Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration
- Neurowissenschaftliches Forschungzentrum, NeuroCure Cluster of Excellence, Charité–Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Germany
- Developmental Biology/Signal Transduction Group, Max Delbrueck Center for Molecular Medicine (MDC) in the Helmholtz Society, Germany
- Department of Neuropediatrics, Charité–Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Germany
Figures
Figure 1 with 1 supplement
Expression of Tnf, Hgf, and Met during muscle regeneration.
(A, B) Expression dynamics of Tnf (A) and Hgf (B) in uninjured and regenerating muscle tissue determined by qPCR. (C) Expression dynamics of Hgf in quiescent and activated muscle stem cells and in …
-
Figure 1—source data 1
Quantification of Tnf, Hgf and Met expression represented in the diagrams shown in A-D.
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Expression levels of Hgf in quiescent (freshly isolated) and proliferating muscle stem cells at various time points defined by microarray analysis (Liu et al., 2013; Latroche et al., 2017).
The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars …
Figure 2
Mutation of Met impairs muscle regeneration.
(A–D) Immunohistological analysis of regenerating (7 days post injury [dpi] and 20 dpi) muscle of control and coMet mutants using antibodies against laminin (red) and sarcomeric myosin (green). DAPI …
-
Figure 2—source data 1
Quantification of fiber diameters represented in the diagrams shown in E, J and O.
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig2-data1-v2.xlsx
Figure 3 with 1 supplement
Mutation of Met reduces the muscle stem cell pool during regeneration.
(A–D) Immunohistological analysis of uninjured and regenerating (7 days post injury [dpi]) muscle of control and coMet mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as …
-
Figure 3—source data 1
Quantification of PAX7+ cells represented in the diagrams shown in E, F, K, L, Q and R (Figure 3).
Quantification of recombination efficiency of the Metflox allele represented in the diagrams shown in B, C and D (Figure 3—figure supplement 1).
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Recombination efficiency and schematic drawing of the different Pax7Cre alleles.
(A) Cartoon showing the unspliced transcripts from the Metflox allele before and after Cre-dependent excision of exon 17. Arrows mark position of qPCR primers used to determine the recombination …
Figure 4 with 1 supplement
Expression of Cxcl12 and Cxcr4 during regeneration.
(A) Expression dynamics of Cxcl12 in uninjured and regenerating muscle tissue determined by qPCR. (B) Expression levels of Cxcl12 in quiescent and activated muscle stem cells and in muscle tissue …
-
Figure 4—source data 1
Quantification of Cxcl12 and Cxcr4 expression represented in the diagrams shown in A-C.
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Expression levels of Cxcl12 in quiescent (freshly isolated) and proliferating muscle stem cells at various time points defined by microarray analysis (Liu et al., 2013; Latroche et al., 2017).
The microarray data sets were obtained from the GEO Database under the accession numbers GSE103684 and GSE47177. Symbols represent the mean of three independent biological replicates, error bars …
Figure 5 with 2 supplements
Cxcr4 and Met cooperate during muscle regeneration.
(A–D) Immunohistological analysis of regenerating (7 days post injury [dpi]) muscle of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mice using antibodies against laminin (red) and sarcomeric …
-
Figure 5—source data 1
Quantification of fiber diameters, PAX7+ cells and fibrotic area represented in the diagrams shown in E, J (Figure 5), E (Figure 5—figure supplement 1) and E, F (Figure 5—figure supplement 2).
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Mutations of Cxcr4 and Met in muscle stem cells did not affect muscle stem cell numbers.
(A–D) Immunohistological analysis of uninjured muscle of control, TxGakaCxcr4, TxGakaMet, andTxGakaCxcr4;Met mice using antibodies against laminin (red) and PAX7 (green). DAPI was used as a …
Figure 5—figure supplement 2
Increased fibrosis in the regenerating muscle of Met and Cxcr4;Met mutants.
(A–D, A′–D′) Immunohistological analysis of regenerating muscle at 7 days post injury (dpi) of control, TxGakaCxcr4, TxGakaMet, and TxGakaCxcr4;Met mutants using antibodies against F4/80 (red in A–D,…
Figure 6 with 2 supplements
Cxcr4;Met mutant muscle stem cells undergo apoptosis after acute injury.
(A–D, A′–D′) Immunohistological analysis of apoptotic cells. PAX7 antibody staining (red) was combined with TUNEL assay (green) to identify apoptotic muscle stem cells in injured muscle of control, …
-
Figure 6—source data 1
Quantification of PAX7+TUNEL+ and PAX7+ cells represented in the diagrams shown in E and F (Figure 6).
Quantification of EdU+PAX7+ cells represented in the diagram shown in E (Figure 6—figure supplement 1). Quantification of MYOG+ and PAX7+ cells represented in the diagrams shown in E and F (Figure 6—figure supplement 2).
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Enhanced proliferation of PAX7+ cells in Cxcr4;Met mutants during regeneration.
(A–D) Identification of proliferating muscle stem cells by EdU incorporation in regenerating muscle of (A) control, (B) TxGakaCxcr4, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury …
Figure 6—figure supplement 2
Differentiation is mildly enhanced in Met and Cxcr4;Met mutants during regeneration.
(A–D) Identification of differentiating myogenic cells in regenerating muscle of (A) control, (B) TxGakaCxcr4, (C) TxGakaMet, and (D) TxGakaCxcr4;Met mice at 4 days post injury (dpi) using …
Figure 7 with 1 supplement
CXCL12 and HGF protect muscle cells from TNFα-induced cell death.
(A–C) Primary muscle stem cells were isolated and cultured for 3 hr in the presence of TNFα plus/minus HGF and Cxcl12. Apoptotic cells were identified by TUNEL staining. (D) Quantification of TUNEL+ …
-
Figure 7—source data 1
Quantification of TUNEL+, PAX7+ and PAX7+TUNEL+ cells represented in the diagrams shown in D, G, H, K, L, O and P (Figure 7).
Quantification of TUNEL+ cells represented in the diagram shown in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/57356/elife-57356-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Neutralizing capacity of TNFα antibody used in Figure 7.
C2C12 cells were cultured for 24 hr in the presence of TNFα plus/minus different concentration of neutralizing TNFα antibody. Apoptotic cells were identified by TUNEL staining and quantified.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Guinea pig polyclonal anti-PAX7 | Our lab | PMID:22940113 | 1:2500 |
| Antibody | Rabbit polyclonal anti-Laminin | Sigma-Aldrich | L9393RRID:AB_477163 | 1:500 |
| Antibody | Goat polyclonalanti-CollagenIV | Millipore | AB769RRID:AB_92262 | 1:500 |
| Antibody | Mouse monoclonalanti-sarcomeric myosin | DSHB | MF20RRID:AB_2147781 | 1:10 |
| Antibody | Rabbit polyclonalanti-Myogenin | Abcam | ab124800RRID:AB_10971849 | 1:1000 |
| Antibody | Mouse monoclonal anti-F4/80 | Abcam | ab6640RRID:AB_1140040 | 1:100 |
| Antibody | Rabbit polyclonal anti-fibronectin | Sigma-Aldrich | F7387RRID:AB_476988 | 1:500 |
| Antibody | Cy2, Cy3, Cy5 conjugated antibodies | Dianova | 1:500 | |
| Commercial assay or kit | In Situ Cell Death Detection Kit | Roche | 12156792910 | |
| Commercial assay or kit | EdU | baseclick GmbH | BCK-EdU647 | |
| Commercial Assay or kit | qPCR SYBR Green Mix | ThermoFisher | AB1158B | |
| Sequence-based reagent | ATCCACGATGTTCATGAGAG | Eurofins | N/A | qPCR HGF (forward primer) |
| Sequence-based reagent | GCTGACTGCATTTCTCATTC | Eurofins | N/A | qPCR HGF (reverse primer) |
| Sequence-based reagent | CACAGAAAGCATGATCCGCGACGT | Eurofins | N/A | qPCR TNF (forward primer) |
| Sequence-based reagent | CGGCAGAGAGGAGGTTGACTTTCT | Eurofins | N/A | qPCR TNF (reverse primer) |
| Sequence-based reagent | CAGAGCCAACGTCAAGCA | Eurofins | N/A | qPCR Cxcl12 (forward primer) |
| Sequence-based reagent | AGGTACTCTTGGATCCAC | Eurofins | N/A | qPCR Cxcl12 (reverse primer) |
| Sequence-based reagent | CATTTTGGCTGTGTCTATCATG | Eurofins | N/A | qPCR Met (forward primer) |
| Sequence-based reagent | ACTCCTCAGGCAGATTCCC | Eurofins | N/A | qPCR Met (reverse primer) |
| Sequence-based reagent | TCAGTGGCTGACCTCCTCTT | Eurofins | N/A | qPCR CXCR4 (forward primer) |
| Sequence-based reagent | CTTGGCCTTTGACTGTTGGT | Eurofins | N/A | qPCR CXCR4 (reverse primer) |
| Sequence-based reagent | CATTTTGGCTGTGTCTATCATG | Eurofins | N/A | qPCR Met Exon 17 (forward primer) |
| Sequence-based reagent | ACTCCTCAGGCAGATTCCC | Eurofins | N/A | qPCR Met Exon 18 (reverse primer) |
| Sequence-based reagent | CTTGCCAGAGACATGTACGAT | Eurofins | N/A | qPCR Met Exon 20 (forward primer) |
| Sequence-based reagent | AGGAGCACACCAAAGGACCA | Eurofins | N/A | qPCR Met Exon 21 (reverse primer) |
| Sequence-based reagent | CCAGTTGGTAACAATGCCATGT | Eurofins | N/A | qPCR β-actin (forward primer) |
| Sequence-based reagent | GGCTGTATTCCCCTCCATCG | Eurofins | N/A | qPCR β-actin (reverse primer) |
| Sequence-based reagent | ACTAGGCTCCACTCTGTCCTTC | Eurofins | PMID:19554048 | Genotyping PCR-Primer 1 Pax7CreERT2Fan |
| Sequence-based reagent | GCAGATGTAGGGACATTCCAGTG | Eurofins | PMID:19554048 | Genotyping PCR-Primer 2 Pax7CreERT2Fan |
| Sequence-based reagent | GCTGCTGTTGATTACCTGGC | Eurofins | PMID:21828091 | Genotyping PCR-Primer 1 Pax7CreERT2GaKa |
| Sequence-based reagent | CTGCACTGAGACAGGACCG | Eurofins | PMID:21828091 | Genotyping PCR-Primer 2 Pax7CreERT2GaKa |
| Sequence-based reagent | GCTGCTGTTGATTACCTGGC | Eurofins | PMID:21828091 | Genotyping PCR-Primer 1 Pax7CreERT2GaKa |
| Sequence-based reagent | GCTCTGGATACACCTGAGTCT | Eurofins | PMID:15520281 | Genotyping PCR-Primer 1 Pax7-IRESCre |
| Sequence-based reagent | GGATAGTGAAACAGGGGCAA | Eurofins | PMID:15520281 | Genotyping PCR-Primer 2 Pax7-IRESCre |
| Sequence-based reagent | TCGGCCTTCTTCTAGGTTCTGCTC | Eurofins | PMID:15520281 | Genotyping PCR-Primer 3 Pax7-IRESCre |
| Sequence-based reagent | CCACCCAGGACAGTGTGACTCTAA | Eurofins | PMID:15520246 | Genotyping PCR-Primer 1 Cxcr4 flox |
| Sequence-based reagent | GATGGGATTCTGTATGAGGATTAGC | Eurofins | PMID:15520246 | Genotyping PCR-Primer 2 Cxcr4 flox |
| Sequence-based reagent | CCAAGTGTCTGACGGCTGTG | Eurofins | N/A | Genotyping PCR-Primer 1 Met flox |
| Sequence-based reagent | AGCCTAGTGGAATTCTCTGTAAG | Eurofins | N/A | Genotyping PCR-Primer 2 Met flox |
Additional files
-
Supplementary file 1
Tnf, Hgf, and Cxcl12 expression levels during muscle regeneration.
Expression levels of Tnf, Hgf, and Cxcl12 mRNA after acute injury were determined in the entire muscle by qPCR. Uninjured and 1–7 days post injury (dpi) were assessed, and expression was normalized to the expression in the uninjured muscle. The values are displayed as means ± SEM. p-Values are shown in brackets. β-Actin was used for normalization.
- https://cdn.elifesciences.org/articles/57356/elife-57356-supp1-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/57356/elife-57356-transrepform1-v2.docx
