Dichotomous role of the human mitochondrial Na+/Ca2+/Li+ exchanger NCLX in colorectal cancer growth and metastasis

  1. Trayambak Pathak
  2. Maxime Gueguinou
  3. Vonn Walter
  4. Celine Delierneux
  5. Martin T Johnson
  6. Xuexin Zhang
  7. Ping Xin
  8. Ryan E Yoast
  9. Scott M Emrich
  10. Gregory S Yochum
  11. Israel Sekler
  12. Walter A Koltun
  13. Donald L Gill
  14. Nadine Hempel
  15. Mohamed Trebak  Is a corresponding author
  1. Department of Cellular and Molecular Physiology, The Pennsylvania State University College of Medicine, United States
  2. Department of Public Health Sciences, The Pennsylvania State University College of Medicine, United States
  3. Department of Biochemistry and Molecular Biology, The Pennsylvania State University College of Medicine, United States
  4. Penn State Cancer Institute. The Pennsylvania State University College of Medicine, United States
  5. Department of Surgery, Division of Colon and Rectal Surgery, The Pennsylvania State University College of Medicine, United States
  6. Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Israel
  7. Department of Pharmacology, The Pennsylvania State University College of Medicine, United States
7 figures, 1 table and 2 additional files

Figures

Figure 1 with 1 supplement
The expression of NCLX, a mtCa2+ extrusion mediator in CRC cells, is decreased in CRC tumor samples from human patients.

(A) TCGA data analysis showing SLC8B1 mRNA levels in tumor tissues and adjacent normal tissues of COADREAD (colon and rectal adenocarcinoma) patients. Each data point represents an individual sample. (B) RT-qPCR analysis of SLC8B1 mRNA in tumor tissues (n = 30) and adjacent normal tissues (n = 30) of CRC patients from Penn State University Hospital. (C, D) TCGA data analysis showing SLC8B1 mRNA level in patients with and without KRAS, PI3K, (C) TP53, and BRAF (D) mutation. (E–F) TCGA data analysis showing NCLX mRNA in tumors at different cancer stages (stages I–IV) (E) or combined stage I/II (early stage) and stage III/IV (late-stage) (F) of COADREAD tissues compared to adjacent normal tissues. NA = stage not known (G) RT-qPCR analysis of SLC8B1 mRNA in combined stage I/II (n = 9) and stage III/IV (n = 20) CRC tumor samples compared to their adjacent normal tissues obtained from Penn State University hospital. (H) Schematic representation of the colitis-associated regimen of AOM and DSS treatment. (I–K) Five representative colons from each experimental group are shown (I), quantification of the number of tumors (J), and tumor volume (K) in NCLX KO and control littermate mice at day 78 after AOM/DSS treatment. The red arrow indicates polyps in the colon and the white star represents fat tissue; n ≥ 30 mice per group. (L, M) Three replicates of representative H and E staining of colon sections where black arrows indicate dysplasia (scale bar 500 µm) (L), histology score of dysplasia (scale bar 500 µm) (M). Kruskal-Wallis ANOVA was performed to test single variables between the two groups. *p<0.05, **p<0.01, and ***p<0.001.

Figure 1—figure supplement 1
Loss of NCLX reduces tumor number and size in the colitis-associated cancer model.

(A) TCGA data analysis showing SLC8B1 mRNA levels in tumors of male and female COADREAD patients. (B, C) TCGA data analysis showing a comparison of SLC8B1 mRNA levels in COAD patients based on age (B) and the origin of adenocarcinoma (C). (D) Cartoon depicting the position of the nucleotides deleted from the Slc8b1 gene in Slc8b1-/-(NCLX KO) mice. The red color depicts the deleted region, the light green bar represents the Slc8b1 gene, and the dark green boxes represent the coding regions in the exons. (E) Cartoon representing the annealing position of the primer pair sets used for genotyping NCLX KO mice, and products of the PCR performed on genomic DNA from wild type (WT), heterozygotes (Slc8b1-/+), and NCLX KO mice tails. (F, G) Magnified image of a colon from an NCLX KO mouse and a littermate control mouse where the tumors are marked by red arrows (F) and colons isolated at day 78 from fifteen NCLX KO mice and control littermate mice subjected to AOM/DSS treatment (G). In TCGA analysis, each data point represents individual patients. Kruskal-Wallis ANOVA was used to calculate statistics. *p<0.05, **p<0.01, and ***p<0.001.

Figure 2 with 1 supplement
Loss of NCLX has a dichotomous role in tumor growth and metastasis in vivo.

(A) Schematic representation of CRISPR-generated HCT116 NCLX KO #33 cells. Luciferase-tagged control HCT116 and HCT116 NCLX KO #33 cells were injected at 5 × 105 cells/mice into spleens of male NOD-SCID mice. (B–C) Representative bioluminescence images (five mice per group) of cancer progression and metastasis in male NOD-SCID mice injected with luciferase-tagged HCT116 cells or HCT116 NCLX KO #33 cells (B) and quantification of whole-body luciferase count (C). (n = 15 mice per group). (D, E) Representative images of the primary tumors at the site of injection (D) and quantification of primary tumor volume at the time of sacrifice (E). Scale bar, 5 mm. (F–H) Representative image of the liver (scale bar, 5 mm) and corresponding colon (scale bar, 1 cm) (F), quantification of luciferase count from the liver (G) and the colon (H) from NOD-SCID mice injected with HCT116 cells or HCT16 NCLX KO #33 cells. (I) Survival curve of NOD-SCID mice injected with either HCT116 cells or HCT116 NCLX KO #33 cells (*p<0.0194, n = 15 mice per group). Kruskal-Wallis ANOVA was performed to test single variables between the two groups. *p<0.05, **p<0.01, and ***p<0.001.

Figure 2—figure supplement 1
Xenografts of HCT116 cells and HCT116 NCLX KO #33 cells in NOD/SCID.

Bioluminescence images of male NOD/SCID mice injected with luciferase-tagged HCT116 cells or HCT116 NCLX KO #33 cells.

Figure 3 with 1 supplement
Loss of NCLX inhibits proliferation but enhances migration and invasion of CRC cells.

(A, B) CyQUANT proliferation assays of HCT116 cells (A), DLD1 cells (B), and their respective NCLX KO clones. (C, D) Representative bright-field images of in vitro wound healing migration assay (C), and quantification of % gap closure for HCT116 cells and clones of HCT116 NCLX KO cells after 24 hr (D). Scale bar, 1 mm. (E, F) In vitro migration assays of control HCT116 cells infected with either scramble shRNA or two different shRNA sequences against NCLX (E) and quantification of % gap closure (F). Scale bar, 1 mm. (G, H) Representative images of invasion assays performed in triplicates (G), and quantification of normalized invasion of HCT116 cells and clones of HCT116 NCLX KO cells (H). Scale bar, 50 µm. (I–K) RT-qPCR data showing mRNA expression for MMP1 (I), MMP2 (J), and MMP9 (K) in HCT116 cells and clones of HCT116 NCLX KO cells. (L, M) Western blot probed with anti-MMP1, anti-MMP2, anti-MMP9, and anti-HSC70 antibody as a loading control (L), and quantification of MMPs band intensities normalized to that of HSC70 (M). (N, O) Representative gelatin zymogram showing MMP2 and MMP9 activity from HCT116 cells, and their respective clones of HCT116 NCLX KO cells (N), quantification of band intensities of MMP2 and MMP9 activities (O). All experiments were performed ≥three times with similar results. Statistical significance was calculated using one-way ANOVA followed by a post-hoc Tukey test, except for M and O, where the paired t-test was performed. *p<0.05, **p<0.01 and ***p<0.001.

Figure 3—figure supplement 1
Deletion of NCLX results in reduced proliferation and increased migration and invasion.

(A–D) CRISPR/Cas9 knockout strategy of the SLC8B1 gene in NCLX KO clones #33 (A), #37 (B), and #59 (C) with g1 and g2 representing the cut site and red box non-translated region. Location of primers used for RT-qPCR are shown in (A), and SLC8B1 mRNA levels in clones of HCT116 NCLX KO cells compared to control HCT116 cells (D). (E–H) The binding site of guide RNA (gRNA) g3 and g4 on the SLC8B1 gene, the subsequent deletion, and location of primers used for RT-qPCR (E). The position on the SLC8B1 gene of the genotyping primers used to screen gene knockout of NCLX KO clones (F), PCR data on genomic DNA showing amplified products with primer pair sets (G), and RT-qPCR data from DLD1 cells and clones of DLD1 NCLX KO cells normalized to tubulin (H). (I) RT-PCR data showing SLC8B1 mRNA relative to tubulin in HCT116 cells transfected with shRNA against NCLX (shNCLX #2, shNCLX #3, and shNCLX #2+3) and normalized to scramble control. (J) Comparison of proliferation between HCT116 cells infected with scramble shRNA and two different NCLX shRNA sequences. (K, L) Representative image of HCT116 cells and HCT116 NCLX KO #33 cells stained with Hoechst and anti-cleaved caspase-3 antibody (K), and quantification of the percentage of cells showing cleaved caspase-3 staining (L). Each data point represents one replicate with each replicate representing the average values from at least three image fields. Total cell counted, HCT116 cells (n = 100), and HCT116 NCLX KO #33 cells (n = 135). (M, N) Quantification of % gap closure for HCT116 cells and clones of HCT116 NCLX KO cells after 6 hr (M), and with and without mitomycin (300 µM) treatment for 12 and 24 hr (N). (O) Quantification of in vitro invasion of DLD1 cells and clones of DLD1 NCLX KO cells. (P, Q) Western blots probed with anti-MMP1, anti-MMP9, and anti-GAPDH antibodies (P). Quantification of protein band intensities between DLD1 cells and DLD1NCLX KO clones relative to GAPDH (Q). (R, S) Western blots probed with anti-MMP1, anti-MMP9, and anti-GAPDH antibodies (R). Quantification of protein band intensities between HCT116 cells infected with scramble shRNA and NCLX shRNA #2, #3, and #2+three relative to GAPDH (S). All experiments were replicated ≥three times with similar results. Statistical significance was calculated using one-way ANOVA followed by a post-hock Tukey test, except for L, O, Q, and S, where paired t-test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 4 with 2 supplements
Abrogation of NCLX function in CRC cells causes mitochondrial damage, and enhances mitochondrial ROS.

(A, B) Flow cytometric analysis of mitochondrial membrane potential using the dye TMRE in HCT116 cells (A) and DLD1 cells (B) and their respective NCLX KO clones. Each data point represents one experimental replicate. 100 µM CCCP was added to cells as a positive control, and unstained cells were used as a negative control. (C) Representative images of a transmission electron micrograph of HCT116 cells and HCT116 NCLX KO cells. Red arrows indicate damaged mitochondria. (D–F) Quantification of mitochondrial area (D), number of damaged mitochondria (E), and number of cristae per mitochondria (F) in HCT116 cells and clones of HCT116 NCLX KO cells. (G–I) Western blots labeled with indicated antibodies with anti-GAPDH used as a loading control (G) and quantification of band intensity of LC3B II (H) and p62 (I) normalized to GAPDH in HCT116 cells and clones of HCT116 NCLX KO cells. (J–M) Oxygen consumption rate (OCR) of HCT116 cells and HCT116 NCLX KO clones (J,L), and quantification of basal respiration (Basal Res), spare respiratory capacity (Spare Res Cap), ATP generation (ATP Gen), and maximum respiration (Maximal Res) (K, M). (N, O) Flow cytometric analysis of mitochondrial ROS levels measured with the dye MitoSox in HCT116 cells (N) and DLD1 cells (O) and their respective NCLX KO clones. As a positive control, 50 µM antimycin was used and unstained cells were used as a negative control. All experiments were performed ≥three times with similar results. Statistical significance was calculated using one-way ANOVA followed by a post-hock Tukey test, except figure H, and I, where paired t-test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 4—figure supplement 1
Loss of NCLX in CRC cells inhibits mtCa2+ extrusion.

(A) Representative images of HCT116 cells and HCT116 NCLX KO cells loaded with the mitochondrial Ca2+ dye Rhod-2 AM. Cells were stimulated with 300 µM ATP in 5 mM extracellular Ca2+ at time 0, and the intensity of Rhod-2 was monitored at different times after ATP stimulation. (B–D) The fluorescence ratio of Rhod-2/mt-Green in response to ATP stimulation is monitored as a function of time in HCT116 cells (n = 370), and HCT116 NCLX KO#33 cells (n = 340) loaded with Rhod-2 and the mitochondrial marker mt-Green (used to normalize the Rhod-2 signal). Stimulation with 300 µM ATP in 5 mM extracellular Ca2+ causes rapid mitochondrial Ca2+ uptake (ascending phase) followed by Ca2+ extrusion (descending phase) (B). Quantification of Ca2+ uptake rate (C) and Ca2+ extrusion rate (D) from all cells in (B). (E) Representative images of DLD1 cells and DLD1 NCLX KO#6 cells loaded with the mitochondrial Ca2+ dye Rhod-2 AM and stimulated with 300 µM ATP in 5 mM extracellular Ca2+ in a manner similar to (A). (F–H) Similar recordings and analysis as (B–D), except that DLD1 cells (n = 63) and DLD1 NCLX KO #6 cells (n = 60) were utilized. (I–L) ATP-stimulated mitochondrial Ca2+ uptake and Ca2+ extrusion measured with the dye Rhod-2 in HCT116 (n = 72), HCT116 NCLX KO #37 (n = 118) cells (I), HCT116 (n = 198), and HCT116 NCLX KO #59 (n = 256) cells (J). Similar recordings in DLD1 (n = 109), DLD1 NCLX KO #24 (n = 90) cells (K), DLD1 (n = 179) and DLD1 NCLX KO #32 (n = 107) cells (L). The Rhod-2 intensity was normalized to mitoGFP intensity. The traces are represented as mean ± S.E. (M) RT-qPCR data depicting SLC8B1 mRNA levels in HCT116, DLD1, and HT29 cells transfected with siRNA against NCLX compared to their respective siRNA control-transfected cells. (N–P) ATP-stimulated mitochondrial Ca2+ uptake and Ca2+ extrusion measured with the dye Rhod-2 in scramble HCT116 (n = 48) and siNCLX HCT116 (n = 38) (N), with rates of Ca2+ uptake (O) and Ca2+ extrusion (P). (Q–S) Similar recordings to (N–P) in DLD1 cells with scramble DLD1(n = 16) and siNCLX DLD1(n = 17) (Q), rates of Ca2+ uptake (R) and Ca2+ extrusion (S). (T–V) Similar recordings to (N–P) and (Q–S) in HT29 cells with scramble HT29 (n = 14) and siNCLX HT29 (n = 8) (T) and rates of Ca2+ uptake (U) and Ca2+ extrusion (V). All traces are represented as mean ± S.E. (W, X) Representative cytosolic Ca2+ measurements in HCT116 (n = 110) and HCT116 NCLX KO #33 cells (n = 100) measured with Fura-2 in response 300 µM ATP applied first in nominally Ca2+-free external solution and subsequently with 10 mM external Ca2+. The traces are represented as mean ± S.E (O), and peak SOCE after addition of 10 mM Ca2+ is quantified in (P). All experiments were replicated ≥three times with similar results. Kruskal-Wallis ANOVA was used to calculate statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Figure 4—figure supplement 2
Loss of NCLX causes mitochondrial damage.

(A–C) Representative transmission electron micrographs (TEM) of mitochondria in HCT116, HCT116 NCLX KO #37 cells, HCT116 NCLX KO #59 cells (A), DLD1 cells, DLD1 NCLX KO#06 cells (B) with red arrows point to damaged mitochondria. TEM of mitochondria in HCT116 and HCT116 NCLX KO #33 cells, and the magnified image shows mitochondria encapsulated in a phagosome (C) with red arrow showing mitophagosomes (D, E) Quantification of autophagosome (D) and mitophagosomes (E) in HCT116 and HCT116 NCLX KO clones. (F, G) Western blots showing levels of LC3B and p62 in control DLD1 cells NCLX KO clones of DLD1 cells (F), and quantification of band intensity relative to loading control GAPDH (G). (H, I) Western blots probed with anti-LC3B and anti-p62 in HCT116 cells infected with control scrambled shRNA or three different NCLX shRNA conditions (H). Quantification of band intensity relative to HSC70 (I). (J–M) Measurement of OCR in DLD1 cells and DLD1 NCLX KO clone #06 (J, K) and from DLD1 NCLX KO clone #24, and clone #32 and (L, M). Quantification of Basal respiration (Basal Res), Spare respiratory capacity (Spare Res Cap), ATP generation (ATP Gen), and maximal respiration (Max Res) (K, M).(N, O) Western blots probed with a cocktail of antibody against electron transport chain complexes, including ATP5A for Complex-V, UQCRC2 for Complex-III, MTCO1 for Complex IV, SDHB for Complex-II, and NDUFB8 for Complex-I (N), and quantification of their band intensity (O). Same blot was probed with LC3B (Figure 4G) and OXPHOS proteins (Figure 4—figure supplement 2N). (P, Q) Representative images of mitoSox, and Hoechst fluorescence in siRNA control-transfected HCT116, HT29, and DLD1 cells with their respective siRNA NCLX-transfected cells (P). The mitoSox fluorescence intensity was quantified using flow cytometry (Q). All experiments were performed ≥three times. The statistics were calculated by paired t-test unless mentioned otherwise, *p≥0.05, **p≥0.01, ***p≥0.001.

Figure 5 with 1 supplement
Loss of NCLX leads to pro-metastatic transcriptional reprogramming.

(A) Volcano plot of differentially expressed genes between HCT116 cells and HCT116 NCLX KO #33 cells showing Log2 fold change vs. false discovery rate. The thresholds in the figure correspond to a false discovery rate <0.05 and log2 fold change <−1.5 or>1.5. Genes that are significantly upregulated and downregulated are represented in pink and light blue, respectively. (B) Pathway analysis showing normalized enrichment score. Positive enrichment score shows upregulated pathways, and negative enrichment score depicts downregulated pathways. (C–F) GSEA analysis of HCT116 cells and HCT116 NCLX KO #33 cells show a positive correlation in the enrichment of hallmark of glycolysis genes (C), a negative correlation of hallmark of G2M checkpoint genes (D), a positive correlation of hallmark of hypoxia-related genes (E), and hallmarks of epithelial-to-mesenchymal transition genes (F). (G) The heat map shows significantly increased expression of EMT genes in HCT116 NCLX KO #33 cells as compared to control HCT116 cells. (H–J) RT-qPCR showing mRNA levels NANOG (H), octamer-binding transcription factor 4 (Oct4) (I), and SRY-Box Transcription Factor 2 (Sox2) (J) in HCT116 cells and clones of HCT116 NCLX KO cells. (K) The proliferation of HCT116 cells and HCT116 NCLX KO #33 cells with and without 10 µM 5-FU treatment. All experiments were performed ≥three times with similar results. Statistical significance was calculated using a paired t-test except for K, where one-way ANOVA followed by a post-hock Tukey test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 5—figure supplement 1
Abrogation of NCLX function leads to transcriptional reprogramming.

(A) Heat map of expression of glycolytic genes that are significantly different between HCT116 cells and HCT116 NCLX KO #33 cells. (B, C) Gene set enrichment analysis (GSEA), and of HCT116 cells, and HCT116 NCLX KO #33 shows enrichment of positive correlation of hallmark of apoptotic genes (B) and heat map of differentially expressed apoptosis-related genes in NCLX KO #33 cells (C). (D) Heat map of differentially regulated cell-cycle genes in HCT116 cells and HCT116 NCLX KO #33 cells. (E, F) Gene set enrichment analysis (GSEA) (E) and heat map (F) of significantly different genes between HCT116 cells and HCT116 NCLX KO #33 cells. (G–N) RT-qPCR data plotted as the 2-ΔCt mRNA value of SLC7A11 (G), GCLM (H) in clones of HCT116 NCLX KO cells normalized to control HCT116 cells, and SLC7A11 (I), GCLM (J) NANOG (K), Sox2 (L), Fox3 (M), and Oct4 (N) in clones of DLD1 NCLX KO cells relative to tubulin and normalized to control DLD1 cells. (O) Schematic representation of HIF1α induced transcriptional activation of SLC7A11 and GCLM, leading to increased transcription of stem cell genes NANOG, Oct4, and Sox2 in CRC cells. Statistical significance was calculated by one-way ANOVA followed by a post-hock Tukey. *p<0.05, **p<0.01, and ***p<0.001.

Figure 6 with 1 supplement
NCLX deficiency stabilizes HIF1α and regulates migration in a mtROS-dependent manner.

(A–F) Western blot of HCT116 cells and clones of HCT116 NCLX KO cells (A), DLD1 cells and clones of DLD1 NCLX KO cells (C) and HCT116 cells infected with either scramble shRNA or three combinations of shRNA against NCLX (E) probed with anti-HIF1α, anti-GAPDH and anti-HSC70 antibody as a loading control, and quantification of HIF1α band intensity relative to HSC70 or GAPDH (B, D, and F). (G, H) Western blot showing HIF1α proteins in HCT116 cells and clones of HCT116 NCLX KO cells after treatment with 5 µM mitoTEMPO overnight (G), and quantification of HIF1α band intensity normalized to GAPDH (H). (I, J) Representative bright-field images of in vitro migration assay (I), and quantification of % gap closure (J) of HCT116 cells and clones of HCT116 NCLX KO cells, with and without treatment with 5 µM mitoTEMPO. Scale bar, 1 mm. (K) Proliferation of HCT116 cells and HCT116 NCLX KO #33 cells with and without 5 µM mitoTEMPO. All experiments were performed ≥three times with similar results. Statistical significance was calculated using the paired t-test unless mentioned otherwise. *p<0.05, **p<0.01, and ***p<0.001.

Figure 6—figure supplement 1
NCLX KO CRC cells show chemoresistance to 5-FU.

(A) The proliferation of HCT116 cells and HCT116 NCLX KO #33 cells in the presence of 0 µM, 1 µM, 10 µM, and 25 µM 5-FU (n = 3). (B) Measurement of IC50 of 5-FU for HCT116 and HCT116 NCLX KO #33 cells after treating the cells with 0 µM, 1 µM, 10 µM, and 25 µM 5-FU for 72 hr. (C) The proliferation of DLD1 cells and clones of DLD1 NCLX KO cells in the absence and presence of 10 µM 5-FU. (D, E) Quantification of migration of HCT116, clones of HCT116 NCLX KO cells (L), and DLD1 cells and clones of DLD1 NCLX KO cells (M) in the presence and absence of 10 µM 5-FU. (F–I) Immunoblot for phospho-AMPK, total AMPK (F), phosphor-S6K, total S6K (H) and loading control GAPDH protein levels, and quantification of band intensity normalized to GAPDH from HCT116 cells and HCT116 NCLX KO #33, #37, and #59 clones (G, I). All the experiments were replicated ≥three times with similar results. Statistical significance was calculated using the paired t-test, except for C, D, and E, where one-way ANOVA followed by a post-hock Tukey test was performed. *p<0.05, **p<0.01, and ***p<0.001.

Figure 7 with 1 supplement
Glycolysis is critical for migration of NCLX-deficient colorectal cancer cells.

(A) RT-qPCR analysis of glycolytic gene expression in HCT116 cells and three clones of HCT116 NCLX KO cells. RT-qPCR results are plotted as 2-ΔCt relative to tubulin and normalized to control. (B, C) Representative western blots probed with anti-ALDOA, anti-HK2, and anti-LDHA antibodies in HCT116 cells and HCT116 NCLX KO #33 cells. Anti-HSC70 antibody is used as a loading control (B) and quantification of band intensity relative to that of HSC70 (C). (D, E) Extracellular acidification rate (ECAR) of HCT116 cells (D) and DLD1 cells (E) and their respective NCLX KO clones were measured with Seahorse using the glycolysis stress test, as described in methods. (F) The percentage of metabolite dependency of HCT116 cells and HCT116 NCLX KO #33 cells measured using the Mitochondrial Fuel Flexibility, Dependency, and Capacity test, as described in methods. (G–J) Measurement of glucose consumption and lactate generation in HCT116, clones of HCT116 NCLX KO (G, H), DLD1, and clones of DLD1 NCLX KO (I, J) cells normalized to the amount of protein. (K) Proliferation of HCT116 cells and clones of HCT116 NCLX KO cells in the presence and absence of 2.5 mM 2-DG. (L, M) In vitro migration (L), and quantification (M) of HCT116 cells and clones of HCT116 NCLX KO cells in the presence and absence of 2.5 mM 2-DG for 24 hr (scale bar, 1 mm). (N) Summary of the findings from the present study. All experiments were performed ≥three times with similar results. Statistical significance was calculated using paired t-test, except for K, M, where one-way ANOVA followed by a post-hock Tukey test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 7—figure supplement 1
Loss of NCLX enhances glycolysis and diminishes mitochondrial respiration.

(A–D) Western blots for HK2, ALDOA, LDHA, with GAPDH as a loading control from HCT116, HCT116 NCLX KO #37, #59 (A), DLD1, clones of DLD1 NCLX KO cells (C), and quantification of band intensity normalized to GAPDH (B, D). (E, F) Western blots probed with anti-HK2, anti-ALDOA, anti-LDHA, and anti-HSC70 loading control (E), and quantification of band intensity (F) from HCT116 cells transfected with scramble and two different constructs of shNCLX. (G) RT-qPCR data plotted as 2-ΔCt mRNA values relative to tubulin and normalized to control, for Glucose-6-phosphate dehydrogenase (G6PD), Phosphogluconate dehydrogenase (PGD), and Transketolase (TKT) in HCT116 cells and HCT116 NCLX KO #33 cells. (H) Extracellular acidification rate (ECAR) measurement from DLD1 cells and clones of DLD1 NCLX KO cells. (I) The proliferation of DLD1 cells and clones of DLD1 NCLX KO cells in the presence and absence of 2.5 mM 2-DG. (J) Quantification of in vitro migration of DLD1 cells and clones of DLD1 NCLX KO cells in the presence and absence of 2.5 mM 2-DG for 24 hr. All experiments were performed ≥three times. The statistics were calculated by one-way ANOVA followed by post-hock Tukey's test except for B, D, and F where paired t-test was performed, *p≥0.05, **p≥0.01, ***p≥0.001.

Tables

Appendix 1—key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
information
Gene (Homo sapiens)SLC8B1/NCLXGenBankGene ID: 80024
Gene Mus musculusSlc8b1/NCLXGenBankGene ID: 170756
Genetic reagent Mus musculusNOD.CB17-Prkdcscid/JJackson LaboratoryStock No: 010636, RRID:IMSR_JAX:010636Male
Cell line (Homo-sapiens)HCT116 (colon, epithelial)ATCCATCC# CCL-247Male
Cell line (Homo-sapiens)HT29 (colon, epithelial)ATCCATCC# HTB-38Female
Cell line (Homo-sapiens)DLD1 (colon, epithelial)ATCCATCC# CCL-221Male
Cell line (Homo-sapiens)HCT116 NCLX KO (colon, epithelial)This paperNCLX Knockout clones of HCT116 cells were generated by the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens)DLD1 NCLX KO (colon, epithelial)This paperNCLX Knockout clones of DLD1 cells were generated in the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens)HCT116 shNCLX KO (colon, epithelial)This paperHCT116 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Cell line (Homo-sapiens)DLD1 sh NCLX KO (colon, epithelial)This paperDLD1 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Antibodyanti-Hif1α (Rabbit polyclonal)Cell Signaling TechnologyCat# 14179s,
RRID:AB_2622225
WB (1:500)
Antibodyanti- ALDOA (Rabbit polyclonal)Cell Signaling TechnologyCat# 8060S,
RRID:AB_2797635
WB (1:1000)
Antibodyanti- HK2 (Rabbit polyclonal)Cell Signaling TechnologyCat# 2867S, RRID:AB_2232946WB (1:1000)
Antibodyanti- LDHA (Rabbit polyclonal)Cell Signaling TechnologyCat# 2012S,
RRID:AB_2137173
WB (1:1000)
Antibodyanti- MMP1 (Rabbit polyclonal)AbcamCat# ab38929, RRID:AB_776395WB (1:1000)
Antibodyanti- MMP2 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-13594, RRID:AB_627956WB (1:500)
Antibodyanti- MMP9 (Rabbit polyclonal)AbcamCat# ab73734, RRID:AB_1860201WB (1:1000)
Antibodyanti- LC3B (Rabbit polyclonal)AbcamCat# ab51520, RRID:AB_881429WB (1:1000)
Antibodyanti- OXPHOS (Mouse monoclonal)AbcamCat# ab110413, RRID:AB_2629281WB (1:5000)
Antibodyanti- GAPDH (Mouse monoclonal)Millipore SigmaCat# MAB374, RRID:AB_2107445WB (1:10000)
Antibodyanti- HSC70 (Mouse monoclonal)Santa Cruz BiotechnologyCat# sc-24, RRID:AB_627760WB (1:5000)
Antibodyanti- p62 (Rabbit polyclonal)AbcamCat# ab109012, RRID:AB_2810880WB (1:1000)
Antibodyanti- cleaved caspase-3 (Rabbit polyclonal)Cell Signaling TechnologyCat# 9661S, RRID:AB_2341188WB (1:1000)
IF (1:500)
Antibodyanti- pAMPK (Rabbit polyclonal)Cell Signaling TechnologyCat# 2535S, RRID:AB_331250WB (1:1000)
Antibodyanti- AMPK (Rabbit polyclonal)Cell Signaling TechnologyCat# 5831S, RRID:AB_10622186WB (1:1000)
Antibodyanti- pS6K (Rabbit polyclonal)Cell Signaling TechnologyCat# 9234S, RRID:AB_2269803WB (1:1000)
Antibodyanti- S6K (Rabbit polyclonal)Cell Signaling TechnologyCat# 2708S, RRID:AB_390722WB (1:1000)
Sequence-based reagentSLC7A11_FThis paperRT-PCR primersAGGGTCACCTTCCAGAAATC
Sequence-based reagentSLC7A11_RThis paperRT-PCR primersGAAGATAAATCAGCCCAGCA
Sequence-based reagentGCLM _FThis paperRT-PCR primersCATTTACAGCCTTACTGGGAGG
Sequence-based reagentGCLM _RThis paperRT-PCR primersATGCAGTCAAATCTGGTGGCA
Sequence-based reagentFOX3_FThis paperRT-PCR primersCGGCTTCGGCTCTTAGCAAA
Sequence-based reagentFOX3_RThis paperRT-PCR primersCGGACAAACGGCTCACTCT
Sequence-based reagentNANOG _FThis paperRT-PCR primersTTTGTGGGCCTGAAGAAAACT
Sequence-based reagentNANOG _RThis paperRT-PCR primersAGGGCTGTCCTGAATAAGCAG
Sequence-based reagentOCT4_FThis paperRT-PCR primersTTCAGCCAAACGACCATCTG
Sequence-based reagentOCT4_RThis paperRT-PCR primersCACGAGGGTTTCTGCTTTGC
Sequence-based reagentSOX2_FThis paperRT-PCR primersGCCGAGTGGAAACTTTTGTCG
Sequence-based reagentSOX2_RThis paperRT-PCR primersGGCAGCGTGTACTTATCCTTCT
Sequence-based reagentGLUT1_FThis paperRT-PCR primersTATCGTCAACACGGCCTTCACT
Sequence-based reagentGLUT1_RThis paperRT-PCR primersAACAGCTCCTCGGGTGTCTTAT
Sequence-based reagentHK2_FThis paperRT-PCR primersGCCATCCTGCAACACTTAGGG
Sequence-based reagentHK2_RThis paperRT-PCR primersGTGAGGATGTAGCTTGTAGAGGGT
Sequence-based reagentGPI_FThis paperRT-PCR primersTGTGTTCACCAAGCTCACAC
Sequence-based reagentGPI_RThis paperRT-PCR primersGTAGAAGCGTCGTGAGAGGT
Sequence-based reagentALDOA_FThis paperRT-PCR primersAGGCCATGCTTGCACTCAG
Sequence-based reagentALDOA_RThis paperRT-PCR primersAGGGCCCAGGGCTTCAG
Sequence-based reagentENO1_FThis paperRT-PCR primersGACTTGGCTGGCAACTCTG
Sequence-based reagentENO1_RThis paperRT-PCR primersGGTCATCGGGAGACTTGAAG
Sequence-based reagentLDHA_FThis paperRT-PCR primersGGTTGGTGCTGTTGGCATGG
Sequence-based reagentLDHA_RThis paperRT-PCR primersTGCCCCAGCCGTGATAATGA
Sequence-based reagentMMP1_FThis paperRT-PCR primersATGCTGAAACCCTGAAGGTG
Sequence-based reagentMMP1_RThis paperRT-PCR primersGAGCATCCCCTCCAATACCT
Sequence-based reagentMMP2_FThis paperRT-PCR primersACCAGCTGGCCTAGTGATGATG
Sequence-based reagentMMP2_RThis paperRT-PCR primersGGCTTCCGCATGGTCTCGATG
Sequence-based reagentMMP9_FThis paperRT-PCR primersACGCACGACGTCTTCCAGTA
Sequence-based reagentMMP9_RThis paperRT-PCR primersCCACCTGGTTCAACTCACTCC
Sequence-based reagentqNCLX_1_FThis paperRT-PCR primersGCCAGCATTTGTGTCCATTT
Sequence-based reagentqNCLX_1_RThis paperRT-PCR primersAATTCGTCTCGGCCACTTAC
Sequence-based reagentqNCLX_2_FThis paperRT-PCR primersCCGGCAGAAGGCTGAATCTG
Sequence-based reagentqNCLX_2_RThis paperRT-PCR primersACCTTGCGGCAGTCTACCAC
Sequence-based reagentGAPDH_FThis paperRT-PCR primersGGGAAACCCATCACCATCTT
Sequence-based reagentGAPDH_RThis paperRT-PCR primersCCAGTAGACTCCACGACATACT
Sequence-based reagentG6PD_FThis paperRT-PCR primersCGAGGCCGTCACCAAGAAC
Sequence-based reagentG6PD_RThis paperRT-PCR primersGTAGTGGTCGATGCGGTAGA
Sequence-based reagentPGD_FThis paperRT-PCR primersATGGCCCAAGCTGACATCG
Sequence-based reagentPGD_RThis paperRT-PCR primersAAAGCCGTGGTCATTCATGTT
Sequence-based reagentTKT_FThis paperRT-PCR primersTCCACACCATGCGCTACAAG
Sequence-based reagentTKT_RThis paperRT-PCR primersCAAGTCGGAGCTGATCTTCCT
Sequence-based reagentg1This paperGuide RNA sequences (Figure 2A and Figure 3—figure supplement 1A)GCGCAGATTCAGCCTTCTGC
Sequence-based reagentg2This paperGuide RNA sequences (Figure 3—figure supplement 1B and C)GGGATACTCACGTCTACCAC
Sequence-based reagentg3This paperGuide RNA sequences (Figure 3—figure supplement 1E)GTAGACGTGAGTATCCCGGT
Sequence-based reagentg4This paperGuide RNA sequences (Figure 3—figure supplement 1E)ACCCACACCAGCAGTCCGTC
Sequence-based reagentshRNA (shNCLX#2)This paperFigure 3—figure supplement 1IGCCTTCTTGCTGTCATGCAAT
Sequence-based reagentshRNA (shNCLX#3)This paperFigure 3—figure supplement 1IGCTCCTCTTCTACCTGAACTT
Sequence-based reagentsiRNA (siNCLX)This paperFigure 4—figure supplement 1MAACGGCCCCUCAACUGUCUT
Sequence-based reagentNCLX_1This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)GCGTGCTGGTTACCACAG T
Sequence-based reagentNCLX_2This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CCACGGAAGAGCATGAGGAA
Sequence-based reagentNCLX_3This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)ACTTAGCACATCGCCACC TG
Sequence-based reagentNCLX_4This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CTGATCTGCACGCTGAAT GG
Sequence-based reagentNCLX_5This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)GAGGTACACAGCAGTTCT CCC
Sequence-based reagentNCLX_6This paperPCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F)CAGCTGGTGCCCTCAAAC AC
Sequence-based reagentpx77This paperPCR primers for genotyping NCLX -/- miceTACAGTCTGGCTCGTTCC CT
Sequence-based reagentpx78This paperPCR primers for genotyping NCLX -/- miceCGGTCCCAGACGCCG T
Sequence-based reagentpx79This paperPCR primers for genotyping NCLX -/- miceCGCTGGGGTCCATCT TTG AT
Sequence-based reagentpx80This paperPCR primers for genotyping NCLX -/- miceTGGGTCTCCGGTCCCAGT A
Commercial assay or kitcDNA Reverse Transcription KitApplied biosystemsCat# 4368814
Commercial assay or kitSeahorse XFp Mito Fuel Flex Test KitAgilent TechnologiesCat# 103270-100
Commercial assay or kitSeahorse XFp Glycolysis Stress Test KitAgilent TechnologiesCat# 103017-100
Commercial assay or kitSeahorse XFp Cell Mito Stress Test KitAgilent TechnologiesCat# 103010-100
Commercial assay or kitBCA assay kitThermo Fisher ScientificCat# A53225
Commercial assay or kitTMREThermo Fisher ScientificCat# T669
Commercial assay or kitCyQUANTThermo Fisher ScientificCat# C35006
Chemical compound, drugAntibiotic and AntimycoticThermo Fisher ScientificCat# 15240062
Chemical compound, drugMcCoy’s 5ACorningCat# 10-050CV
Chemical compound, drugRPMI-1640CorningCat# 10-040CV
Chemical compound, drugLipofectamine 2000Thermo Fisher ScientificCat# 11668019
Chemical compound, drugTrypLEThermo Fisher ScientificCat# 12605028
Chemical compound, drugCoCl2Sigma-AldrichCat# 15862
Chemical compound, drug2-deoxy-D-glucose (2-DG)Sigma-AldrichCat# D8375
Chemical compound, drug5- FluorouracilSigma-AldrichCat# F6627
Chemical compound, drugGlucoseSigma-AldrichCat# D9434
Chemical compound, drugPuromycinMP BiomedicalCat# 02100552
Chemical compound, drugRIPA bufferSigmaCat# R0278
Chemical compound, drugATPSigmaCat# A9187
Chemical compound, drugDextroseFisher ScientificCat# D14
Chemical compound, drugTris BaseFisher ScientificCat# BP152-5
Chemical compound, drugNaClFisher ScientificCat# S671
Chemical compound, drugMOPS SDS running bufferThermo Fisher ScientificCat# NP0001
Chemical compound, drugTris-Glycine transfer bufferBio-radCat#161-0734
Chemical compound, drugKClFisher ScientificCat# P217
Chemical compound, drugMgCl2Fisher ScientificCat# M33
Chemical compound, drugCaCl2Fisher ScientificCat# C614
Chemical compound, drugHEPESFisher ScientificCat# BP310
Chemical compound, drugLDS sample bufferThermo Fisher ScientificCat# NP0007
Chemical compound, drugNuPAGE Bis-Tris precast gelsThermo Fisher ScientificCat# NP0321
Chemical compound, drugPolyvinylidene difluoride membraneLi-Core BiosciencesCat# 88518
Chemical compound, drugOdyssey Blocking Buffer (TBS)Li-Core BiosciencesCat# 937-50003
Chemical compound, drugDextran sulfate sodiumMP BiomedicalCat# 0216011080
Chemical compound, drugAzoxymethaneSigmaCat# A5486
Chemical compound, drugDNase IThermo Fisher ScientificCat# 18068-015
Chemical compound, drugTRIzolThermo Fisher ScientificCat# 15596018
Chemical compound, drugSeahorse XF DMEM Medium pH 7.4Agilent TechnologiesCat# 103575-100
Chemical compound, drugSeahorse XF 100 mM pyruvate solutionAgilent TechnologiesCat# 103578-100
Chemical compound, drugSeahorse XF 200 mM glutamine solutionAgilent TechnologiesCat# 103579-100
Chemical compound, drugSeahorse XF 1.0 M glucose solutionAgilent TechnologiesCat# 103577-100
Chemical compound, drugZymogram Developing Buffer (10X)Thermo Fisher ScientificCat# LC2671
Chemical compound, drugZymogram Renaturing Buffer (10X)Thermo Fisher ScientificCat# LC2670
Chemical compound, drugTris-Glycine SDS Running Buffer (10X)Thermo Fisher ScientificCat# LC2675
Chemical compound, drugTween 20Fisher ScientificCat# BP337
Software, algorithmImage Jhttps://imagej.net/RRID:SCR_003070
OtherDAPISigma-AldrichCat# D95421µg/ml
OtherHoechstThermo Fisher ScientificCat# H35701µg/ml
OtherIRDye 800CW Goat anti-MouseLi-Core BiosciencesCat# 925-322101:10000
OtherIRDye 800CW Donkey anti-RabbitLi-Core BiosciencesCat# 925-322131:5000
OtherMitoSox RedThermo Fisher ScientificCat# M36008
OtherMito TEMPOThermo Fisher ScientificCat# SML0737
OtherMito Tracker Green FMThermo Fisher ScientificCat# M7514
OtherMito Tracker Deep red FMCell Signaling TechnologyCat# 8778S
OtherFura-2 AMThermo Fisher ScientificCat# F1221
OtherFluoroBlokCorningCat# 351152
OtherBioCoat Tumor Invasion PlateCorningCat# 80774380
OtherSYBER select master mixThermo Fisher ScientificCat# 4472920
OtherNovex 10% Zymogram Plus (Gelatin) Protein Gels, 1.0 mm, 10-wellThermo Fisher ScientificCat# ZY00100
OtherSimplyBlue Safe StainThermo Fisher ScientificCat# LC6060

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Trayambak Pathak
  2. Maxime Gueguinou
  3. Vonn Walter
  4. Celine Delierneux
  5. Martin T Johnson
  6. Xuexin Zhang
  7. Ping Xin
  8. Ryan E Yoast
  9. Scott M Emrich
  10. Gregory S Yochum
  11. Israel Sekler
  12. Walter A Koltun
  13. Donald L Gill
  14. Nadine Hempel
  15. Mohamed Trebak
(2020)
Dichotomous role of the human mitochondrial Na+/Ca2+/Li+ exchanger NCLX in colorectal cancer growth and metastasis
eLife 9:e59686.
https://doi.org/10.7554/eLife.59686