Inhibition of post-termination ribosome recycling at premature termination codons in UPF1 ATPase mutants
- Department of Genetics and Genome Sciences, Case Western Reserve University School of Medicine, United States
- Department of Biochemistry, Case Western Reserve University School of Medicine, United States
Figures
Figure 1 with 1 supplement
5’ termini of RNA decay fragments in UPF1 ATPase derive downstream of the PTC.
(A) Primer extension analysis of GFPPTC125 mRNA from cells expressing either wild type (WT) or ATPase-deficient UPF1 (UPF1-DE572AA), or depleted for translation termination factor eRF1 (GAL1-SUP45). …
Figure 1—figure supplement 1
5’ termini of RNA decay fragments in UPF1 ATPase are downstream of the PTC.
(A) Western blot analysis of 3HA-SUP45 levels over time after inhibition of transcription (shift to growth in glucose). Protein levels relative to time zero and normalized to PAB1 shown. (B) …
Figure 2 with 1 supplement
3’ RNA decay intermediates are ribosome bound.
(A) Northern blot analysis of GFPPTC125 mRNA co-immunopurified with untagged or epitope-tagged RPS13 (RPS13-HA) in cells deleted for UPF1 (upf1∆) or expressing the ATPase-deficient mutant, UPF1-DE572…
Figure 2—figure supplement 1
3’ RNA decay intermediates are ribosome bound.
(A) Agarose gel electrophoresis and ethidium bromide staining of material co-immunopurified with untagged or epitope-tagged RPS13 (RPS13-HA) in cells deleted for UPF1 (upf1∆) or expressing the …
Figure 3 with 1 supplement
Translational read-through or reinitiation products are not detected in ATPase-deficient UPF1 mutants.
(A) GFPPTC125 reporters encoding an internal FLAG epitope downstream of the PTC in each translational reading frame. Predicted products for translation of GFP mRNA to the PTC (14 kDa), read-through …
Figure 3—figure supplement 1
Alteration of translational reading frame downstream of the PTC does not alter primer extension products.
(A) Primer extension analysis of GFPPTC135 and GFPPTC135+1 mRNA from WT, upf1Δ, and UPF1 ATPase mutants (DE). GFPPTC125+1 mRNA harbors a single-nucleotide insertion immediately downstream of the PTC.
Figure 4 with 1 supplement
RNA sequence requirements for the accumulation of 3’ RNA decay fragments.
(A) Schematic of nucleotide insertions or deletions immediately downstream of the PTC in GFPPTC125 (top) and primer extension analysis of these reporter mRNAs from ATPase-deficient UPF1 mutants …
Figure 4—figure supplement 1
Accumulation of 3’ RNA decay intermediates in UPF1 ATPase mutants is unaffected by the nucleotide sequence of the PTC or penultimate sense codon.
(A) Primer extension analysis of GFPPTC125 mRNA harboring a UAA, UAG, or UGA nonsense codon from ATPase-deficient UPF1 mutants. (B) Primer extension analysis of GFPPTC125 mRNA with mutations within G…
Figure 5 with 1 supplement
Mutational analysis of UPF1 active site correlates ATP hydrolysis with ribosome stalling.
Northern blot (A, C) and primer extension analysis (D) of GFPPTC125 mRNA from cells expressing either wild-type UPF1 or the indicated mutant allele with substitutions in the ATP binding pocket. Full-…
Figure 5—figure supplement 1
Impact of UPF1 active site mutations on NMD activity.
(A and B) Northern blot analysis of CYH2 RNA from cells expressing the indicated allele of UPF1. NMD-sensitive CYH2 pre-mRNA and NMD-insensitive CYH2 mRNA are indicated and NMD activity calculated …
Figure 6
Inhibition of post-termination ribosome release during premature translation termination in UPF1-ATPase mutants.
RLI1 function in translation termination involves both stimulation of peptidyl-tRNA hydrolysis by eRF1 and ATP hydrolysis-dependent ribosome subunit splitting. In UPF1 ATPase mutants, ribosomes …
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae) | Wild type (WT) | Saccharomyces Genome Deletion Project | MATa, ura3, leu2, his3, met15 | |
| Genetic Reagent (S. cerevisiae) | upf1Δ | Saccharomyces Genome Deletion Project | MATa, ura3, leu2, his3, met15, upf1::KanMX | |
| Genetic Reagent (S. cerevisiae) | Rpl16-ZZ | This paper | MATa, ura3, leu2, his3, met15, upf1::KanMX, RPL16A-ZZ-HIS3 | |
| Genetic Reagent (S. cerevisiae) | Rps13-HA | This paper | MATa, ura3, leu2, his3, met15, upf1::KanMX, RPS13-HA-HIS3 | |
| Genetic Reagent (S. cerevisiae) | Sup45 depletion strain | This paper | MATa, ura3, leu2, his3, met15, upf1::KanMX, HIS3-PGAL-3HA-SUP45 | |
| Antibody | Anti-HA (Mouse monoclonal) | Covance | MMS-101P; RRID:AB_2314672 | WB: (1:5,000) IP: (4 µg) |
| Antibody | Anti-TAP (Rabbit polyclonal) | Thermo Fisher | CAB1001; RRID:AB_10709700 | IP: (4 µg) |
| Antibody | Anti-Pab1 (Mouse monoclonal) | Encore Biotechnology | MCA-1G1; RRID:AB_2572370 | WB: (1:10,000) |
| Antibody | Anti-mouse IgG-HRP (goat polyclonal) | Santa Cruz Biotechnology | Sc-2005; RRID:AB_631736 | WB: (1:5,000) |
| Commercial Assay or Kit | Sequenase 2.0 DNA Sequencing Kit | Thermo Fisher | 70771KT | |
| Recombinant DNA Reagent | GFPPTC67 | This paper | pKB673 | CEN; URA3 |
| Recombinant DNA Reagent | GFPPTC125 | This paper | pKB674 | CEN; URA3 |
| Recombinant DNA Reagent | GFPPTC135 | This paper | pKB510 | CEN; URA3 |
| Recombinant DNA Reagent | UPF1-WT | PMID:28008922 | pKB556 | CEN; URA3 |
| Recombinant DNA Reagent | UPF1-DE572AA | PMID:28008922 | pKB576 | CEN; LEU2 |
| Sequence-based reagent | RT primer (GFPPTC125 primer extension analysis) | This paper | oKB132 | GGGCAGATTGTGTGGACAGGTAATGGTTGTCTGG |
Additional files
-
Supplementary file 1
Complete list of all yeast strains used in this study.
- https://cdn.elifesciences.org/articles/57834/elife-57834-supp1-v1.xlsx
-
Supplementary file 2
Complete list of all plasmids used in this study.
- https://cdn.elifesciences.org/articles/57834/elife-57834-supp2-v1.xlsx
-
Supplementary file 3
Complete list of all oligonucleotides used in this study.
- https://cdn.elifesciences.org/articles/57834/elife-57834-supp3-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/57834/elife-57834-transrepform-v1.docx
