1. Cancer Biology
Download icon

Functional interrogation of HOXA9 regulome in MLLr leukemia via reporter-based CRISPR/Cas9 screen

  1. Hao Zhang
  2. Yang Zhang
  3. Xinyue Zhou
  4. Shaela Wright
  5. Judith Hyle
  6. Lianzhong Zhao
  7. Jie An
  8. Xujie Zhao
  9. Ying Shao
  10. Beisi Xu
  11. Hyeong-Min Lee
  12. Taosheng Chen
  13. Yang Zhou
  14. Xiang Chen
  15. Rui Lu  Is a corresponding author
  16. Chunliang Li  Is a corresponding author
  1. Division of Hematology/Oncology, University of Alabama at Birmingham, United States
  2. O’Neal Comprehensive Cancer Center, University of Alabama at Birmingham, United States
  3. Department of Tumor Cell Biology, St. Jude Children’s Research Hospital, United States
  4. Cancer Biology Program/Comprehensive Cancer Center, St. Jude Children’s Research Hospital, United States
  5. Department of Pharmaceutical Sciences, St. Jude Children’s Research Hospital, United States
  6. Department of Computational Biology, St. Jude Children’s Research Hospital, United States
  7. Department of Chemical Biology and Therapeutics, St. Jude Children's Research Hospital, United States
  8. Department of Biomedical Engineering School of Engineering, University of Alabama at Birmingham, United States
Research Article
Cite this article as: eLife 2020;9:e57858 doi: 10.7554/eLife.57858
5 figures, 1 table and 3 additional files

Figures

Figure 1 with 2 supplements
Establishment and characterization of the HOXA9P2A-mCherry reporter human MLLr leukemia cell line.

(A) Schematic diagram of the knock-in design and genotyping PCR primer design for the HOXA9P2A-mCherry reporter allele. (B) Flow cytometry analysis of HOXA9P2A-mCherry reporter cells. Wild-type SEM cells were used as negative controls. (C) Genotyping PCR products from the 5′ and 3′ knock-in boundaries were sequenced to verify the seamless knock-in of the mCherry reporter gene to the endogenous locus. (D) Fluorescence in situ hybridization of the P2A-mCherry knock-in cassette in HOXA9P2A-mCherry reporter cells. The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and a HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative metaphase cell image is shown for the pattern of hybridization (pairing of red and green signals). (E) RNA-seq data of all HOXA cluster genes were illustrated as log2 (normalized numbers of FPKM) from two replicate samples of SEM cells. HOXA7, HOXA9, and HOXA10 were highlighted by color code. (F) Q-PCR analysis confirmed the unaffected HOXA cluster gene transcription between HOXA9P2A-mCherry reporter (KI) and WT SEM cells. Data shown are means ± SEM from replicate independent experiments. *p<0.05 of two-tailed Student’s t test.

Figure 1—figure supplement 1
HOXA9 expression profiling in leukemia.

(A) HOXA9 expression in different leukemia lineages (GSE13159). (B) Kaplan-Meier survival curve indicated the poor outcome associated with high HOXA9 expression (GSE13159). (C) HOXA9 expression was revealed by leukemia subtypes in MILE leukemia study cohort (bloodspot). (D) HOXA9 mRNA level was assessed by Q-PCR in MLLr and non-MLLr leukemia cell lines.

Figure 1—figure supplement 2
Cytogenetic characterization HOXA9 knock-in allele in MLLr SEM and OCI-AML2 cells.

(A) The genomic HOXA9 location was highlighted in human chromosome 7. (B) Karyotype analysis of parental MLLr SEM cells indicating the mono-allelic deletion of partial segment in chromosome 7 containing the HOXA cluster (red arrow). Black arrows indicated other chromosome alterations including t4,11 translocation and trisomy 8. (C) Chromosome analysis of spectral karyotyping (SKY) was conducted by using a commercially prepared SKY probe from Applied Spectral Imaging (Carlsbad, CA) on HOXA9 reporter cells. Translocation between chr4 and chr11, trisomy eight and micro-deletion of chr7 was confirmed. (D) FISH analysis confirming the co-localization of HOXA9 and mCherry in targeted SEM cells at interphase (left) and metaphase (right). The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and an HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative cell image is shown for the pattern of hybridization (pairing of red and green signals). SEM has one copy of the HOXA cluster. (E) FISH analysis confirming the co-localization of HOXA9 and mCherry in targeted OCI-AML2 cells at interphase (left) and metaphase (right). The P2A-mCherry DNA was labeled with a red-dUTP by nick translation, and an HOXA9 BAC clone was labeled with a green-dUTP. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) to visualize the nuclei. A representative cell image is shown for the pattern of hybridization (pairing of red and green signals). OCI-AML2 has two copies of the HOXA cluster.

Figure 2 with 1 supplement
The HOXA9P2A-mCherry reporter allele recapitulates endogenous transcription of HOXA9 in MLLr SEM cells.

(A) Flow cytometry analysis of the HOXA9P2A-mCherry cells targeted with luciferase-sgRNA (sgLuc) and DOT1L-sgRNA (sgDOT1L). (B) Q-PCR analysis of the HOXA9P2A-mCherry cells targeted with sgLuc and sgDOT1L by using specific primers targeting the mRNA sequences of mCherry and HOXA9. Three biological replicates were performed. Data shown are means ± SEM from replicate independent experiments. The p-value was calculated by performing a two-tailed t-test. (C) Flow cytometry analysis of the HOXA9P2A-mCherry cells targeted with luciferase-sgRNA (sgLuc) and ENL-sgRNA (sgENL). (D) Q-PCR analysis of the HOXA9P2A-mCherry cells targeted with sgLuc and sgENL by using specific primers targeting the mRNA sequence of mCherry and HOXA9. Three biological replicates were performed. The p-value was calculated by performing a two-tailed t-test. (E) The correlation of transcription reduction in mCherry and HOXA9 in response to CRISPR–mediated targeting was calculated by Pearson’s correlation test. (F) Fluorescence imaging was performed on the HOXA9P2A-mCherry cells treated with various dosages of DOT1L inhibitor SGC0946 for six days. Representative images were shown for comparison between 0.3 nM and 10 µM dosages. For each dosage treatment, four replicates were conducted (scale bar 50 μm). (G) Fluorescence curve was generated according to mCherry intensity in response to dosage-dependent treatment of drug for 6 days. About 20,000 cells were split in each of the 384-well at the starting time point. (H) Flow cytometry analysis of the HOXA9P2A-mCherry cells treated with DMSO and various dosages of the DOT1L inhibitor SGC0946. (I) Q-PCR analysis of the HOXA9P2A-mCherry cells with or without the 6-day treatment of the DOT1L inhibitor SGC0946 by using specific primers targeting the mRNA sequences of mCherry and HOXA9. The correlation of transcription reduction in mCherry and HOXA9 in response to inhibitor–mediated transcription repression was calculated by performing Pearson’s correlation test.

Figure 2—figure supplement 1
The HOXA9P2A-mCherry reporter allele recapitulates endogenous transcription of HOXA9 in MLLr OCI-AML2 cells.

(A) Flow cytometry analysis of the HOXA9P2A-mCherry cells compared with parental wildtype cells. (B) Genotyping PCR was conducted to confirm the successful knock-in. (C) Flow cytometry analysis of the HOXA9P2A-mCherry cells targeted with luciferase-sgRNA (sgLuc), DOT1L-sgRNA (sgDOT1L) and ENL-sgRNA (sgENL). (D) The correlation of transcription reduction in mCherry and HOXA9 in response to CRISPR–mediated targeting was calculated by Pearson’s correlation test. (E) Q-PCR analysis of the HOXA9P2A-mCherry cells targeted with sgLuc, sgDOT1L and sgENL by using specific primers targeting the mRNA sequences of mCherry and HOXA9. Three biological replicates were performed. Data shown are means ± SEM from replicate independent experiments. The p-value was calculated by performing a two-tailed t-test. (F) Flow cytometry analysis of the HOXA9P2A-mCherry cells treated with DMSO and various dosages of the DOT1L inhibitor SGC0946. (G) Fluorescence imaging was performed on the HOXA9P2A-mCherry cells treated with various dosages of DOT1L inhibitor SGC0946 for six days. Representative images were shown for comparison between 3, 10, and 20 nM dosages. For each dosage treatment, four replicates were conducted (scale bar 50 μm).

Figure 3 with 3 supplements
Pooled CRISPR/Cas9 screening identified a novel transcription factor, USF2, regulating HOXA9.

(A) Schematic diagram of a working model of loss-of-function CRISPR screening targeting 1639 human transcription factors. (B) The enrichment score of seven sgRNAs against each transcription factor was combined by the MAGeCK algorithm. Positive regulators of HOXA9 were compared between parental reporter strain and HOXA9-MEIS1 overexpressed screens. Overlapped top hits including HOXA9, USF2 and DOT1L were highlighted. (C) The overall distribution of all sgRNAs from the parental SEM HOXA9 reporter screening was shown based on the p-value and the DEseq2 score calculated by Log2[Fold Change (mCherryHigh/mCherryLow)]. NT, HOXA9, USF2 and KMT2A sgRNAs were highlighted by different color code. (D) The ratio for all sgRNAs targeting HOXA9, USF2, and KMT2A, are shown between mCherryHigh and mCherryLow sorted population. NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 sgRNAs. Transcription factors: seven sgRNAs/each. RRA score of each gene was collected from MAGeCK analysis. (E) The overall distribution of all sgRNAs from the HOXA9-MEIS1 overexpressing SEM HOXA9 reporter screening was shown based on the p-value and the DEseq2 score calculated by Log2[Fold Change (mCherryHigh/mCherryLow)]. NT, HOXA9, USF2 and KMT2A sgRNAs were highlighted by different color code. (F) The ratio for all sgRNAs targeting HOXA9, USF2, and KMT2A, are shown between mCherryHigh and mCherryLow sorted population. NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 sgRNAs. Transcription factors: seven sgRNAs/each. RRA score of each gene was collected from MAGeCK analysis.

Figure 3—figure supplement 1
CRISPR screen and data analysis by MAGeCK.

(A) Gene ranking of the top 10 positive and negative candidate regulators of HOXA9 enriched from parental SEM reporter screening by MAGeCK algorithm. (B) Normalized sgRNA count distribution of each of seven sgRNAs against HOXA9. (C) Normalized sgRNA count distribution of each of seven sgRNAs against USF2. (D) Gene ranking of the top 10 positive and negative candidate regulators of HOXA9 enriched from HOXA9-MEIS1 overexpressing SEM reporter screening by MAGeCK algorithm. (E) Normalized sgRNA count distribution of each of seven sgRNAs against HOXA9. (F) Normalized sgRNA count distribution of each of seven sgRNAs against USF2.

Figure 3—figure supplement 2
CTCF is dispensable for maintaining HOXA9 expression in MLLr SEM cells.

(A) Flow diagram of auxin-inducible degradation model to acutely deplete endogenous CTCF protein. Dox, doxycycline; IAA: auxin. (B) Immunoblotting analysis of CTCFAID and MYC in three bi-allelic knock-in clones 27, 35, and 42 with or without auxin (IAA) treatment. GAPDH was used as a loading control. (C) CTCF Cut and Run tracks shown at the selective viewpoint of the HOXA9 locus where significant reduction of CTCF binding at CBS7/9 occurs following 48 hr IAA treatment in clones 27, 35, and 42. Publicly available ChIP-seq tracks of CTCF, AFF1 and H3K27ac were included to indicate the open chromatin status of the locus. (D) RNA-seq profiles of HOXA7, HOXA9, and HOXA10 in CTCF-depleted SEM cells. (E) Quantification of HOXA7 and HOXA9 levels in three knock-in clones of CTCF depleted SEM cells using RNA-seq data. (F) Q-PCR analysis of HOXA9 was conducted to monitor the transcriptional response to CTCF depletion for 24, 48 hr and washout from three biological replicates; clones 27, 35, and 42 (N = 3). Data shown are means ± SEM from three independent experiments. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, two-tailed Student’s t test. (G) Q-PCR analysis of HOXA9 was conducted to monitor the transcriptional response to CTCF depletion for 24, 48 hr and washout from three biological replicates; clones 27, 35, and 42 (N = 3). Data shown are means ± SEM from three independent experiments. *p<0.05, two-tailed Student’s t test. (H) SEM cells were electroporated with CTCF-siRNA and NT-siRNA. Q-PCR was conducted 24 hr post-electroporation to monitor CTCF expression. Data shown are means ± SEM from two independent experiments. **p<0.01, two-tailed Student’s t test. (I) SEM cells were electroporated with CTCF-siRNA and NT-siRNA. Q-PCR analysis was conducted 24 hr post-electroporation to monitor HOXA7 expression. Data shown are means ± SEM from two independent experiments. *p<0.05, two-tailed Student’s t test. (J) SEM cells were electroporated with CTCF-siRNA and NT-siRNA. Q-PCR was conducted 24 hr post-electroporation to monitor HOXA9 expression. Data shown are means ± SEM from two independent experiments. *p<0.05, two-tailed Student’s t test.

Figure 3—figure supplement 3
CTCF regulates HOXA9 expression in human colorectal cancer HCT116 cells.

(A) ChIP-seq tracks from publicly available ENCODE dataset demonstrated the enriched transcription factor occupancy at CBS7/9 in HCT116 cells RNA-seq profiles of HOXA7, HOXA9, and HOXA10 in CTCF depleted SEM cells. (B) Q-PCR analysis of CTCF in HCT116 cells transfected with CTCF-siRNAs and NT-siRNAs for 48 hr. Data are means ± SEM from two independent experiments. ***p<0.001, Student’s t test. (C) Immunoblotting confirmed the siRNA-mediated inhibition of CTCF at protein level. (D) Q-PCR analysis of HOXA7 in HCT116 cells transfected with CTCF-siRNAs and NT-siRNAs for 48 hr. Data are means ± SEM from two independent experiments. **p<0.01, Student’s t test. (E) Q-PCR analysis of HOXA9 in HCT116 cells transfected with CTCF-siRNAs and NT-siRNAs for 48 hr. Data are means ± SEM from two independent experiments. *p<0.05, Student’s t test.

Figure 4 with 1 supplement
USF2 is required to maintain HOXA9 expression in MLLr leukemia.

(A) Flow cytometry analysis was performed at day 8 on the HOXA9P2A-mCherry cells targeted with lentiviral Cas9 and four sgRNAs against USF2. The sgENL-targeted cells were used as positive controls while sgLuc targeted cells were used as negative controls. (B) Q-PCR analysis was conducted on the USF2-targeted cells to monitor the reduction of HOXA9. The sgENL targeted cells were used as positive controls while sgLuc-targeted cells were used as negative controls. Data shown are means ± SEM from three independent experiments. *p<0.05, **p<0.01, ***p<0.001, two-tailed Student’s t test. (C) Immunoblotting of USF2 in USF2 sgRNAs targeted cells. '*' denoted non-specific bands. (D) USF2 occupancy changes in sgLuc and sgUSF2-targeted SEM cells were characterized in HOXA9 locus (A1, HOXA1; AS3, HOXA-AS3; A7, HOXA7; A9, HOXA9).

Figure 4—figure supplement 1
Time-course knock-down of USF2 and consequent HOXA9 expression analysis.

Flow cytometry analysis was performed at day 0, 4, 6, 8, and 11 on the HOXA9P2A-mCherry cells targeted with lentiviral Cas9 and four sgRNAs against USF2. The sgLuc- and sgRosa26-targeted cells were included as negative controls.

Figure 5 with 3 supplements
USF1 and USF2 synergistically regulate HOXA9 expression in MLLr leukemia.

(A) Flow diagram of dropout CRISPR screening procedure. (B) Gene ranking of all transcription factors from dropout screening was illustrated. The enrichment score of seven sgRNAs against each transcription factor was combined by the MAGeCK algorithm. (C) Q-PCR was conducted to monitor HOXA9 expression upon CRISPR targeting on its promoter. (D) Competitive proliferation assay was conducted by infecting SEMCas9 cells with Lentiviral-mCherry-sgRNAs against HOXA9 promoter at about 50% efficiency. The mCherry% was quantified every three days by flow cytometry to evaluate the growth disadvantage. (E) Competitive proliferation assay was conducted by infecting SEMCas9 cells with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF2#2, 2#3 and 2#5) at about 50% efficiency. The mCherry% was quantified every 3 days by flow cytometry to evaluate the growth disadvantage. (F) Rescued competitive proliferation assay was conducted by infecting SEM cells overexpressing ectopic Hoxa9 with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF2#2, 2#3 and 2#5) at about 50% efficiency. The mCherry% was quantified every 3 days by flow cytometry to evaluate the growth disadvantage. (G) Q-PCR analysis was conducted on the sgUSF2, sgUSF1 and sgUSF1/2-targeted SEM cells to monitor the reduction of HOXA9. Data shown are means ± SEM from three independent experiments. **p<0.01, two-tailed Student’s t test. (H) Competitive proliferation assay was conducted by infecting SEMCas9 cells with Lentiviral-mCherry-sgLuc, sgUSF1, sgUSF2, and sgUSF1/2 (DKO) at about 50% efficiency. The mCherry% was quantified at days 3, 7, 11, 15, 19, and 23 by flow cytometry to evaluate the growth disadvantage. A guide RNA targeting the survival essential gene RPS19 was included as a positive control for Cas9 activity. Guide RNAs targeting Luciferase gene (sgLuc) and the human ROSA26 gene (sgROSA26) were included as a negative control. (I) Q-PCR analysis was conducted on the sgUSF2, sgUSF1 and sgUSF1/2 targeted OCI-AML2 cells to monitor the reduction of HOXA9. Data shown are means ± SEM from three independent experiments. *p<0.05, **p<0.01, two-tailed Student’s t test. (J) Competitive proliferation assay was conducted by infecting OCI-AML2Cas9 cells with Lentiviral-mCherry-sgLuc, sgUSF1, sgUSF2, and sgUSF1/2 (DKO) at about 50% efficiency. The mCherry% was quantified at days 3, 7, 11, 15, 19, and 23 by flow cytometry to evaluate the growth disadvantage. A guide RNA targeting the survival essential gene RPS19 was included as a positive control for Cas9 activity. Guide RNAs targeting Luciferase gene (sgLuc) and the human ROSA26 gene (sgROSA26) were included as negative controls.

Figure 5—figure supplement 1
USF2 depletion in MLLr leukemia cells.

(A) Flow cytometry analysis was performed on the HOXA9P2A-mCherry SEM cells targeted with lentiviral Cas9 and sgRNAs against USF1, USF2, and USF1/2 (DKO). (B) Q-PCR was performed to validate the transcriptional regulation of HOXA9 upon USF2 targeting by two sgRNAs (sgUSF2#2 and sgUSF2#3) in OCI-AML2 cells. Immunoblotting confirmed the complete depletion of USF2. (C) Q-PCR was performed to validate the transcriptional regulation of HOXA9 upon USF2 targeting by two sgRNAs (sgUSF2#2 and sgUSF2#3) in NOMO-1 cells. Immunoblotting confirmed the complete depletion of USF2. (D) Immunoblotting confirmed the complete depletion of USF1 in SEM cells upon USF1 targeting by a sgRNA. (E) Immunoblotting confirmed the complete depletion of USF1 in OCI-AML2 cells upon USF1 targeting by a sgRNA. (F) Immunoblotting confirmed the complete depletion of USF2 in MOLM13 cells USF2 targeting by two sgRNAs (sgUSF2#2 and sgUSF2#3). (G) Competitive proliferation assay was conducted by infecting MOLM13Cas9 cells with Lentiviral-mCherry-sgRNAs against luciferase (sgLuc) and USF2 (sgUSF2#2, 2#3 and 2#5) at about 50% efficiency. The mCherry% was quantified at days 0, 3, 7, 11, 15, 19, and 23 by flow cytometry to evaluate the growth disadvantage. A guide RNA targeting the survival essential gene RPS19 was included as a positive control for Cas9 activity. Guide RNAs targeting Luciferase gene (sgLuc) and the human ROSA26 gene (sgROSA26) were included as negative controls.

Figure 5—figure supplement 2
USF2 depletion in non-MLLr leukemia cells.

(A) Q-PCR was performed to validate the transcriptional impact of HOXA9 upon USF2 targeting by two sgRNAs (sgUSF2#2 and sgUSF2#3) in OCI-AML3 cells. Immunoblotting confirmed the complete depletion of USF2. (B) Immunoblotting confirmed the complete depletion of USF2 in OCI-AML3 cells upon USF2 targeting by a sgRNA. (C) Q-PCR was performed to validate the transcriptional impact of HOXA9 upon USF2 targeting by two sgRNAs (sgUSF2#2 and sgUSF2#3) in U937 cells. Immunoblotting confirmed the complete depletion of USF2. (D) Immunoblotting confirmed the complete depletion of USF2 in U937 cells upon USF2 targeting by a sgRNA.

Figure 5—figure supplement 3
Transcriptional correlation between USF2 and HOXA9 in patient cohorts.

(A) Pearson’s correlation of transcriptional levels of HOXA9 and top 10 positive regulators identified from TF screen in a cohort of 1988 B-ALL patients (Gu et al., 2019). (B) Pearson’s correlation of transcriptional levels of HOXA9 and USF2 in a cohort of 1988 B-ALL patients (Gu et al., 2019). (C) Pearson’s correlation of transcriptional levels of HOXA9 and USF2 in a cohort of 136 MLLr B-ALL patients (Gu et al., 2019).

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Cell line (Homo sapiens)SEMDSMZACC546CVCL_0095
Cell line (Homo sapiens)NOMO-1DSMZACC542CVCL_1609
Cell line (Homo sapiens)OCI-AML2DSMZACC99CVCL_1619
Cell line (Homo sapiens)OCI-AML3DSMZACC582CVCL_1844
Cell line
(Homo sapiens)
MOLM13DSMZACC554CVCL_2119
Cell line (Homo sapiens)U937ATCCCRL-1593.2CVCL_0007
Cell line (Homo sapiens)293TATCCCRL-3216CVCL_0063
Cell line (Homo sapiens)SEM-HOXA9P2A-mCherryThis eLife studyReporter derived from SEM cells via knock-inCell line is available upon request to Dr. Chunliang Li
Cell line (Homo sapiens)OCI-AML2-HOXA9P2A-mCherryThis eLife studyReporter derived from OCI-AML2 cells via knock-inCell line is available upon request to Dr. Chunliang Li
AntibodyAnti-USF2 (Rabbit polyclonal)NovusNBP1-92649IP, IB (1:2,000)
AB_11007053
AntibodyAnti-USF1Proteintech22327–1-APIB (1: 2,000) AB_2060867
AntibodyAnti-CTCF (Rabbit polyclonal)Abcamab70303IB (1:1,000)
AB_1209546
AntibodyAnti-MYC (Rabbit polyclonal)Cell Signaling Technology9402IB (1:1000)
AB_2151827
AntibodyAnti-GAPDHThermo Fisher ScientificAM4300IB (1:10,000) AB_437392
AntibodyAnti-VinculinProteintech26520–1-APIB (1:2,000) AB_2868558
Sequence-based reagentU6-Forward sequencing primerThis papersgRNA sequencing primer5’GAGGGCCTATTTCCCATGAT3’
Sequence-based reagentsgRNA sequenceThis papersgRNA targeting HOXA9 on C-terminus5’AAAGACGAGTGATGCCATTT3’
Sequence-based reagentHOXA9 5’HA cloning primer FThis paperHOXA9 knockin reporter cloning5’GGCCGATTCCTTCCACTTCT3’
Sequence-based reagentHOXA9 5’HA cloning primer RThis paperHOXA9 knockin reporter cloning5’TCACTCGTCTTTTGCTCGGT3’
Sequence-based reagentHOXA9 3’HA cloning primer FThis paperHOXA9 knockin reporter cloning5’ACCGAGCAAAAGACGAGTGA3’
Sequence-based reagentHOXA9 3’HA cloning primer RThis paperHOXA9 knockin reporter cloning5’CACTGTTCGTCTGGTGCAAA3’.
Sequence-based reagentInfusion cloning FThis paperHOXA9 knockin reporter cloning5’AAGACCGAGCAAAAGACGAGGGATCCGGCGCAACAAACTT3’
Sequence-based reagentInfusion cloning RThis paperHOXA9 knockin reporter cloning5’AATAAGCCCAAATGGCATCACTTGTACAGCTCGTCCATGC3‘
Sequence-based reagentInfusion cloning of mCherry FThis paperHOXA9 knockin reporter cloning5’AAAGACGAGTGATGCCATTTGGGATGAGGCTGCGGGCGAC3’
Sequence-based reagentInfusion cloning of mCherry RThis paperHOXA9 knockin reporter cloning5’AAAGACGAGTGATGCCATTTGGGTATATATACAATAGACAAGACAGGAC3’
Sequence-based reagentDOT1L-sgRNAThis papersgRNA sequence5’TCAGCTTCGAGAGCATGCAG3’
Sequence-based reagentENL-sgRNAThis papersgRNA sequence5’TCACCTGGACGGTGCACTGG3’
Sequence-based reagentUSF2-sgRNA#2This papersgRNA sequence5’AGAAGAGCCCAGCACAACGA3’
Sequence-based reagentUSF2-sgRNA#3This papersgRNA sequence5’TGTTTTCCGCAGTGGAGCGG3’
Sequence-based reagentUSF2-sgRNA#4This papersgRNA sequence5’CCGGGGATCTTACCTGGCGG3’
Sequence-based reagentUSF2-sgRNA#5This papersgRNA sequence5’CAGCCACGACAAGGGACCCG3’
Sequence-based reagentUSF1-sgRNAThis papersgRNA sequence5’CTATACTTACTTCCCCAGCA3’
Sequence-based reagentLuciferase-sgRNAThis papersgRNA sequence5’CCCGGCGCCATTCTATCCGC3’
Sequence-based reagentROSA26-sgRNAThis papersgRNA sequence5’ACCTACCACACTAGCCCGA3’
Sequence-based reagentRPS19-sgRNAThis papersgRNA sequence5’GTAGAACCAGTTCTCATCGT3’
Sequence-based reagentHOXA9-promoter sgRNAThis papersgRNA sequence5’GATTTCATGTAACAACTTGG3’
Sequence-based reagentCTCF-FThis studyQ-PCR primer5’TTTGTCTGTTCTAAGTGTGGGAAA3’
Sequence-based reagentCTCF-RThis studyQ-PCR primer5’TTAGAGCGCATCTTTCTTTTTCTT3’
Sequence-based reagentGAPDH-FThis studyQ-PCR primer5’AGGGCTGCTTTTAACTCTGGT3’
Sequence-based reagentGAPDH-RThis studyQ-PCR primer5’CCCCACTTGATTTTGGAGGGA3’
Sequence-based reagentACTB-FThis studyQ-PCR primerGAGCACAGAGCCTCGCCTTT
Sequence-based reagentACTB-RThis studyQ-PCR primerGAGCGCGGCGATATCATCA
Sequence-based reagentHOXA1-FThis studyQ-PCR primer5’CCAGCCACCAAGAAGCCTGT3’
Sequence-based reagentHOXA1-RThis studyQ-PCR primer5’CCAGTTCCGTGAGCTGCTTG3’
Sequence-based reagentHOXA2-FThis studyQ-PCR primer5’ACAGCGAAGGGAAATGTAAAAGC3’
Sequence-based reagentHOXA2-RThis studyQ-PCR primer5’GGGCCCCAGAGACGCTAA3’
Sequence-based reagentHOXA3-FThis studyQ-PCR primer5’TGCAAAAAGCGACCTACTACGA3’
Sequence-based reagentHOXA3-RThis studyQ-PCR primer5’CGTCGGCGCCCAAAG3’
Sequence-based reagentHOXA4-FThis studyQ-PCR primer5’CGTGGTGTACCCCTGGATGA3’
Sequence-based reagentHOXA4-RThis studyQ-PCR primer5’AAGACCTGCTGCCGGGTGTA3’
Sequence-based reagentHOXA5-FThis studyQ-PCR primer5’TCTACCCCTGGATGCGCAAG3’
Sequence-based reagentHOXA5-RThis studyQ-PCR primer5’AATCCTCCTTCTGCGGGTCA3’
Sequence-based reagentHOXA6-FThis studyQ-PCR primer5’TGGATGCAGCGGATGAACTC3’
Sequence-based reagentHOXA6-RThis studyQ-PCR primer5’CCGTGTCAGGTAGCGGTTGA3’
Sequence-based reagentHOXA7-FThis studyQ-PCR primer5’TCTGCAGTGACCTCGCCAAA3’
Sequence-based reagentHOXA7-RThis studyQ-PCR primer5’AGCGTCTGGTAGCGCGTGTA3’
Sequence-based reagentHOXA9-FThis studyQ-PCR primer5’AAAAACAACCCAGCGAAGGC3’
Sequence-based reagentHOXA9-RThis studyQ-PCR primer5’ACCGCTTTTTCCGAGTGGAG3’
Sequence-based reagentHOXA10-FThis studyQ-PCR primer5’CCTTCCGAGAGCAGCAAAGC3’
Sequence-based reagentHOXA10-RThis studyQ-PCR primer5’CAGCGCTTCTTCCGACCACT3’
Sequence-based reagentHOXA11-FThis studyQ-PCR primer5’ACAGGCTTTCGACCAGTTTTTC3’
Sequence-based reagentHOXA11-RThis studyQ-PCR primer5’CCTTCTCGGCGCTCTTGTC3’
Sequence-based reagentHOXA13-FThis studyQ-PCR primer5’ACTCTGCCCGACGTGGTCTC3’
Sequence-based reagentHOXA13-RThis studyQ-PCR primer5’TTCGTGGCGTATTCCCGTTC3’
Sequence-based reagentmCherry-FThis studyQ-PCR primer5’CACTACGACGCTGAGGTCAA3’
Sequence-based reagentmCherry-RThis studyQ-PCR primer5’TAGTCCTCGTTGTGGGAGGT3’
Sequence-based reagentsiRNA: nontargeting controlThermo FishersiRNA oligoSilencer Select
Sequence-based reagentsiRNA: CTCFThermo FishersiRNA oligoSilencer Select
Sequence-based reagentDNA oligo poolCustomArraysgRNA synthesis
Commercial assay or kitIn-Fusion HD CloningClontech638909
Commercial assay or kitPolybreneEMD MilliporeTR-1003-G
Commercial assay or kitDAPISigmaD9542-10MG
Commercial assay or kitLonza nucleofector KitLonzaVCA-1003
Commercial assay or kitQ5 High-Fidelity DNA PolymeraseNew England BiolabsM0491L
Commercial assay or kitCloneAMP HiFI PCR PremixClontech639298
Commercial assay or kitQuick-DNA Miniprep KitZymoD3025
Commercial assay or kitNEB Next UltraII DNA Library Prep KitNEBE7645S
Commercial assay or kitZymoPURE II Plasmid Midiprep KitZymoD4201
Commercial assay or kitTRIzolThermo Fisher Scientific15596026
Commercial assay or kitHigh-Capacity cDNA Reverse Transcription KitApplied Biosystems4374966
Commercial assay or kitFAST SYBR Green Master MixApplied Biosystems4385612
Recombinant DNA reagentpSpCas9(BB)−2A-GFPAddgene48138PX458
Recombinant DNA reagentTOPO-cloning vectorThermo Fisher Scientific450641
Recombinant DNA reagentLenti-Cas9-Blast plasmidAddgene83480
Recombinant DNA reagentLenti-Guide-Puro plasmidAddgene52963
Recombinant DNA reagentLRCherry2.1Addgene108099
Recombinant DNA reagentLRNeo-2.1 vectorThis studySubclone from LRCherry2.1
Recombinant DNA reagentLenti-Guide-Puro-IRES-CFP plasmidThis studySubclone from Lenti-Guide-Puro
Recombinant DNA reagentHOXA9-MEIS1 OEThis studySubclone from mouse cDNA
Recombinant DNA reagentmHoxa9 OEThis studySubclone from mouse cDNA
Chemical compound, drugPuromycinInvivoGenant-pr-1
Chemical compound, drugNeomycinGeminiBio400–121P
Chemical compound, drugBlasticidineGibcoA1113903
Chemical compound, drugSGC0946MedChemExpressHY-15650DOT1L inhibitor
Software, algorithmFluorescene ImagingPerkin ElmerColumbus Image Data Storage and Analysis system
Software, algorithmMAGeCKhttps://sourceforge.net/ p/mageck/wiki/Home/PMID:25476604
Software, algorithmMACS2https://github.com/macs3-project/MACSZhang et al., 2008
Software, algorithmCutadapthttps://cutadapt.readthedocs.io/en/v1.9.1/installation.html1.9.1
Software, algorithmBWAhttps://github.com/lh3/bwa/releasesLi, 20130.7.17-r1188
Software, algorithmSamtoolshttp://www.htslib.org/Htslib 1.6
Software, algorithmIGVhttp://software.broadinstitute.org/software/igv/IGV2.3.97
Software, algorithmChIPseekerhttps://guangchuangyu.github.io/software/ChIPseeker/Yu et al., 2015
Software, algorithmTRANSFAChttp://gene-regulation.com/pub/databases.html
Software, algorithmJASPARhttp://jaspar.genereg.net/8th release (2020)
Software, algorithmFIMOhttp://meme-suite.org/doc/fimo.html
Software, algorithmDESeq2https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Software, algorithmGraphPad Prismversion 8.0
Software, algorithmFlowjoversion 10.0
Software, algorithmBowtiehttp://bowtie-bio.sourceforge.net/index.shtml
Software, algorithmBamCoveragehttps://deeptools.readthedocs.io/en/develop/content/tools/bamCoverage.html

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)