(A) Schematic representation of how the extrinsic apoptotic pathway accelerates mRNA decay. (B) Western blot of HCT116 lysates showing the depletion of full-length caspase 8 (CASP8) and caspase 3 …
(A) RT-qPCR quantification of total RNA at the indicated times post 100 ng/μL TRAIL treatment of HCT116 cells (n = 4). (B) Stained agarose gel depicting a 200 nt RT-PCR product of 4sU-labeled 18S …
(A, B) RT-qPCR measurements of total (A) and nascent 4sU-labeled (B) RNA fold changes after 2 hr TRAIL treatment of HCT116 cells, including a 1 hr pre-treatment with either 40 μM zVAD or an equal …
4sU-seq differential gene expression and enrichment analyses.
(A) Differential 4sU-labeled transcript expression values (averaged across two replicates and normalized to ERCC spike-ins) upon 2 hr TRAIL treatment with 1 hr DMSO (vehicle) pre-treatment. Includes gene, transcript identifiers, and RefSeq annotations. (B) Differential 4sU-labeled transcript expression values (averaged across two replicates and normalized to ERCC spike-ins) upon 2 hr TRAIL treatment with 1 hr zVAD pre-treatment. Includes gene, transcript identifiers, and RefSeq annotations. (C) GO enrichment anaylsis for subset of genes represented in the transcripts upregulated >2 fold upon TRAIL treatment (with 1 hr DMSO pre-treatment). Only statistically significant (FDR < 0.05) enrichments are listed. (D) Transcription factor enrichment analysis for subset of genes represented in the transcripts upregulated >2 fold upon TRAIL treatment (with 1 hr DMSO pre-treatment).
(A) Western blot of HCT116 lysates showing cleavage (or lack thereof) of the caspase 8 (CASP8) targets BID and caspase 3 (CASP3), as well as the CASP3 target PARP1 upon 2 hr 100 ng/μL TRAIL …
(A) Western blots showing the efficacy of CASP3, CASP8, and caspase-activated DNase (CAD) protein depletion following nucleofection with the indicated siRNAs, with or without 2 hr TRAIL treatment. …
(A) RT-qPCR quantification of the change in total RNA levels in HCT116 cells treated with the indicated siRNAs upon 2 hr TRAIL treatment. Fold change were calculated from Ct values normalized to 18S …
(A) Western blots performed with lysates from HCT116 cells depleted of the indicated decay factors with and without 2 hr TRAIL treatment. Blot representative of three biological replicates. …
(A, B) RT-qPCR quantification of the change in total (A) and 4sU-labeled (B) RNA levels in HCT116 cells treated with the indicated siRNAs upon 2 hr TRAIL treatment (n = 4). Fold changes were …
(A) Western blots showing the indicated proteins in the nuclear and cytoplasmic fractions of apoptotic and non-apoptotic HCT116 cells nucleofected with the indicated siRNAs. The nuclear and …
(A) Western blot showing the indicated proteins in the nuclear and cytoplasmic fractions of HCT116 cells with or without 2 hr TRAIL treatment and/or 3 hr ivermectin. Lamin B1 (LMNB1) and TUBA1A …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | Anti-RNA polymerase II CTD repeat YSPTSPS (mouse monoclonal) | Abcam | Cat#ab817 | WB: (1:500) ChIP: (1:200) |
Antibody | Anti-RNA polymerase II CTD repeat YSPTSPS (phospho S2) (rabbit polyclonal) | Abcam | Cat#ab5095: RRID:AB_304749 | WB: (1:1000) |
Antibody | Anti-RNA polymerase II CTD repeat YSPTSPS (phospho S5) (rabbit polyclonal) | Abcam | Cat#ab5131; RRID:AB_449369 | WB: (1:1000) |
Antibody | Anti-alpha Tubulin (mouse monoclonal) | Abcam | Cat#ab7291; RRID:AB_2241126 | WB: (1:500) |
Antibody | Anti-POLR2B (RPB2) (mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-166803; RRID:AB_2167499 | WB: (1:500) |
Antibody | Anti-RPB3 (rabbit monoclonal) | Abcam | Cat#ab182150 | WB: (1:10000) |
Antibody | Anti-POLR2D (RPB4) (rabbit polyclonal) | ThermoFisher Scientific | Cat#PA5-35954; RRID:AB_2553264 | WB: (1:1000) |
Antibody | Anti-Vinculin (rabbit polyclonal) | Abcam | Cat#ab91459; RRID:AB_2050446 | WB: (1:1000) |
Antibody | Anti-PNPT1 (rabbit polyclonal) | Abcam | Cat#ab96176; RRID:AB_10680559 | WB: (1:1000) |
Antibody | Anti-RRP41 (EXOSC4) (rabbit polyclonal) | Abcam | Cat#ab137250 | WB: (1:1000) |
Antibody | Anti-DIS3L2 (rabbit polyclonal) | Novus Biologicals | Cat#NBP184740; RRID:AB_11038956 | WB: (1:1000) |
Antibody | Anti-Lamin B1 (rabbit monoclonal) | Abcam | Cat#ab133741; RRID:AB_2616597 | WB: (1:10000) |
Antibody | Anti-GAPDH (mouse monoclonal) | Abcam | Cat#ab8245; RRID:AB_2107448 | WB: (1:5000) |
Antibody | Anti-Caspase-8 (rabbit monoclonal) | Cell Signaling Technology | Cat#4790; RRID:AB_10545768 | WB: (1:1000) |
Antibody | Anti-Caspase-3 (rabbit polyclonal) | Cell Signaling Technology | Cat#9662; RRID:AB_331439 | WB: (1:1000) |
Antibody | Anti-Bak (rabbit polyclonal) | Cell Signaling Technology | Cat#3814S; RRID:AB_2290287 | WB: (1:1000) |
Antibody | Anti-Bax Antibody | Cell Signaling Technology | Cat#2772S; RRID:AB_10695870 | WB: (1:1000) |
Antibody | Anti-XRN1 (rabbit polyclonal) | Bethyl Laboratories | Cat#A300-433A; RRID:AB_2219047 | WB: (1:1000) |
Antibody | Anti-DFFB (rabbit polyclonal) | Abcam | Cat#ab69438; RRID:AB_2040661 | WB: (1:1000) |
Antibody | Anti-PABP1 (rabbit polyclonal) | Cell Signaling Technology | Cat#4992; RRID:AB_10693595 | WB: (1:1000) |
Antibody | Anti-C23 (NCL) (mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-8031; RRID:AB_672071 | WB: (1:1000) |
Antibody | Anti-PARP (rabbit polyclonal) | Cell Signaling Technology | Cat#9542; RRID:AB_2160739 | WB: (1:1000) |
Antibody | Anti-BID (mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-56025; RRID:AB_781628 | WB: (1:1000) |
Antibody | Anti-TATA binding protein TBP (mouse monoclonal) | Abcam | Cat#ab51841; RRID:AB_945758 | WB: (1:1000) ChIP: (1:125) |
Antibody | Anti-Cytochrome c (CYTC) (rabbit monoclonal) | Cell Signaling Technology | Cat#11940: RRID:AB_2637071 | WB: (1:500) |
Antibody | Anti-VDAC1/Porin (rabbit polyclonal) | Abcam | Cat#ab15895; RRID:AB_2214787 | WB: (1:1000) |
Antibody | Anti-muSOX (rabbit polyclonal) | This paper | N/A | WB: (1:1000) |
Other | TrizolTM Reagent | ThermoFisher Scientific | Cat#15596026 | |
Other | TrizolTM LS Reagent | ThermoFisher Scientific | Cat#10296028 | |
Peptide, recombinant protein | TURBO DNase | ThermoFisher Scientific | Cat#AM2238 | |
Peptide, recombinant protein | Avian Myeloblastosis Virus Reverse Transcriptase | Promega Corporation | Cat#M5108 | |
Other | iTaq Universal SYBR Master Mix | Bio-Rad Laboratories | Cat#1725122 | |
Other | Dynabeads Protein G | ThermoFisher Scientific | Cat#10003D | |
Other | Dynabeads Protein A | ThermoFisher Scientific | Cat#10002D | |
Other | Dynabeads MyOne Streptavidin C1 | ThermoFisher Scientific | Cat# | |
Peptide, recombinant protein | EZ-link HPDP-biotin | ThermoFisher Scientific | Cat#21341 | |
Peptide, recombinant protein | SuperKillerTRAIL | Enzo Life Sciences | Cat# ALX-201-115-3010 | |
Other | KillerTRAIL Storage and Dilution Buffer | Enzo Life Sciences | Cat# ALX-505–005 R500 | |
Chemical compound, drug | Caspase Inhibitor Z-VAD-FMK | Promega Corporation | Cat#G7231 | |
Chemical compound, drug | Ivermectin | Millipore Sigma | Cat#I8898 | |
Chemical compound, drug | Raptinal | Millipore Sigma | Cat#SML1745 | |
Other | Dulbecco’s Modified Eagle Medium | ThermoFisher Scientific | Cat#12800082 | |
Other | McCoy’s (modified) 5A medium | ThermoFisher Scientific | Cat#16600082 | |
Other | Fetal Bovine Serum | VWR | Cat#89510–186 | |
Other | Trypsin-EDTA (0.05%), phenol red | ThermoFisher Scientific | Cat# 25300120 | |
Other | PageRuler Prestained Protein Ladder | ThermoFisher Scientific | Cat#26616 | |
Other | PageRuler Plus Prestained Protein Ladder | ThermoFisher Scientific | Cat#26620 | |
Other | Quick-Load Purple 1 kb Plus DNA Ladder | New England BioLabs | Cat#N0550S | |
Other | Clarity Western ECL Substrate | Bio-Rad Laboratories | Cat#1705061 | |
Other | 4x Laemmli Sample Buffer | Bio-Rad Laboratories | Cat#1610747 | |
Other | Gel Loading Dye, Purple (6X) | New England BioLabs | B7025S | no SDS |
Commercial assay, kit | TUNEL Assay Kit - BrdU-Red | Abcam | Cat#ab66110 | |
Commercial assay, kit | OneStep RT-PCR Kit | QIAGEN | Cat#210210 | |
Commercial assay, kit | Cell Fractionation Kit | Abcam | Cat#ab109719 | |
Commercial assay, kit | Bio-Rad Protein Assay Kit II | Bio-Rad Laboratories | Cat#5000002 | |
Commercial assay, kit | Oligo Clean and Concentrator Kit | Zymo Research | Cat#D4060 | |
Commercial assay, kit | In-Fusion HD Cloning Kit | Takara Bio USA | Cat#639650 | |
Commercial assay, kit | Lenti-X Tet-On 3G Inducible Expression System | Takara Bio USA | Cat#631187 | |
Commercial assay, kit | Neon Transfection System | ThermoFisher Scientific | Cat#MPK5000 | |
Commercial assay, kit | KAPA Stranded RNA-Seq Kit with RiboErase (HMR) | Roche | Cat#KK8484 | |
Sequence-based reagent | ERCC RNA Spike-In Mix | ThermoFisher Scientific | Cat#4456740 | |
Cell line (Homo sapiens) | HCT116 cells | ATCC | Cat#CCL-247; RRID:CVCL_0291 | |
Cell line (Homo sapiens) | 293T/17 cells | ATCC | Cat#CRL-11268; RRID:CVCL_1926 | |
Cell line (Homo sapiens) | HeLa Cells | ATCC | Cat#CCL-2; RRID:CVCL_0030 | |
Sequence-based reagent | muSOX F | This paper | TCCCGTATACACCGGTATGTGGAGCCACCCC | |
Sequence-based reagent | muSOX R | This paper | ATCCGCCGGCACCGGTTTAGGGGGTTATGGG | |
Sequence-based reagent | ON-TARGETplus Non-targeting Control Pool | Horizon Discovery Group | Cat#D-001810–10 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus DIS3L2 siRNA | Horizon Discovery Group | Cat#L-018715–01 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus Human EXOSC4 siRNA | Horizon Discovery Group | Cat#L-013760–00 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus Human PNPT1 siRNA | Horizon Discovery Group | Cat#L-019454–01 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus XRN1 siRNA | Horizon Discovery Group | Cat#L-013754–01 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus CASP3 siRNA | Horizon Discovery Group | Cat#L-004307–00 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus CASP8 siRNA | Horizon Discovery Group | Cat#L-003466–00 | |
Sequence-based reagent | ON-TARGETplus DFFB siRNA SMARTpool | Horizon Discovery Group | Cat#L-004425–00 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus Human BAX siRNA | Horizon Discovery Group | Cat# L-003308–01 | |
Sequence-based reagent | SMARTpool: ON-TARGETplus Human BAK1 siRNA | Horizon Discovery Group | Cat# L-003305–00 | |
Sequence-based reagent | See Supplementary file 1 for RT-(q)PCR primers | |||
Software, algorithm | Prism 8 | GraphPad | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
Software, algorithm | FlowJo | BD | RRID:SCR_008520 | https://www.flowjo.com/solutions/flowjo |
Software, algorithm | Image Lab Software | Bio-Rad Laboratories | Cat#1709690; RRID:SCR_014210 | |
Software, algorithm | FastQC | Babraham Bioinformatics | RRID:SCR_014583 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc |
Software, algorithm | Sickle version 1.33 | N/A | RRID:SCR_006800 | https://github.com/najoshi/sickle |
Software, algorithm | STAR | Dobin et al., 2013 | RRID:SCR_004463 | https://doi.org/10.1093/bioinformatics/bts635 |
Software, algorithm | Cuffdiff 2 | Trapnell et al., 2013 | RRID:SCR_001647 | https://doi.org/10.1038/nbt.2450 |
Software, algorithm | PANTHER GO-slim | Mi et al., 2019 | RRID:SCR_002811 | http://geneontology.org/ |
Software, algorithm | ChEA3 | Keenan et al., 2019 | N/A | https://maayanlab.cloud/chea3/ |
Statistical tests and PCR primers.
(A) p values calculated by statistical tests employed in this study. (B) RT-(q)PCR primer sequences
GO enrichment anaylsis for subset of genes represented in the transcripts downregulated >2 fold upon TRAIL treatment (with 1 hr DMSO pre-treatment).
No statistically significant (FDR < 0.05) enrichments were identified.