TAZ inhibits glucocorticoid receptor and coordinates hepatic glucose homeostasis in normal physiological states
- Division of Endocrinology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Branch of the National Clinical Research Center for Metabolic Disease, China
- Division of Endocrinology, Boston Children’s Hospital, Harvard Medical School, United States
- Cancer Center, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, China
- Department of Gastrointestinal Surgery, The First Affiliated Hospital of Jinan University, China
- Department of Biliary-Pancreatic Surgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, China
- Department of Pathology, Beth Israel Deaconess Medical Center, United States
- College of Science, Northeastern University, United States
- Department of Systemic Biology, Harvard Medical School, United States
- Transplantation Research Center, Brigham and Women’s Hospital, Harvard Medical School, United States
- Department of Pediatrics, Harvard Medical School, United States
Figures
Figure 1 with 3 supplements
humanTAZ protein is regulated by fasting and feeding in hepatocytes.
8- to 12-week-old C57BL/6J mice were ad libitum-fed (non-fasted) or fasted for 24 hr (fasted). (A–D) Hepatic proteins were measured by immunoblotting whole-cell lysates (A; quantified results are shown in B) or nuclear (Nuc) or cytoplasmic (Cyto) extracts (C; quantified results are shown in D). (E) Immunohistochemical staining for TAZ in the livers of mice fed ad libitum or fasted for 24 hr (CV, central vein; PV, portal vein; scale bar, 500 μM). (F, G) Protein levels were measured by immunoblotting lysates of pericentral and periportal mouse hepatocytes (F) or hepatocytes isolated from mice that were ad libitum-fed or fasted for 24 hr (G). (H) mRNA expression of hepatic mRNA expression of hepatic Taz was measured using real-time qRT-PCR. Data are means and SEMs; control values were set to 1; n = 6. Representative results of 2–3 independent experiments are shown. Data were analyzed by unpaired Student’s t-test; **p<0.01, ***p<0.001.
Figure 1—figure supplement 1
Hepatic gene expression in ad libitum-fed and fasted (24 hr) mouse livers.
(A) Gluconeogenic genes. (B) TAZ target gene involved in proliferation.
Figure 1—figure supplement 2
Validation of immunohistochemical staining for TAZ in control and L-TAZ KO liver sections.
Immunohistochemistry using an anti-TAZ antibody in L-TAZ KO and control floxed (Flox) mouse liver sections (CV, central vein; PV, portal vein; scale bar, 50 μM).
Figure 1—figure supplement 3
mRNA and protein expression of TAZ in primary mouse hepatocytes.
Primary mouse hepatocytes were incubated in low glucose media (1 g/L) without fetal bovine serum (FBS) for overnight and then placed in high glucose media (4.5 g/L) with FBS for the indicated times. Protein levels (A) and mRNA expression (B) were measured. Data are means and SEMs of triplicated wells. Data were analyzed by one-way ANOVA.
Figure 2 with 5 supplements
Knockdown or knockout of hepatic TAZ increases gluconeogenic gene expression and blood glucose concentrations in mice.
(A–G) 8- to 12-week-old C57BL/6J mice were administered AdshTAZ or AdshControl (AdshCon), then sacrificed 8 days later in the ad libitum-fed state, when the mRNA expression of hepatic genes (A, C) and the corresponding protein levels (B, D, and E [quantified results of D]) were measured. (F) Ad libitum-fed and fasting blood glucose concentrations were measured. (G) Six days after adenoviral injection, the mice underwent pyruvate tolerance testing (PTT) (left) and the areas under the curves (AUCs) were calculated (right); p<0.001 AdshTAZ versus AdshCon. (H–M) 10- to 12-week-old, age- and sex-matched L-TAZ KO and floxed (Flox) control littermates were studied. (H, I) TAZ protein was measured in whole liver cell lysates (H) or isolated hepatocytes (I) by immunoblotting. (J, K) Ad libitum-fed and fasting blood glucose concentrations were measured. (L, M) Mice underwent PTT; p<0.001 L-TAZ KO versus Flox. Data are means and SEMs; control values were set to 1 (A, C, E); n = 7–10. Representative results of 2–3 independent experiments are shown. Data were analyzed by unpaired Student’s t-test (A, C, E–F, G [right], J–K, L–M [right]) and two-way ANOVA (G [left] and L–M [left]); *p<0.05, **p<0.01, ***p<0.001.
Figure 2—figure supplement 1
Information on mice administered AdshTAZ or AdshCon.
Body (A), epididymal white adipose tissue (WAT) (B), and liver weight (C) were measured. (D) H&E staining of liver sections (scale bar, 50 μM). Data were analyzed by unpaired Student’s t-test; **p<0.01.
Figure 2—figure supplement 2
TAZ knockdown has no effects on protein expression of key gluconeogenic factors and insulin and glucagon signaling in mice.
Hepatic proteins were measured by immunoblotting whole-cell lysates.
Figure 2—figure supplement 3
TAZ knockdown has no effects on plasma insulin and glucagon concentrations in the ad libitum-fed state.
Plasma insulin (A) and glucagon (B) were measured. Data were analyzed by unpaired Student’s t-test.
Figure 2—figure supplement 4
Information on L-TAZ KO and flox mice.
Body (A) and liver weight (B) were measured. (C) H&E staining of liver sections (scale bar, 50 μM). Data were analyzed by two-way ANOVA (A) and unpaired Student’s t-test (B).
Figure 2—figure supplement 5
L-TAZ KO has no effects on insulin sensitivity.
(A) Hepatic proteins were measured by immunoblotting whole-cell lysates. (B, C) Insulin sensitivity was assessed by intraperitoneal insulin tolerance test (ITT). Glucose percentages relative to the basal blood glucose concentration (B) are plotted. Data were analyzed by two-way ANOVA.
Figure 3 with 2 supplements
Overexpression of hepatic TAZ inhibits gluconeogenic gene expression and reduces blood glucose concentration in mice.
8- to 12-week-old C57BL/6J mice were administered AdGFP or AdTAZ, then sacrificed 5 days later, after a 24 hr fast, when the hepatic protein levels in nuclear extracts (A [representative image, left; quantified results, right]), isolated pericentral hepatocytes (B), or whole-cell lysates (E, F [quantified results of E]) were measured. Blood glucose (C) and mRNA expression of hepatic genes (D) were measured. (G, H) Five days after adenoviral injection, the mice underwent glucagon challenge (G) or pyruvate tolerance testing (PTT) (H); p<0.001 L-TAZ KO versus Flox. Data are means and SEMs; control values were set to 1 (A, D, F); n = 5–10. Representative results of 2–3 independent experiments are shown. Data were analyzed by unpaired Student’s t-test (A, C, D, F, G [right], H [right]) and two-way ANOVA (G [left], H [left]); *p<0.05, **p<0.01, ***p<0.001.
Figure 3—figure supplement 1
Immunohistochemical staining for TAZ in livers of mice administered AdTAZ or control AdGFP and fasted for 24 hr.
CV, central vein; PV, portal vein; scale bar, 500 μM.
Figure 3—figure supplement 2
Information on mice administered AdTAZ or control AdGFP.
Mouse body weight (A), epididymal white adipose tissue weight (WAT) weight (B), liver weight (C), and plasma insulin (F, left) and glucagon (F, right) levels were measured. (D) H&E staining of liver sections (scale bar, 50 μM). (E) Hepatic proteins were measured by immunoblotting whole-cell lysates. Data were analyzed by unpaired Student’s t-test; *p<0.05.
Figure 4 with 3 supplements
The inhibition of gluconeogenic gene expression by TAZ is hepatocyte-autonomous.
Primary mouse hepatocytes were isolated from 8- to 12-week-old C57BL/6J mice. (A–D) To knock down TAZ, cells were infected with AdshTAZ or AdshControl (AdshCon). (E–H) To overexpress TAZ, cells were infected with AdTAZ or AdGFP. Cells were treated with glucagon (20 nM) for 3 hr (B, F) or dexamethasone (Dex, 100 nM) for 6 hr (C, G). (A [left]–C, F, G) Gene expression was measured using real-time RT-PCR. (A [right], E) TAZ protein levels were measured by immunoblotting whole-cell lysates and the quantified results of (E) are shown on the right. (D, H) Glucose production, in the presence of glucagon (20 nM), was assessed by measuring the glucose concentration in the media at the indicated times. Data are means and SEMs of three wells; control values were set to 1. Data were analyzed by unpaired Student’s t-test (A, E) and two-way ANOVA (B–D and F–H). *p<0.05, **p<0.01, ***p<0.001 versus control adenovirus-treated cells; in (B–D) and (F–H), #p<0.05, ###p<0.001 versus similarly treated controls. Representative results of 2–5 independent experiments are shown.
Figure 4—figure supplement 1
The effect of TAZ on the induction of glycogen synthase by dexamethasone (Dex).
Primary mouse hepatocytes were infected with AdTAZ or control AdGFP and were treated with Dex (100 nM) for 6 hr. Gene expression was measured using real-time RT-PCR. Data were analyzed by two-way ANOVA. **p<0.01 versus control adenovirus-treated cells; ##p<0.01 versus similarly treated controls.
Figure 4—figure supplement 2
Protein expression in primary mouse hepatocytes in the presence of TAZ knockdown or overexpression.
Cells were infected with AdshTAZ or AdshCon (A) or AdTAZ or AdGFP (B). Protein levels were measured by immunoblotting whole-cell lysates.
Figure 4—figure supplement 3
TAZ knockdown or overexpression in primary hepatocytes has no effects on insulin or glucagon signaling.
Cells were infected with AdshTAZ or AdshCon (A, B) or AdTAZ or AdGFP (C, D). Protein levels were measured by immunoblotting whole-cell lysates. Cells were treated with glucagon (20 nM) for 30 min (A, C) or insulin (20 nM) for 10 min (B, D).
Figure 5 with 3 supplements
TAZ interacts with glucocorticoid receptor (GR) and inhibits the transactivation of gluconeogenic genes by GR.
(A–D, G, K, L, N, O) HepG2 cells were co-transfected with expression vectors, luciferase reporters, and an internal control (Renilla), and treated with dexamethasone (Dex; 100 nM), as indicated. Relative luciferase activity (RLA) is presented after normalization to the Renilla activity. (E, F, M, Q) 293A cells were transfected with expression vectors, which was followed by immunoprecipitation and immunoblotting, as indicated. (H–J, R, S) Primary mouse hepatocytes were infected with adenoviruses, with or without glucagon or Dex treatment. (R, S) Cells were treated with RU486 30 min prior to glucagon treatment. Protein levels (H) and gene expression (I, J, R, S) were measured by immunoblotting and real-time RT-PCR, respectively. (P) Chromatin immunoprecipitation (ChIP) assays were performed using an anti-GR antibody or a control IgG. The relative enrichment of GR was assessed using real-time RT-PCR, and primers for the indicated regions of the Pck1 and G6pc genes were performed using an anti-GR antibody or a control IgG. Data are means and SEMs of three or four wells or immunoprecipitation reactions. Representative results of 2–5 independent experiments are shown. Data were analyzed by one-way ANOVA (A–D, G, K, L, N, O) and two-way ANOVA (I, J, P, R, S). *p<0.05, **p<0.01, ***p<0.001, #p<0.05, ##p<0.01, ###p<0.001. In (A–D, G, K, L, N, O), * denotes comparisons with wells treated with GR/Dex or GR/PGC1α/Dex alone; in (I, J R, S), # denotes comparisons with controls administered the same viruses; in (P), # denotes a comparison with IgG.
-
Figure 5—source data 1
A conserved I/LPKY motif is identified in glucocorticoid receptor (GR) from various species.
Highlighted in red.
- https://cdn.elifesciences.org/articles/57462/elife-57462-fig5-data1-v2.eps
Figure 5—figure supplement 1
TAZ inhibits PCK-Luc activity.
(A, C) HepG2 cells were co-transfected with expression vectors, luciferase reporters, and an internal control (Renilla), and treated with dexamethasone (Dex) (100 nM), as indicated. Relative luciferase activity (RLA) is presented. (B) Cells were co-transfected with a flag-TAZ expression vector and a TAZ knockdown vector, or a control vector, as indicated, and TAZ expression was measured by immunoblotting whole-cell lysates. Data are means and SEMs of triplicated wells; controls were set to 1. Data were analyzed by one-way ANOVA. **p<0.01 denotes comparisons with wells treated with GR/PGC1α/HNF4α/Dex alone.
Figure 5—figure supplement 2
Effects of TAZ mutants on TEAD transactivation.
293A A cells were co-transfected with expression vectors, luciferase reporters, and an internal control (Renilla), and treated with dexamethasone (Dex) (100 nM), as indicated. Relative luciferase activity (RLA) is presented. Data are means and SEMs of triplicated wells; control was set to 1. Data were analyzed by one-way ANOVA. **p<0.01 and ***p<0.001 denotes comparisons with wells transfected with TEAD4 alone.
Figure 5—figure supplement 3
TAZ has no effects on glucocorticoid receptor (GR) nuclear localization or the amounts of GR dimer.
(A) 293A A cells were transfected with expression vectors for GR fused with a GFP, TAZ, or a control empty vector (Con), and treated with dexamethasone (Dex) (100 nM) or vehicle for 6 hr prior to fixation and DAPI staining. GFP-GR distribution was examined by a fluorescent microscope. (B) 293A A cells were transfected with expression vectors for GR, TAZ, or a control empty vector for 48 hr. Cells were then treated with dithiobis (succinimidyl propionate) (DSP) (3 µM) for 30 minutes on ice, and GR dimer was measured by immunoblotting whole-cell lysates.
Figure 6 with 2 supplements
TAZ represses glucocorticoid receptor (GR) transactivation of gluconeogenic genes in mouse liver.
(A, G) Endogenous TAZ was immunoprecipitated from liver nuclear extracts prepared from ad libitum-fed C57BL/6J mice (A) or mice treated with RU486 or vehicle (G), and the amounts of GR in the immunoprecipitates were measured by immunoblotting. C57BL/6J mice were administered AdshTAZ or AdshCon, as in Figure 2 (B, C, H) or AdTAZ or AdGFP, as in Figure 3 (D–F and K–N). (I, J) L-TAZ KO and control mice. (H–N) Mice were treated with RU486 (RU) or vehicle (V), as indicated. The relative enrichment of GR (B, D, N), acetylated-histone 4 (Ac-H4) (C, E, N), and Pol II (F) in the liver extracts was assessed using chromatin immunoprecipitation (ChIP) assays. (H, I, K) Blood glucose concentration. (L) Hepatic gene expression. (J, M) Pyruvate tolerance testing (PTT). Data are means and SEMs; n = 5–8; for ChIP, the data are the results of triplicate or quadruplicate immunoprecipitations. Data were analyzed by two-way ANOVA (B–F, I, J, M, N) and unpaired Student’s t-test (H, K, L). *p<0.05, **p<0.01, ***p<0.001, #p<0.05, ##p<0.01, ###p<0.001; in (B–F, N), # denotes comparisons with IgG; in (I, J), # denotes comparisons with vehicle-treated controls of the same genotype; NS, not significant.
Figure 6—figure supplement 1
TAZ does not bind to gluconeogenic gene promoters.
8- to 12-week-old male C57BL/6J mice were administered adenoviruses expressing TAZ (flag-tagged) or GFP for 5 days. Chromatin immunoprecipitation (ChIP) assays were performed from liver extracts using indicated antibodies. Data are means and SEMs of 3–4 immunoprecipitates. Data were analyzed by two-way ANOVA; * p<0.05, **p<0.01, #p<0.05, ##p<0.01, ###p<0.001; # denotes comparisons with IgG.
Figure 6—figure supplement 2
Blood glucose concentrations and hepatic gene expression of mice administered AdTAZ and dexamethasone (Dex).
8- to 12-week-old C57BL/6J J mice were administered adenoviruses expressing TAZ or GFP for 5 days. Mice were treated with Dex or vehicle. Blood glucose (A) and hepatic gene expression (B) were measured. Data were analyzed by one-way ANOVA; *p<0.05, **p<0.01, ***p<0.001.
Figure 7 with 1 supplement
The inhibition of gluconeogenic gene expression by TAZ requires its WW domain.
C57BL/6J mice (A–D) or (E) C57BL/6J mice were ad libitum-fed (non-fasted) or fasted for 24 hr. (A) Blood glucose. (B) Pyruvate tolerance testing (PTT). (C) Hepatic gene expression. (D, E) Chromatin immunoprecipitation (ChIP) assays were conducted using the indicated antibodies. (F) Regulation of gluconeogenic gene expression by TAZ in the fed and fasting states. Data are means and SEMs; n = 5–8; except for (D) and (E), in which the data are the results of triplicate or quadruplicate immunoprecipitations. Data were analyzed by one-way ANOVA (A, B [right], C), two-way ANOVA (B [left], D, E). *p<0.05, **p<0.01, ***p<0.001, #p<0.05, ##p<0.01, ###p<0.001. In (B), * denotes comparisons with AdGFP and # denotes comparisons between AdS89A and AdTAZΔWW; in (D, E), # denotes comparisons with IgG.
Figure 7—figure supplement 1
Body and liver mass and hepatic TAZ expression in mice administered AdTAZ mutants or AdGFP.
Mice were administered adenoviruses expressing TAZ mutants (flag-tagged) or GFP for 5 days. Body weight (A) and liver weight (B) were measured, and hepatic protein levels (C) were measured by immunoblotting whole -cell lysates. Data were analyzed by one-way ANOVA; **p<0.01, ###p<0.001.
Figure 8 with 1 supplement
TAZ regulates glucose production in insulin-resistant states.
(A–C) 8- to 10-week-old L-DKO or flox controls were administered the indicated adenoviruses. (A) Blood glucose. (B) Pyruvate tolerance testing (PTT). (C) Hepatic gene expression. (D) 4- to 6-week-old C57BL/6J mice were fed chow or a high-fat diet (HFD) for 2 months. Mice that were ad libitum-fed or fasted for 24 hr were compared, and hepatic TAZ expression was measured by immunoblotting whole-cell lysates. (E, F) 4- to 6-week-old L-TAZ KO and floxed control littermates were fed an HFD for 2 months. Mice underwent PTT (E, left) or insulin tolerance test (ITT) (F, left) and the areas under the curves were calculated (right). Data are means and SEMs; n = 5–8. Data were analyzed by unpaired Student’s t-test (A, C, E [right], F [right]) or two-way ANOVA (B , E [left], F [left]); *p<0.05, **p<0.01, ***p<0.001; in (B), # denotes comparisons with flox mice administered the same virus.
Figure 8—figure supplement 1
L-DKO and flox mice administered AdTAZS89A.
(A) Hepatic proteins were measured by immunoblotting nuclear (Nuc) or cytoplasmic (Cyto) extracts of L-DKO and flox control mice. (B, C) Female L-DKO and flox controls were administered adenoviruses expressing TAZ or GFP. Body (B) and liver (C) weight were measured. Data were analyzed by unpaired Student’s t-test. *p<0.05, ***p<0.001.
Author response image 1
PTT data plotted using SEM and SD.
Figures 2G (A), 2L (C), and 2M (E), which are plotted using SEM, are compared with Figures R1B, R1D, and R1F, respectively, which are plotted using SD.
Author response image 2
Hepatic TAZ protein expression in hyperglycemic and insulin resistant mouse models.
Hepatic TAZ protein expression was measured by immunoblotting liver cytoplasmic (Cyto) and nuclear (Nucl) fractions.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | C57BL/6J | Jackson Laboratory | Stock #: 000664 RRID:IMSR_JAX:000664 | |
| Genetic reagent (M. musculus) | Tazflox/flox: Yapflox/flox | Jackson Laboratory | Stock #: 030532RRID:IMSR_JAX:030532 | |
| Genetic reagent (M. musculus) | Albumin-Cre | Jackson Laboratory | Stock #: 003574RRID:IMSR_JAX:003574 | |
| Genetic reagent (M. musculus) | Tazflox/flox: Alb-Cre | This paper | See ‘Animals and treatments’ in Materials and methods | |
| Cell line (Homo sapiens) | HepG2 | ATCC | Cat. #: HB-8065RRID:CVCL 0027 | |
| Cell line (H. sapiens) | 293A | Thermo Fisher Scientific | Cat. #: R70507RRID:CVCL_6910 | |
| Commercial assay or kit | BLOCK-iT U6 RNAi entry vector kit | Thermo Fisher Scientific | Cat. #: K494500 | |
| Commercial assay or kit | BLOCK-iT U6 adenoviral RNAi expression system | Thermo Fisher Scientific | Cat. #: K494100 | |
| Commercial assay or kit | Stellux Chemiluminscence rodent insulin ELISA kit | Alpco | Cat. #:80-INSMR-CH01 | |
| Commercial assay or kit | Mouse glucagon ELISA kit | Alpco | Cat. #:48-GLUHU-E01 | |
| Commercial assay or kit | Dual-luciferase reporter assay kit | Promega | Cat. #: E1960 | |
| Commercial assay or kit | VIP substrate Kit, HRP | Vector Laboratories | Cat. #: SK-4600 RRID:AB_2336848 | PMID:28123024 |
| Commercial assay or kit | Mutagenesis kit | Agilent | Cat. #: 210,519 | |
| Commercial assay or kit | cDNA synthesis kit | Thermo Fisher Scientific | Cat. #: 4368813 | |
| Commercial assay or kit | NE-PER Nuclear and Cytoplasmic Extraction kit | Thermo Fisher Scientific | Cat. #: 78835 | |
| Commercial assay or kit | Amplex glucose oxidase assay kit | Thermo Fisher Scientific | Cat. #: A22189 | |
| Recombinant DNA reagent | pCMV-TOPO TAZ (human) | Addgene | Cat. #: 24809 RRID:Addgene_24809 | PMID:18568018 |
| Recombinant DNA reagent | pcDNA3-flag-TAZ (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pcDNA3-flag-TAZ S51A (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pcDNA3-flag-TAZ S89A (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pCMV-TOPO TAZΔWW (human) | Addgene | Cat. #: 24811RRID:Addgene_24811 | PMID:18568018 |
| Recombinant DNA reagent | pCMV-TOPO TAZΔCC (human) | Addgene | Cat. #: 24816 RRID:Addgene_24816 | PMID:18568018 |
| Recombinant DNA reagent | pcDNA3-flag-TAZΔWW (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pcDNA3-flag- TAZΔCC (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pcDNA3-flag-TAZ WW | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pGL3-3XGRE-Luc | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pGL3-G6PC-Luc (human) | Dr. Pere Puigserver | ||
| Recombinant DNA reagent | pGL3-PCK1-Luc (human) | Dr. Pere Puigserver | ||
| Recombinant DNA reagent | pcDNA3-HNF4 α (mouse) | Dr. Pere Puigserver | ||
| Recombinant DNA reagent | pcDNA3-PGC1α (mouse) | Dr. Pere Puigserver | ||
| Recombinant DNA reagent | pEGFP-GR | Addgene | Cat. #: 47504 RRID:Addgene_47504 | |
| Recombinant DNA reagent | pcDNA3-GR (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pcDNA3-GR4A (human) | This paper | See ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | 8xGTIIC-Luc | Addgene | Cat. #: 34615 RRID:Addgene_34615 | PMID:21654799 |
| Recombinant DNA reagent | pcDNA3-Flag-YAP1 (human) | Addgene | Cat. #: 18881 RRID:Addgene_18881 | PMID:18280240 |
| Recombinant DNA reagent | pRK5-TEAD1 (human) | Addgene | Cat. #: 33109 RRID:Addgene_33109 | PMID:18579750 |
| Recombinant DNA reagent | pAd-Track-CMV-GFP | Addgene | Cat. #: 16405 RRID:Addgene_16405 | PMID:9482916Construct to establish adenovirus |
| Recombinant DNA reagent | pAd-Track-CMV-Flag-TAZ (human) | This paper | Construct to establish adenovirus expressing TAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pAd-Track-CMV-Flag-TAZΔWW (human) | This paper | Construct to establish adenovirus expressing TAZΔWW; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | pAd-Track-CMV-Flag-TAZS89A (human) | This paper | Construct to establish adenovirus expressing TAZS89A; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | U6-shLamin (human) | This paper | Control for shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | U6-shTAZ (human) | This paper | Construct to knockdown TAZ in HepG2 cells; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | U6-shLacZ | This paper | Construct to establish adenovirus expressing shControl; control for shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | U6-shTAZ (mouse) | This paper | Construct to establish adenovirus expressing shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | Ad-shLacZ | This paper | Control adenovirus expressing shLacZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | Ad-shTAZ (mouse) | This paper | Adenovirus expressing shTAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | Ad-Track-CMV-GFP | This paper | Control adenovirus expressing GFP, generated from pAd-Track-CMV-GFP vector; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | Ad-Track-CMV-flag-TAZ | This paper | Adenovirus generated from pAd-Track-CMV-TAZ; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | Ad-Track-CMV-flag-TAZΔWW | This paper | Adenovirus generated from pAd-Track-CMV-TAZΔWW; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Recombinant DNA reagent | Ad-Track-CMV-flag-TAZS89A | This paper | Adenovirus generated from pAd-Track-CMV-TAZS89A; see ‘Plasmid and adenoviral vector constructs’ in Materials and methods | |
| Sequence-based reagent | shLamin (human) | This paper | CTGGACTTCCAGAAGAACA | |
| Sequence-based reagent | shLacZ | This paper | CTACACAAATCAGCGATTT | |
| Sequence-based reagent | shTAZ (human) | This paper | GCTCAGATCCTTTCCTCAATG | |
| Sequence-based reagent | shTAZ (mouse) | This paper | GCCAGAGATACTTCCTTAATC | |
| Sequence-based reagent | Mouse-Tbp-F | This paper | qRT-PCR primer | ACCTTCACCAATGACTCCTATG |
| Sequence-based reagent | Mouse-Tbp-R | This paper | qRT-PCR primer | TGACTGCAGCAAATCGCTTGG |
| Sequence-based reagent | Mouse-Cry61-F | This paper | qRT-PCR primer | CAAGAAATGCAGCAAGACCA |
| Sequence-based reagent | Mouse-Cry61-R | This paper | qRT-PCR primer | GGCCGGTATTTCTTGACACT |
| Sequence-based reagent | Mouse-Ctgf-F | This paper | qRT-PCR primer | TCCACCCGAGTTACCAATGA |
| Sequence-based reagent | Mouse-Ctgf -R | This paper | qRT-PCR primer | CAAACTTGACAGGCTTGGC |
| Sequence-based reagent | Mouse-G6pc-F | This paper | qRT-PCR primer | TGGCTTTTTCTTTCCTCGAA |
| Sequence-based reagent | Mouse-Pck1-F | This paper | qRT-PCR primer | TCGGAGACTGGTTCAACCTC |
| Sequence-based reagent | Mouse-Pck1-R | This paper | qRT-PCR primer | GAGGGACAGCAGCACCAT |
| Sequence-based reagent | Mouse-Taz-F | This paper | qRT-PCR primer | ACAGGTGAAAATTCCGGTCA |
| Sequence-based reagent | Mouse-Taz -R | This paper | qRT-PCR primer | GAAGGCAGTCCAGGAAATCA |
| Sequence-based reagent | Mouse-Yap-F | This paper | qRT-PCR primer | AAGCCATGACTCAGGATGGA |
| Sequence-based reagent | Mouse-Yap-R | This paper | qRT-PCR primer | GTTCATGGCAAAACGAGGGTC |
| Sequence-based reagent | Mouse-Ctgf-ChIP-F | This paper | qChIP primer | TTCCTGGCGAGCTAAAGTGT |
| Sequence-based reagent | Mouse-Ctgf-ChIP-R | This paper | qChIP primer | CCTTCCTGCCTCATCAACTC |
| Sequence-based reagent | Mouse-G6pc-ChIP-GRE-F | This paper | qChIP primer | AGCACTGTCAAGCAGTGTGC |
| Sequence-based reagent | Mouse-G6pc-ChIP-GRE-F | This paper | qChIP primer | GCAAAACAGGCACACAAAAA |
| Sequence-based reagent | Mouse-G6pc-ChIP-HNF4E-F | This paper | qChIP primer | CCCTGAACATGTTTGCATCA |
| Sequence-based reagent | Mouse-G6pc-ChIP-HNF4E-R | This paper | qChIP primer | GTAGGTCAATCCAGCCCTGA |
| Sequence-based reagent | Mouse-Pck1-ChIP-Con-F | This paper | qChIP primer | TGGGAGACACACATCTTATTCCA |
| Sequence-based reagent | Mouse-Pck1-ChIP-Con-R | This paper | qChIP primer | GTCCCTCTATAGACTTCCAGCACA |
| Sequence-based reagent | Mouse-Pck1-ChIP-GRE-F | This paper | qChIP primer | TGCAGCCAGCAACATATGAA |
| Sequence-based reagent | Mouse-Pck1-ChIP-GRE-F | This paper | qChIP primer | TGATGCAAACTGCAGGCTCT |
| Sequence-based reagent | Mouse-Pck1-ChIP-HNF4E-F | This paper | qChIP primer | TAAGGCAAGAGCCTGCAGTT |
| Sequence-based reagent | Mouse-Pck1-ChIP-HNF4E-F | This paper | qChIP primer | AGGCCCCTCTATCAGCCATA |
| Antibody | (Rabbit polyclonal) anti-TAZ | Cell Signaling Technology | Cat. #: 4883 RRID:AB_1904158 | PMID:29533785IB (1:1000) |
| Antibody | (Rabbit monoclonal) anti-p-TAZ (Ser89) | Cell Signaling Technology | Cat. #: 59971 RRID:AB_2799578 | IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-AKT | Cell Signaling Technology | Cat. #: 9272 RRID:AB_329827 | PMID:23653460IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-p-AKT (Thr308) | Cell Signaling Technology | Cat. #: 9275 RRID:AB_329828 | PMID:23715867IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-p-AKT (Ser473) | Abclonal | Cat. #: AP0098 RRID:AB_2770899 | IB (1:1000) |
| Antibody | (Mouse monoclonal) anti-beta-actin | Santa Cruz Biotechnology | Cat. #: sc-47778 RRID:AB_2714189 | PMID:28017329IB (1:3000) |
| Antibody | (Rabbit monoclonal) anti-CREB | Cell Signaling Technology | Cat. #: 9197RRID:AB_331277 | PMID:24080368IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-p-CREB (Ser133) | Abclonal | Cat. #: AP0333RRID:AB_2771008 | IB (1:1000) |
| Antibody | (Mouse monoclonal) anti-Flag | Abclonal | Cat. #: AE005RRID:AB_2770401 | IB (1:10000)IP (1 µg/IP)ChIP (1–2 µg/IP) |
| Antibody | (Rabbit polyclonal) anti-Flag | Cell Signaling Technology | Cat. #: 2368 RRID:AB_2217020 | PMID:25514086IB (1:1000) |
| Antibody | (Rabbit monoclonal) anti-FoxO1 | Cell Signalling Technology | Cat. #: 2880 RRID:AB_2106495 | PMID:24248465IB (1:1000) |
| Antibody | (Rabbit monoclonal) anti-p-FoxO1 (Ser256) | Cell Signaling Technology | Cat. #: 84192 RRID:AB_2800035 | PMID:31583122IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-G6PC | Abcam | Cat. #: ab83690 RRID:AB_1860503 | PMID:25774555IB (1:1000) |
| Antibody | (Mouse monoclonal) anti-GAPDH | Santa Cruz Biotechnology | Cat. #: sc-32233 RRID:AB_627679 | PMID:24105481IB (1:1000) |
| Antibody | (Mouse monoclonal) anti-GLUL | BD Biosciences | Cat. #: 610517 RRID:AB_397879 | PMID:17120293IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-GR | Abclonal | Cat. #: A2164 RRID:AB_2764182 | IB (1:3000) |
| Antibody | Goat polyclonal anti-HMGCR | Santa Cruz Biotechnology | Cat. #: sc-27578 RRID:AB_2118199 | PMID:26824363IB (1:1000) |
| Antibody | (Rabbit polyclonal) anti-HNF4α | Santa Cruz Biotechnology | Cat. #: sc-8987 RRID:AB_2116913 | PMID:29937200IB (1:000) |
| Antibody | (Rabbit polyclonal) anti-PGC1α | Abclonal | Cat. #: A12348 RRID:AB_2759191 | IB (1:000) |
| Antibody | (Rabbit monoclonal) anti-Tubulin | Cell SignalingTechnology | Cat. #: 2125 RRID:AB_2619646 | PMID:28343940IB (1:5000) |
| Antibody | (Mouse monoclonal) anti-Vinculin | Santa Cruz Biotechnology | Cat. #: sc-73614 RRID:AB_1131294 | PMID:29017056IB (1:5000) |
| Antibody | (Rabbit polyclonal) anti-YAP | Cell Signaling Technology | Cat. #: 4912 RRID:AB_2218911 | PMID:28323616IB (1:000) |
| Antibody | (Mouse polyclonal) anti-IRS1 | Provided by Dr. Morris White | PMID:29867232IB (1:000) | |
| Antibody | (Mouse polyclonal) anti-IRS2 | Provided by Dr. Morris White | PMID:29867232IB (1:000) | |
| Antibody | (Rabbit polyclonal) anti-Ac-Histone4 | Abclonal | Cat. #: A15233 RRID:AB_2762128 | ChIP (1 µg/IP) |
| Antibody | (Mouse monoclonal) anti-GR | Santa Cruz Biotechnology | Cat. #: Sc-393232 RRID:AB_2687823 | PMID:28467930ChIP (1–2 µg/IP) |
| Antibody | (Rabbit polyclonal) anti-TAZ | Abclonal | Cat. #: A8202 RRID:AB_2721146 | ChIP (1–2 µg/IP)IHC (1: 200) |
| Antibody | Goat anti-(Rabbit polyclonal) IgG-HPR | Thermo Fisher Scientific | Cat. #: 31460RRID:AB_228341 | PMID:24932808IB (1:5000–20,000) |
| Antibody | Goat anti-(Mouse polyclonal) IgG-HRP | Thermo Fisher Scientific | Cat. #: 31430RRID:AB_228307 | PMID:10359649IB (1:5000–20,000) |
| Antibody | Rabbit anti-goat (Rabbit polyclonal) IgG-HRP | Santa Cruz Biotechnology | Cat. #: sc-2768RRID:AB_656964 | PMID:23970784IB (1:5000–15,000) |
| Chemical compound, drug | Glucagon | Sigma | Cat. #: G2044 | |
| Chemical compound, drug | RU486 | Sigma | Cat. #: M8046 | |
| Chemical compound, drug | Dexamethasone | Sigma | Cat. #: D4902 | For cell culture studies |
| Chemical compound, drug | Dexamethasone | Sigma | Cat. #: 2915 | For in vivo studies |
| Chemical compound, drug | Sodium pyruvate | Sigma | Cat. #: P5280 | |
| Chemical compound, drug | Protease inhibitor cocktail tablet | Sigma | Cat. #: S8820 | |
| Chemical compound, drug | Phosphatase inhibitor cocktail tablet | Sigma | Cat. #: 4906837001 | |
| Chemical compound, drug | Bovine insulin | Sigma | Cat. #: I0516 | For cell culture studies |
| Chemical compound, drug | Human insulinHumulin R U-100 | Eli Lily | Cat. #: HI-210 | For in vivo studies |
| Chemical compound, drug | Percoll | Cytiva | Cat. #: 17089109 | |
| Chemical compound, drug | Trizol | Thermo Fisher Scientific | Cat. #: 15596018 | |
| Chemical compound, drug | DSP | Thermo Fisher Scientific | Cat. #: PG82081 | |
| Other | SYBR Green PCR master mix | Bioline | Cat. #: BIO-84050 | |
| Other | Collagen Type I Rat Tail | Corning | Cat. #: 354,236 | |
| Other | Collagenase Type I | Worthington Biochemical Corporation | Cat. #: LS004196 | |
| Other | PVDF membrane | Sigma | Cat. #: IPVH00010 | |
| Other | ECL | Thermo Fisher Scientific | Cat. #: A43841 | |
| Other | Agarose A/G beads | Santa Cruz Biotechnology | Cat. #: sc-2003 RRID:AB_10201400 | PMID:28392145 |
| Other | DMEM cell culture media | Thermo Fisher Scientific | Cat. #: 11965118 | |
| Other | M199 cell culture media | Thermo Fisher Scientific | Cat. #:11043023 | |
| Other | DMEM low glucose cell culture media, no phenol red | Thermo Fisher Scientific | Cat. #:11054020 | |
| Other | Lipofectamine 2000 | Thermo Fisher Scientific | Cat. #: 11668019 | Transfection reagent |
Author response table 1
Blood glucose concentrations (mg/dl) of AdshTAZ- and AdshCon-infected mice during the PTT .
| Time (min) | ||||||
|---|---|---|---|---|---|---|
| Treatment | 0 | 15 | 30 | 60 | 120 | |
| AdshCon | 76 | 91 | 120 | 105 | 73 | |
| AdshCon | 73 | 116 | 139 | 119 | 64 | |
| AdshCon | 76 | 109 | 100 | 86 | 71 | |
| AdshCon | 67 | 93 | 98 | 103 | 72 | |
| AdshCon | 63 | 119 | 119 | 104 | 57 | |
| AdshCon | 78 | 104 | 120 | 83 | 68 | |
| AdshCon | 66 | 96 | 122 | 106 | 67 | |
| AdshTAZ | 96 | 129 | 161 | 168 | 91 | |
| AdshTAZ | 79 | 130 | 149 | 114 | 103 | |
| AdshTAZ | 80 | 122 | 135 | 116 | 105 | |
| AdshTAZ | 105 | 195 | 195 | 116 | 108 | |
| AdshTAZ | 86 | 140 | 162 | 146 | 94 | |
| AdshTAZ | 85 | 130 | 155 | 122 | 89 | |
| AdshTAZ | 102 | 129 | 127 | 125 | 94 | |
| Ave | AdshCon | 71.3 | 104.0 | 116.9 | 100.9 | 67.4 |
| AdshTAZ | 90.4 | 139.3 | 154.9 | 129.6 | 97.7 | |
| SEM | AdshCon | 2.222 | 4.220 | 5.302 | 4.698 | 2.103 |
| AdshTAZ | 3.981 | 9.496 | 8.316 | 7.615 | 2.826 | |
| SD | AdshCon | 5.880 | 11.165 | 14.029 | 12.429 | 5.563 |
| AdshTAZ | 10.533 | 25.124 | 22.003 | 20.148 | 7.477 | |
| Two-way ANOVA | p | 0.0942 | 0.0002 | <0.0001 | 0.0033 | 0.0017 |
Author response table 2
Blood glucose concentrations (mg/dl) of female L-TAZ KO and floxed control mice during the PTT.
| Time (min) | ||||||
|---|---|---|---|---|---|---|
| Treatment | 0 | 15 | 30 | 60 | 120 | |
| Flox (F) | 56 | 71 | 75 | 63 | 34 | |
| Flox (F) | 44 | 85 | 98 | 70 | 60 | |
| Flox (F) | 52 | 79 | 103 | 86 | 51 | |
| Flox (F) | 54 | 89 | 97 | 63 | 52 | |
| Flox (F) | 51 | 82 | 103 | 85 | 47 | |
| Flox (F) | 52 | 89 | 101 | 76 | 53 | |
| Flox (F) | 53 | 87 | 89 | 83 | 47 | |
| Flox (F) | 54 | 81 | 95 | 66 | 59 | |
| L-TAZ KO (F) | 58 | 97 | 120 | 86 | 63 | |
| L-TAZ KO (F) | 66 | 102 | 114 | 86 | 73 | |
| L-TAZ KO (F) | 58 | 89 | 106 | 91 | 59 | |
| L-TAZ KO (F) | 57 | 93 | 111 | 83 | 64 | |
| L-TAZ KO (F) | 56 | 93 | 108 | 88 | 62 | |
| L-TAZ KO (F) | 58 | 96 | 109 | 87 | 53 | |
| L-TAZ KO (F) | 57 | 89 | 105 | 96 | 65 | |
| L-TAZ KO (F) | 63 | 94 | 108 | 88 | 59 | |
| L-TAZ KO (F) | 62 | 92 | 128 | 106 | 63 | |
| L-TAZ KO (F) | 62 | 91 | 113 | 102 | 60 | |
| Ave | Flox (F) | 52.0 | 82.9 | 95.1 | 74.0 | 50.4 |
| L-TAZ KO (F) | 59.7 | 93.4 | 112.2 | 91.3 | 62.1 | |
| SEM | Flox (F) | 1.268 | 2.142 | 3.308 | 3.464 | 2.890 |
| L-TAZ KO (F) | 1.044 | 1.343 | 2.240 | 2.399 | 1.629 | |
| SD | Flox (F) | 3.586 | 6.058 | 9.357 | 9.798 | 8.176 |
| L-TAZ KO (F) | 3.302 | 4.248 | 70.84 | 7.587 | 5.152 | |
| Two-way ANOVA | p | 0.0836 | 0.0067 | <0.0001 | <0.001 | 0.002 |
Author response table 3
Blood glucose concentrations (mg/dl) of male L-TAZ KO and floxed control mice during the PTT.
| Time (min) | ||||||
|---|---|---|---|---|---|---|
| Treatment | 0 | 15 | 30 | 60 | 120 | |
| Flox (M) | 46 | 65 | 102 | 69 | 52 | |
| Flox (M) | 44 | 84 | 97 | 73 | 51 | |
| Flox (M) | 51 | 89 | 95 | 79 | 56 | |
| Flox (M) | 54 | 78 | 98 | 69 | 57 | |
| Flox (M) | 53 | 74 | 101 | 77 | 60 | |
| Flox (M) | 46 | 82 | 108 | 77 | 56 | |
| Flox (M) | 54 | 75 | 97 | 68 | 55 | |
| Flox (M) | 51 | 89 | 103 | 79 | 58 | |
| L-TAZ KO (M) | 56 | 92 | 129 | 85 | 62 | |
| L-TAZ KO (M) | 56 | 94 | 118 | 95 | 59 | |
| L-TAZ KO (M) | 59 | 97 | 108 | 88 | 60 | |
| L-TAZ KO (M) | 66 | 105 | 110 | 102 | 78 | |
| L-TAZ KO (M) | 55 | 106 | 110 | 92 | 66 | |
| L-TAZ KO (M) | 61 | 93 | 115 | 92 | 68 | |
| L-TAZ KO (M) | 58 | 99 | 105 | 87 | 71 | |
| Ave | Flox (M) | 49.9 | 79.5 | 100.1 | 73.9 | 55.6 |
| L-TAZ KO (M) | 58.7 | 98.0 | 113.6 | 91.6 | 66.3 | |
| SEM | Flox (M) | 1.407 | 2.897 | 1.493 | 1.663 | 1.051 |
| L-TAZ KO (M) | 1.443 | 2.138 | 3.046 | 2.170 | 2.552 | |
| SD | Flox (M) | 3.980 | 8.194 | 4.224 | 4.704 | 2.973 |
| L-TAZ KO (M) | 3.817 | 5.657 | 8.059 | 5.740 | 6.751 | |
| Two-way ANOVA | p | 0.0173 | <0.0001 | <0.0001 | <0.0001 | <0.0026 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
TAZ inhibits glucocorticoid receptor and coordinates hepatic glucose homeostasis in normal physiological states
eLife 10:e57462.
https://doi.org/10.7554/eLife.57462
