Cytoplasmic mRNA decay represses RNA polymerase II transcription during early apoptosis
- Department of Molecular and Cell Biology; University of California, Berkeley, United States
- Department of Plant and Microbial Biology; University of California, Berkeley, United States
- Howard Hughes Medical Institute, Berkeley, United States
Figures
Figure 1 with 1 supplement
mRNA decay during early apoptosis is accompanied by reduced synthesis of RNAPII transcripts.
(A) Schematic representation of how the extrinsic apoptotic pathway accelerates mRNA decay. (B) Western blot of HCT116 lysates showing the depletion of full-length caspase 8 (CASP8) and caspase 3 …
Figure 1—figure supplement 1
mRNA decay during early apoptosis is accompanied by reduced synthesis of RNAPII transcripts.
(A) RT-qPCR quantification of total RNA at the indicated times post 100 ng/μL TRAIL treatment of HCT116 cells (n = 4). (B) Stained agarose gel depicting a 200 nt RT-PCR product of 4sU-labeled 18S …
Figure 2 with 1 supplement
RNAPII transcription is globally repressed during early apoptosis.
(A, B) RT-qPCR measurements of total (A) and nascent 4sU-labeled (B) RNA fold changes after 2 hr TRAIL treatment of HCT116 cells, including a 1 hr pre-treatment with either 40 μM zVAD or an equal …
-
Figure 2—source data 1
4sU-seq differential gene expression and enrichment analyses.
(A) Differential 4sU-labeled transcript expression values (averaged across two replicates and normalized to ERCC spike-ins) upon 2 hr TRAIL treatment with 1 hr DMSO (vehicle) pre-treatment. Includes gene, transcript identifiers, and RefSeq annotations. (B) Differential 4sU-labeled transcript expression values (averaged across two replicates and normalized to ERCC spike-ins) upon 2 hr TRAIL treatment with 1 hr zVAD pre-treatment. Includes gene, transcript identifiers, and RefSeq annotations. (C) GO enrichment anaylsis for subset of genes represented in the transcripts upregulated >2 fold upon TRAIL treatment (with 1 hr DMSO pre-treatment). Only statistically significant (FDR < 0.05) enrichments are listed. (D) Transcription factor enrichment analysis for subset of genes represented in the transcripts upregulated >2 fold upon TRAIL treatment (with 1 hr DMSO pre-treatment).
- https://cdn.elifesciences.org/articles/58342/elife-58342-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
RNAPII transcription is globally repressed during early apoptosis.
(A) Western blot of HCT116 lysates showing cleavage (or lack thereof) of the caspase 8 (CASP8) targets BID and caspase 3 (CASP3), as well as the CASP3 target PARP1 upon 2 hr 100 ng/μL TRAIL …
Figure 3 with 1 supplement
Transcriptional repression during early apoptosis requires MOMP, but not necessarily caspase activity.
(A) Western blots showing the efficacy of CASP3, CASP8, and caspase-activated DNase (CAD) protein depletion following nucleofection with the indicated siRNAs, with or without 2 hr TRAIL treatment. …
Figure 3—figure supplement 1
Transcriptional repression during early apoptosis requires MOMP, but not necessarily caspase activity.
(A) RT-qPCR quantification of the change in total RNA levels in HCT116 cells treated with the indicated siRNAs upon 2 hr TRAIL treatment. Fold change were calculated from Ct values normalized to 18S …
Figure 4 with 1 supplement
Apoptosis causes reduced RNAPII transcriptional output and promoter occupancy in an mRNA decay-dependent manner.
(A) Western blots performed with lysates from HCT116 cells depleted of the indicated decay factors with and without 2 hr TRAIL treatment. Blot representative of three biological replicates. …
Figure 4—figure supplement 1
Apoptosis causes reduced RNAPII transcriptional output and promoter occupancy in an mRNA decay-dependent manner.
(A, B) RT-qPCR quantification of the change in total (A) and 4sU-labeled (B) RNA levels in HCT116 cells treated with the indicated siRNAs upon 2 hr TRAIL treatment (n = 4). Fold changes were …
Figure 5 with 1 supplement
Importin α/β transport links mRNA decay and transcription.
(A) Western blots showing the indicated proteins in the nuclear and cytoplasmic fractions of apoptotic and non-apoptotic HCT116 cells nucleofected with the indicated siRNAs. The nuclear and …
Figure 5—figure supplement 1
Importin α/β transport links mRNA decay and transcription.
(A) Western blot showing the indicated proteins in the nuclear and cytoplasmic fractions of HCT116 cells with or without 2 hr TRAIL treatment and/or 3 hr ivermectin. Lamin B1 (LMNB1) and TUBA1A …
Figure 6
Schematic representation of the cellular events connecting apoptosis induction with mRNA decay and RNAPII transcription.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-RNA polymerase II CTD repeat YSPTSPS (mouse monoclonal) | Abcam | Cat#ab817 | WB: (1:500) ChIP: (1:200) |
| Antibody | Anti-RNA polymerase II CTD repeat YSPTSPS (phospho S2) (rabbit polyclonal) | Abcam | Cat#ab5095: RRID:AB_304749 | WB: (1:1000) |
| Antibody | Anti-RNA polymerase II CTD repeat YSPTSPS (phospho S5) (rabbit polyclonal) | Abcam | Cat#ab5131; RRID:AB_449369 | WB: (1:1000) |
| Antibody | Anti-alpha Tubulin (mouse monoclonal) | Abcam | Cat#ab7291; RRID:AB_2241126 | WB: (1:500) |
| Antibody | Anti-POLR2B (RPB2) (mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-166803; RRID:AB_2167499 | WB: (1:500) |
| Antibody | Anti-RPB3 (rabbit monoclonal) | Abcam | Cat#ab182150 | WB: (1:10000) |
| Antibody | Anti-POLR2D (RPB4) (rabbit polyclonal) | ThermoFisher Scientific | Cat#PA5-35954; RRID:AB_2553264 | WB: (1:1000) |
| Antibody | Anti-Vinculin (rabbit polyclonal) | Abcam | Cat#ab91459; RRID:AB_2050446 | WB: (1:1000) |
| Antibody | Anti-PNPT1 (rabbit polyclonal) | Abcam | Cat#ab96176; RRID:AB_10680559 | WB: (1:1000) |
| Antibody | Anti-RRP41 (EXOSC4) (rabbit polyclonal) | Abcam | Cat#ab137250 | WB: (1:1000) |
| Antibody | Anti-DIS3L2 (rabbit polyclonal) | Novus Biologicals | Cat#NBP184740; RRID:AB_11038956 | WB: (1:1000) |
| Antibody | Anti-Lamin B1 (rabbit monoclonal) | Abcam | Cat#ab133741; RRID:AB_2616597 | WB: (1:10000) |
| Antibody | Anti-GAPDH (mouse monoclonal) | Abcam | Cat#ab8245; RRID:AB_2107448 | WB: (1:5000) |
| Antibody | Anti-Caspase-8 (rabbit monoclonal) | Cell Signaling Technology | Cat#4790; RRID:AB_10545768 | WB: (1:1000) |
| Antibody | Anti-Caspase-3 (rabbit polyclonal) | Cell Signaling Technology | Cat#9662; RRID:AB_331439 | WB: (1:1000) |
| Antibody | Anti-Bak (rabbit polyclonal) | Cell Signaling Technology | Cat#3814S; RRID:AB_2290287 | WB: (1:1000) |
| Antibody | Anti-Bax Antibody | Cell Signaling Technology | Cat#2772S; RRID:AB_10695870 | WB: (1:1000) |
| Antibody | Anti-XRN1 (rabbit polyclonal) | Bethyl Laboratories | Cat#A300-433A; RRID:AB_2219047 | WB: (1:1000) |
| Antibody | Anti-DFFB (rabbit polyclonal) | Abcam | Cat#ab69438; RRID:AB_2040661 | WB: (1:1000) |
| Antibody | Anti-PABP1 (rabbit polyclonal) | Cell Signaling Technology | Cat#4992; RRID:AB_10693595 | WB: (1:1000) |
| Antibody | Anti-C23 (NCL) (mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-8031; RRID:AB_672071 | WB: (1:1000) |
| Antibody | Anti-PARP (rabbit polyclonal) | Cell Signaling Technology | Cat#9542; RRID:AB_2160739 | WB: (1:1000) |
| Antibody | Anti-BID (mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-56025; RRID:AB_781628 | WB: (1:1000) |
| Antibody | Anti-TATA binding protein TBP (mouse monoclonal) | Abcam | Cat#ab51841; RRID:AB_945758 | WB: (1:1000) ChIP: (1:125) |
| Antibody | Anti-Cytochrome c (CYTC) (rabbit monoclonal) | Cell Signaling Technology | Cat#11940: RRID:AB_2637071 | WB: (1:500) |
| Antibody | Anti-VDAC1/Porin (rabbit polyclonal) | Abcam | Cat#ab15895; RRID:AB_2214787 | WB: (1:1000) |
| Antibody | Anti-muSOX (rabbit polyclonal) | This paper | N/A | WB: (1:1000) |
| Other | TrizolTM Reagent | ThermoFisher Scientific | Cat#15596026 | |
| Other | TrizolTM LS Reagent | ThermoFisher Scientific | Cat#10296028 | |
| Peptide, recombinant protein | TURBO DNase | ThermoFisher Scientific | Cat#AM2238 | |
| Peptide, recombinant protein | Avian Myeloblastosis Virus Reverse Transcriptase | Promega Corporation | Cat#M5108 | |
| Other | iTaq Universal SYBR Master Mix | Bio-Rad Laboratories | Cat#1725122 | |
| Other | Dynabeads Protein G | ThermoFisher Scientific | Cat#10003D | |
| Other | Dynabeads Protein A | ThermoFisher Scientific | Cat#10002D | |
| Other | Dynabeads MyOne Streptavidin C1 | ThermoFisher Scientific | Cat# | |
| Peptide, recombinant protein | EZ-link HPDP-biotin | ThermoFisher Scientific | Cat#21341 | |
| Peptide, recombinant protein | SuperKillerTRAIL | Enzo Life Sciences | Cat# ALX-201-115-3010 | |
| Other | KillerTRAIL Storage and Dilution Buffer | Enzo Life Sciences | Cat# ALX-505–005 R500 | |
| Chemical compound, drug | Caspase Inhibitor Z-VAD-FMK | Promega Corporation | Cat#G7231 | |
| Chemical compound, drug | Ivermectin | Millipore Sigma | Cat#I8898 | |
| Chemical compound, drug | Raptinal | Millipore Sigma | Cat#SML1745 | |
| Other | Dulbecco’s Modified Eagle Medium | ThermoFisher Scientific | Cat#12800082 | |
| Other | McCoy’s (modified) 5A medium | ThermoFisher Scientific | Cat#16600082 | |
| Other | Fetal Bovine Serum | VWR | Cat#89510–186 | |
| Other | Trypsin-EDTA (0.05%), phenol red | ThermoFisher Scientific | Cat# 25300120 | |
| Other | PageRuler Prestained Protein Ladder | ThermoFisher Scientific | Cat#26616 | |
| Other | PageRuler Plus Prestained Protein Ladder | ThermoFisher Scientific | Cat#26620 | |
| Other | Quick-Load Purple 1 kb Plus DNA Ladder | New England BioLabs | Cat#N0550S | |
| Other | Clarity Western ECL Substrate | Bio-Rad Laboratories | Cat#1705061 | |
| Other | 4x Laemmli Sample Buffer | Bio-Rad Laboratories | Cat#1610747 | |
| Other | Gel Loading Dye, Purple (6X) | New England BioLabs | B7025S | no SDS |
| Commercial assay, kit | TUNEL Assay Kit - BrdU-Red | Abcam | Cat#ab66110 | |
| Commercial assay, kit | OneStep RT-PCR Kit | QIAGEN | Cat#210210 | |
| Commercial assay, kit | Cell Fractionation Kit | Abcam | Cat#ab109719 | |
| Commercial assay, kit | Bio-Rad Protein Assay Kit II | Bio-Rad Laboratories | Cat#5000002 | |
| Commercial assay, kit | Oligo Clean and Concentrator Kit | Zymo Research | Cat#D4060 | |
| Commercial assay, kit | In-Fusion HD Cloning Kit | Takara Bio USA | Cat#639650 | |
| Commercial assay, kit | Lenti-X Tet-On 3G Inducible Expression System | Takara Bio USA | Cat#631187 | |
| Commercial assay, kit | Neon Transfection System | ThermoFisher Scientific | Cat#MPK5000 | |
| Commercial assay, kit | KAPA Stranded RNA-Seq Kit with RiboErase (HMR) | Roche | Cat#KK8484 | |
| Sequence-based reagent | ERCC RNA Spike-In Mix | ThermoFisher Scientific | Cat#4456740 | |
| Cell line (Homo sapiens) | HCT116 cells | ATCC | Cat#CCL-247; RRID:CVCL_0291 | |
| Cell line (Homo sapiens) | 293T/17 cells | ATCC | Cat#CRL-11268; RRID:CVCL_1926 | |
| Cell line (Homo sapiens) | HeLa Cells | ATCC | Cat#CCL-2; RRID:CVCL_0030 | |
| Sequence-based reagent | muSOX F | This paper | TCCCGTATACACCGGTATGTGGAGCCACCCC | |
| Sequence-based reagent | muSOX R | This paper | ATCCGCCGGCACCGGTTTAGGGGGTTATGGG | |
| Sequence-based reagent | ON-TARGETplus Non-targeting Control Pool | Horizon Discovery Group | Cat#D-001810–10 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus DIS3L2 siRNA | Horizon Discovery Group | Cat#L-018715–01 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus Human EXOSC4 siRNA | Horizon Discovery Group | Cat#L-013760–00 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus Human PNPT1 siRNA | Horizon Discovery Group | Cat#L-019454–01 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus XRN1 siRNA | Horizon Discovery Group | Cat#L-013754–01 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus CASP3 siRNA | Horizon Discovery Group | Cat#L-004307–00 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus CASP8 siRNA | Horizon Discovery Group | Cat#L-003466–00 | |
| Sequence-based reagent | ON-TARGETplus DFFB siRNA SMARTpool | Horizon Discovery Group | Cat#L-004425–00 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus Human BAX siRNA | Horizon Discovery Group | Cat# L-003308–01 | |
| Sequence-based reagent | SMARTpool: ON-TARGETplus Human BAK1 siRNA | Horizon Discovery Group | Cat# L-003305–00 | |
| Sequence-based reagent | See Supplementary file 1 for RT-(q)PCR primers | |||
| Software, algorithm | Prism 8 | GraphPad | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
| Software, algorithm | FlowJo | BD | RRID:SCR_008520 | https://www.flowjo.com/solutions/flowjo |
| Software, algorithm | Image Lab Software | Bio-Rad Laboratories | Cat#1709690; RRID:SCR_014210 | |
| Software, algorithm | FastQC | Babraham Bioinformatics | RRID:SCR_014583 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc |
| Software, algorithm | Sickle version 1.33 | N/A | RRID:SCR_006800 | https://github.com/najoshi/sickle |
| Software, algorithm | STAR | Dobin et al., 2013 | RRID:SCR_004463 | https://doi.org/10.1093/bioinformatics/bts635 |
| Software, algorithm | Cuffdiff 2 | Trapnell et al., 2013 | RRID:SCR_001647 | https://doi.org/10.1038/nbt.2450 |
| Software, algorithm | PANTHER GO-slim | Mi et al., 2019 | RRID:SCR_002811 | http://geneontology.org/ |
| Software, algorithm | ChEA3 | Keenan et al., 2019 | N/A | https://maayanlab.cloud/chea3/ |
Additional files
-
Supplementary file 1
Statistical tests and PCR primers.
(A) p values calculated by statistical tests employed in this study. (B) RT-(q)PCR primer sequences
- https://cdn.elifesciences.org/articles/58342/elife-58342-supp1-v2.xlsx
-
Supplementary file 2
GO enrichment anaylsis for subset of genes represented in the transcripts downregulated >2 fold upon TRAIL treatment (with 1 hr DMSO pre-treatment).
No statistically significant (FDR < 0.05) enrichments were identified.
- https://cdn.elifesciences.org/articles/58342/elife-58342-supp2-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/58342/elife-58342-transrepform-v2.docx
