1. Evolutionary Biology
  2. Microbiology and Infectious Disease
Download icon

Mutational resilience of antiviral restriction favors primate TRIM5α in host-virus evolutionary arms races

  1. Jeannette L Tenthorey  Is a corresponding author
  2. Candice Young
  3. Afeez Sodeinde
  4. Michael Emerman
  5. Harmit S Malik
  1. Division of Basic Sciences, Fred Hutchinson Cancer Research Center, United States
  2. Division of Human Biology, Fred Hutchinson Cancer Research Center, United States
  3. Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, United States
Research Article
Cite this article as: eLife 2020;9:e59988 doi: 10.7554/eLife.59988
6 figures, 2 tables and 1 additional file

Figures

TRIM5α has sampled limited amino acid diversity, even at rapidly evolving positions.

(A) Alignment of TRIM5α from simian primates. A 20-amino acid duplication in the v1 loop of the African green monkey clade is abbreviated as ‘+20’. Amino acid numbering follows human TRIM5α. Rapidly evolving residues are indicated with black arrows and gray boxes. (B) Evolutionarily accessible amino acids were defined as within 1 nucleotide of any codon in this alignment, and the fraction of accessible variants sampled among aligned sequences was determined for each position. (C-D) Theoretical possibilities for antiviral protein evolutionary landscapes, with antiviral potency represented in z and color axes as it varies with single point mutations. Fitness landscapes might be highly constrained (C) or permissive (D).

Figure 1—source data 1

Codons that are evolutionarily accessible to primate TRIM5α.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig1-data1-v1.xlsx
Selection scheme to identify human TRIM5α variants that gain HIV-1 restriction.

(A) A DMS library, encoding all single amino acid variants within the v1 loop (rapidly evolving sites are boxed), was generated by PCR with degenerate NNS codons. The library was transduced into naturally TRIM5α-deficient CRFK cells at low MOI (multiplicity of infection) and selected using puromycin. Colors represent different TRIM5α variants. (B) Pooled TRIM5α-expressing cells were infected with HIV-1-GFP virus-like particles (VLPs) at a high dose. GFP-negative cells were FACS sorted, re-infected, and re-sorted. Restrictive TRIM5α variants were then sequenced, and variant frequencies were normalized to input representation. (C) Amino acid enrichment scores are highly correlated across two biological replicates. Each dot represents a unique amino acid sequence, averaged across synonymous codons. (D) Nonsense variants (red, n = 11) are depleted relative to WT (blue, n = 10) and most missense (gray) variants; ****p<0.0001, student’s unpaired t-test. Enrichment is averaged across synonymous codons and replicates, except for WT variants, which are averaged only across replicates to better visualize variance (WT mean ±2 standard deviations is indicated). (E) HIV-1 fold-restriction by TRIM5α was measured by the increase in ID10 (viral dose at which 10% of cells are infected) relative to an empty vector control. (F) Enrichment scores are highly correlated with HIV-1 restriction (n ≥ 3 biological replicates) for re-tested variants. (D-F) Error bars, SD.

Figure 2—source data 1

Quality control of DMS libraries.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig2-data1-v1.xlsx
Figure 2—source data 2

Enrichment scores for human TRIM5α gain-of-function against HIV-1.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig2-data2-v1.xlsx
Figure 2—source data 3

Validation of human TRIM5α gain-of-function screen against HIV-1.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig2-data3-v1.xlsx
Figure 3 with 1 supplement
Many single mutations improve human TRIM5α restriction of HIV-1, primarily by removal of positive charge.

(A) Enrichment in the HIV-1 restrictor pool relative to WT (white) for each TRIM5α variant, arrayed by position mutated and amino acid mutation, is indicated by color intensity. Variants marked with X were excluded due to low input representation. (B-C) Enrichment scores for each position across all amino acid variants (B) or each amino acid across all positions (C); statistics reported in comparison to WT. Rapidly evolving sites are indicated by black arrows. (D) Box plot of missense mutations grouped by their effect on the net v1 loop charge; WT has a net v1 charge of +2. (E) Gain-of-function mutations were tested against HIV-1 individually or in combination with R332P, and fold-restriction was determined as in Figure 2E. TRIM5α expression levels in CRFK cells were analyzed by immunoblot (IB) against the C-terminal HA tag (blot representative of three independent experiments). (B-E) *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; one-way ANOVA with Holm-Sidak’s correction for multiple comparisons and (B-D) correction for unequal variances.

Figure 3—source data 1

Enrichment scores and p-values for human TRIM5α gain-of-function against HIV-1.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig3-data1-v1.xlsx
Figure 3—source data 2

Raw western blots of human TRIM5α variants.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig3-data2-v1.png.pdf
Figure 3—source data 3

Quantification of human TRIM5α western blots.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig3-data3-v1.xlsx
Figure 3—source data 4

HIV-1 fold restriction by human TRIM5α double mutants.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig3-data4-v1.xlsx
Figure 3—figure supplement 1
Some, but not all, human TRIM5α gain-of-function mutations against HIV-1 increase TRIM5α expression level.

(A) Representative immunoblot (IB) for TRIM5α expression in CRFK cells. (B) TRIM5α-HA band intensity was normalized to β-actin, and then further normalized to WT TRIM5α to determine relative expression. Results from three independent experiments. HIV-1 restriction was calculated in Figure 2F. Error bars, SD. (C-D) TRIM5α variants from (B) were grouped according to net v1 charge to assess the effect of charge on HIV-1 restriction (C) or TRIM5α expression level (D).

Figure 4 with 2 supplements
Evolutionary landscapes are generally permissive for evolving novel lentiviral restriction, which is resilient to most mutations once achieved.

(A) CRFK cells expressing the indicated human TRIM5α variant were challenged with GFP-marked lentiviral VLPs to determine fold-restriction as in Figure 2E. Results from at least three independent experiments. (B) To determine whether newly acquired viral restriction tolerates mutations, a second human TRIM5α v1 DMS library was generated with R332P fixed in all variants. This library of cells was infected with HIV-1-GFP VLPs, and GFP-positive (non-restrictor) cells were sorted and sequenced. (C) Stop codon variants (red, n = 10) are highly enriched in the non-restrictor pool compared to WT (R332P, blue, n = 9) variants (****p<0.0001, student’s unpaired t-test with Welch’s correction), while 65% of all missense variants fall less than 2 SD above WT (R332P) mean. Enrichment scores between two biological replicates are well correlated. (A, C) Error bars, SD.

Figure 4—source data 1

TRIM5α v1-dependence of lentivirus restriction.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig4-data1-v1.xlsx
Figure 4—source data 2

Lentiviral restriction by human TRIM5α single mutants.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig4-data2-v1.xlsx
Figure 4—source data 3

Enrichment scores and p-values for human TRIM5α-R332P loss-of-function against HIV-1.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
Lentiviral restriction by TRIM5α is v1-dependent.

CRFK cells expressing human, rhesus, or human TRIM5α with the v1 loop exchanged for that of rhesus were challenged with GFP-marked lentiviral VLPs. Results representative of at least three independent experiments.

Figure 4—figure supplement 2
Biochemical preferences for human TRIM5α-R332P restriction of HIV-1.

(A) Enrichment in the HIV-1 non-restrictor pool relative to R332P (white) for each human TRIM5α-R332P variant, arrayed by position and amino acid variant, is indicated by color intensity. Variants marked with X were excluded due to low input representation; no variation was present at position 332 (black box). Arrows indicate rapidly evolving sites. (B) Missense variants at each position (across all variants) or each amino acid (across all positions); one-way ANOVA compared to R332P with corrections for multiple comparisons (Holm-Sidak) and unequal variances (Geisser-Greenhouse); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. (C) Positive charge is detrimental to human TRIM5α restriction of HIV-1, both for WT and R332P variants (Spearman r = −0.60). Missense mutations that increase positive charge (green) weaken R332P restriction, while those that negate positive charge (orange) improve WT restriction of HIV-1. Dashed lines indicate 2 SD above or below the mean enrichment for WT variants (blue) in each screen.

Rhesus macaque TRIM5α restriction of HIV-1 tolerates many mutations.

A rhesus TRIM5α v1 DMS library was infected with HIV-1-GFP VLPs, and GFP-positive (non-restrictor) cells were sorted and sequenced. (A) Nonsense variants are highly enriched in the non-restrictor pool compared to WT (n = 13; ****p<0.0001, student’s unpaired t-test with Welch’s correction), while half of all missense variants fall less than 2 SD above WT. Enrichment scores between two biological replicates are highly correlated. (B) Re-testing individual variants confirms that enriched variants have partially lost HIV-1 restriction, while depleted variants do not differ from WT. Spearman r; error bars, SD; n ≥ 3 biological replicates. (C) Steady-state levels of TRIM5α variants stably expressed in CRFK cells; results representative of two independent immunoblots (IB). (D) Enrichment in the HIV-1 non-restrictor pool relative to WT (white) for each variant, arrayed by position and amino acid mutation, is indicated by color intensity. The color scale was slightly compressed to avoid exaggerating a single mutant (L343stop) with enrichment >4.5. Rapidly evolving sites are indicated with arrows. Statistical tests compare each position (across all variants) or each amino acid (across all positions) to WT, one-way ANOVA with Geisser-Greenhouse non-sphericity and Holm-Sidak’s multiple comparisons corrections; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Figure 5—source data 1

Enrichment scores and p-values for rhesus TRIM5α loss-of-function against HIV-1.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig5-data1-v1.xlsx
Figure 5—source data 2

Validation of rhesus TRIM5α loss-of-function screen against HIV-1.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig5-data2-v1.xlsx
Figure 5—source data 3

Raw western blots of rhesus TRIM5α.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig5-data3-v1.png.pdf
Figure 6 with 3 supplements
N-MLV restriction by primate TRIM5α is robust to single point mutations.

The rhesus (A) or WT human (B) v1 DMS libraries were infected with N-MLV-GFP VLPs, and GFP-positive (non-restrictor) cells were sorted and sequenced. Nonsense variants are highly enriched in the non-restrictor pool compared to WT in both screens; ****p<0.0001, student’s unpaired t-test with Welch’s correction. Error bars, SD. The fraction of all missense variants less than 2SD above WT mean is indicated. Enrichment scores between two biological replicates are highly correlated.

Figure 6—source data 1

Enrichment scores and p-values for human and rhesus TRIM5α loss-of-function against N-MLV.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig6-data1-v1.xlsx
Figure 6—source data 2

Validation of human and rhesus TRIM5α loss-of-function screen against N-MLV.

https://cdn.elifesciences.org/articles/59988/elife-59988-fig6-data2-v1.xlsx
Figure 6—figure supplement 1
Biochemical preferences for rhesus TRIM5α restriction of N-MLV are distinct from HIV-1.

(A) Enrichment scores in the N-MLV non-restrictor pool for each variant are arrayed by position and amino acid mutation. Enrichment (decreased restriction, red) relative to WT (white) is indicated by color intensity. (B) Missense variants at each position (across all variants) or each amino acid (across all positions); one-way ANOVA compared to WT with Geisser-Greenhouse non-sphericity and Holm-Sidak’s multiple comparisons corrections; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. (C) Re-testing individual mutations confirms that enriched mutants have lost restriction (Spearman r = −0.81). Error bars, SD; n = 2 biological replicates. (D) Rhesus TRIM5α restriction of HIV-1 and N-MLV has partially overlapping biochemical requirements. Positive charge (K/R, green) breaks only HIV-1 restriction, whereas stop codons (red) and aromatic residues (F/W/Y, yellow) weaken restriction of both viruses. Excluding K and R improves the correlation compared to all variants (Spearman r = 0.66 or 0.50, respectively). Dashed lines indicate 2 SD above and below the mean enrichment for WT variants (blue) in each screen.

Figure 6—figure supplement 2
Missense mutations do not disrupt human TRIM5α restriction of N-MLV.

(A) Enrichment scores in the N-MLV non-restrictor pool for each variant are arrayed by position and amino acid mutant. Enrichment (decreased restriction, red) relative to WT (white) is indicated by color intensity. Variants marked with X were excluded due to low input representation. Rapidly evolving residues are indicated with black arrows. (B) Missense variants at each position (across all variants) or each amino acid (across all positions); one-way ANOVA compared to WT with Geisser-Greenhouse non-sphericity and Holm-Sidak’s multiple comparisons corrections; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. (C) Re-testing individual mutations confirms that mutations have little effect on N-MLV restriction. Results are representative of at least three independent experiments. (D) HIV-1 gain-of-restriction compared to N-MLV loss-of-restriction. No anti-correlation is evident, with the exception of stop codons (red). Dashed lines indicate 2 SD above and below the mean enrichment for WT variants (blue) in each screen.

Figure 6—figure supplement 3
Summary of deep mutational scanning results.

Random missense mutations in human TRIM5α frequently improve HIV-1 restriction. Multiple TRIM5α orthologs, including a de novo HIV-1 restrictor (human TRIM5α-R332P), display high mutational resilience against two distantly related retroviruses. Arrow thickness represents antiviral potency; the fraction of missense mutants that gain or retain function are indicated.

Tables

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Gene (Homo sapiens)TRIM5αNCBINM_033034.2
Gene (Macaca mulatta)TRIM5αNCBINM_001032910.1
Strain, strain background (Escherichia coli)DH5αNEBC2987HChemically competent cells
Cell line (Homo sapiens)HEK-293T/17ATCCCRL-11268; RRID:CVCL_1926Purchased fresh stock from ATCC
Cell line (Felis catus)CRFKATCCCCL-94; RRID:CVCL_2426Purchased fresh stock from ATCC
Cell line (Felis catus)CRFK + Human TRIM5αThis studyCell line stably expressing human TRIM5α (from ~ single random integration event per cell); see Materials and methods
Cell line (Felis catus)CRFK + Human-v1DMS TRIM5αThis studyCell line stably expressing library of human TRIM5α single amino acid variants; see Materials and methods
Cell line (Felis catus)CRFK + Human-R332P TRIM5αThis studyCell line stably expressing human TRIM5α-R332P; see Materials and methods
Cell line (Felis catus)CRFK + Human-R332P-v1DMS TRIM5αThis studyCell line stably expressing library of human TRIM5α-R332P single amino acid variants; see Materials and methods
Cell line (Felis catus)CRFK + Rhesus TRIM5αThis studyCell line stably expressing rhesus TRIM5α; see Materials and methods
Cell line (Felis catus)CRFK + Rhesus-v1DMS TRIM5αThis studyCell line stably expressing library of rhesus TRIM5α single amino acid variants; see Materials and methods
Antibodyanti-HA.11 (mouse monoclonal)Biolegend901516; RRID:AB_2565335(1:1000)
Antibodyanti-β-actin (rabbit polyclonal)Abcamab8227; RRID:AB_2305186(1:5000)
AntibodyIRDye 680RD anti-mouse (donkey polyclonal)LI-COR926–68072; RRID:AB_10953628(1:10,000) (secondary)
AntibodyIRDye 800CW anti-rabbit (donkey polyclonal)LI-COR926–32213; RRID:AB_621848(1:10,000) (secondary)
Recombinant DNA reagentMD2.GAddgene12259VSV-G expression, CMV promoter
Recombinant DNA reagentL-VSV-GPMID:9245614VSV-G expression, Tat-driven
Recombinant DNA reagentCMV-TatPMID:9245614Tat expression, CMV promoter
Recombinant DNA reagentpHIV-ZsGreenPMID:18371425HIV-1 transfer vector
Recombinant DNA reagentpALPS-eGFPPMID:30546110HIV-1 transfer vector
Recombinant DNA reagentp8.9NdSB bGH Blp1 BstEIIPMID:15479815NL4.3 HIV-1 gag/pol
Recombinant DNA reagentp8.9NdSB bGH Blp1 BstEII HIV-2 CAPMID:26181333NL4.3 HIV-1 gag/pol with HIV-2ROD CA residues 1–202
Recombinant DNA reagentpHIV-MACPMID:18417575HIV-1 gag/pol with SIVmac239 CA residues 1–146 (A77V)
Recombinant DNA reagentpHIV-Gb2PMID:18417575HIV-1 gag/pol with SIVcpzGab2 CA residues 1–146
Recombinant DNA reagentpCIG3NPMID:10906195N-MLV gag/pol
Recombinant DNA reagentpQCXIPTakara Bio631516Puromycin-selectable retroviral expression cassette
Recombinant DNA reagentpQCXIP-eGFPThis studyN-MLV transfer vector; see Materials and methods
Recombinant DNA reagentpQCXIP-Human TRIM5α-HAThis studyStable expression of human TRIM5α; see Materials and methods
Recombinant DNA reagentpQCXIP-Human-R332P TRIM5α-HAThis studyStable expression of human TRIM5α-R332P; see Materials and methods
Recombinant DNA reagentpQCXIP-Human-v1rhesus TRIM5α-HAThis studyStable expression of human TRIM5α containing rhesus v1 loop; see Materials and methods
Recombinant DNA reagentpQCXIP-Rhesus TRIM5α-HAThis studyStable expression of rhesus TRIM5α; see Materials and methods
Peptide, recombinant proteinQ5 high-fidelity DNA polymeraseNEBM4091LUsed for Quikchange and DMS library construction
Commercial assay or kitNEBuilder HiFi DNA assembly cloning kitNEBE5520SGibson assembly kit
Commercial assay or kitPureYield plasmid miniprep kitPromegaA2495Transfection-quality plasmid miniprep (low LPS)
Commercial assay or kitNuceloBond Xtra midiprep kitTakara Bio740410.50Transfection-quality plasmid midiprep (low LPS)
Commercial assay or kitDNeasy Blood and Tissue kitQiagen69504Genomic DNA purification
Commercial assay or kitQIAquick PCR purification kitQiagen28106PCR cleanup kit
Commercial assay or kitAgencourt Ampure XP beadsBeckman CoulterA63880Double-sided size selection of PCR products
Chemical compound, drugTrans-IT 293T transfection reagentMirus BioMIR 2700Transfect plasmids into HEK-293T
Chemical compound, drugpolybreneSigmaTR-1003-GTransduction reagent
Cchemical compound, drugpuromycinFisher50488918Antibiotic selection for stably transduced cells
Software, algorithmDMS data analysisThis studyhttps://github.com/jtenthor/T5DMS_data_analysisR scripts for DMS data analysis; see Materials and methods
Software, algorithmPAMLPMID:967129For analysis of rapid evolution
Table 1
Primers used in this study.
PrimerUseSequence
Subcloning TRIM5α constructs
(human, human-v1rhesus, rhesus) into pQCXIP
oJT029Amplify human or rhesus TRIM5α-HA (Fwd), add NotI site, for cloning into pQCXIPcaagcggccgcgccaccATGGCTTCTGGAATC
oJT030Amplify human or rhesus TRIM5α-HA (Rev), add EcoRI site, for cloning into pQCXIPgcggaattcTCAagcgtagtctgggacgtc
DMS library construction
oJT037Flanking primer for all DMS library construction (Fwd), amplifies pQCXIP backbone 5' of NotI site for Gibson cloning with pQCXIP-TRIM5α digested with NotI and BamHIacctgcaggaattgatccgcggcc
oJT038Flanking primer for rhesus DMS library construction (Rev), amplifies rhesus TRIM5α 3' of BamHI site for Gibson cloning with pQCXIP-TRIM5α digested with NotI and BamHIGGATTGGAAGCCAGCACATACCCCCAG
oJT003Randomize rhesus TRIM5α at codon Q332 (Fwd primer, use w/oJT038 for C-term half)CGGAACCCACAGATAATGTATNNSGCACCAGGGACATTATTTAC
oJT004Randomize rhesus TRIM5α at codon Q332 (Rev primer, use w/oJT037 for N-term half)GTAAATAATGTCCCTGGTGCSNNATACATTATCTGTGGGTTCCG
oJT005Randomize rhesus TRIM5α at codon A333 (Fwd primer, use w/oJT038 for C-term half)GAACCCACAGATAATGTATCAGNNSCCAGGGACATTATTTACGTTTC
oJT006Randomize rhesus TRIM5α at codon A333 (Rev primer, use w/oJT037 for N-term half)GAAACGTAAATAATGTCCCTGGSNNCTGATACATTATCTGTGGGTTC
oJT007Randomize rhesus TRIM5α at codon P334 (Fwd primer, use w/oJT038 for C-term half)CCACAGATAATGTATCAGGCANNSGGGACATTATTTACGTTTCCG
oJT008Randomize rhesus TRIM5α at codon P334 (Rev primer, use w/oJT037 for N-term half)CGGAAACGTAAATAATGTCCCSNNTGCCTGATACATTATCTGTGG
oJT009Randomize rhesus TRIM5α at codon G335 (Fwd primer, use w/oJT038 for C-term half)CAGATAATGTATCAGGCACCANNSACATTATTTACGTTTCCGTCAC
oJT010Randomize rhesus TRIM5α at codon G335 (Rev primer, use w/oJT037 for N-term half)GTGACGGAAACGTAAATAATGTSNNTGGTGCCTGATACATTATCTG
oJT011Randomize rhesus TRIM5α at codon T336 (Fwd primer, use w/oJT038 for C-term half)ATGTATCAGGCACCAGGGNNSTTATTTACGTTTCCGTCACTCAC
oJT012Randomize rhesus TRIM5α at codon T336 (Rev primer, use w/oJT037 for N-term half)GTGAGTGACGGAAACGTAAATAASNNCCCTGGTGCCTGATACAT
oJT013Randomize rhesus TRIM5α at codon L337 (Fwd primer, use w/oJT038 for C-term half)TATCAGGCACCAGGGACANNSTTTACGTTTCCGTCACTCAC
oJT014Randomize rhesus TRIM5α at codon L337 (Rev primer, use w/oJT037 for N-term half)GTGAGTGACGGAAACGTAAASNNTGTCCCTGGTGCCTGATA
oJT015Randomize rhesus TRIM5α at codon F338 (Fwd primer, use w/oJT038 for C-term half)CAGGCACCAGGGACATTANNSACGTTTCCGTCACTCACG
oJT016Randomize rhesus TRIM5α at codon F338 (Rev primer, use w/oJT037 for N-term half)CGTGAGTGACGGAAACGTSNNTAATGTCCCTGGTGCCTG
oJT017Randomize rhesus TRIM5α at codon T339 (Fwd primer, use w/oJT038 for C-term half)AGGCACCAGGGACATTATTTNNSTTTCCGTCACTCACGAATTTC
oJT018Randomize rhesus TRIM5α at codon T339 (Rev primer, use w/oJT037 for N-term half)GAAATTCGTGAGTGACGGAAASNNAAATAATGTCCCTGGTGCCT
oJT019Randomize rhesus TRIM5α at codon F340 (Fwd primer, use w/oJT038 for C-term half)CACCAGGGACATTATTTACGNNSCCGTCACTCACGAATTTCAAT
oJT020Randomize rhesus TRIM5α at codon F340 (Rev primer, use w/oJT037 for N-term half)ATTGAAATTCGTGAGTGACGGSNNCGTAAATAATGTCCCTGGTG
oJT021Randomize rhesus TRIM5α at codon P341 (Fwd primer, use w/oJT038 for C-term half)ACCAGGGACATTATTTACGTTTNNSTCACTCACGAATTTCAATTATTGTA
oJT022Randomize rhesus TRIM5α at codon P341 (Rev primer, use w/oJT037 for N-term half)TACAATAATTGAAATTCGTGAGTGASNNAAACGTAAATAATGTCCCTGGT
oJT023Randomize rhesus TRIM5α at codon S342 (Fwd primer, use w/oJT038 for C-term half)GGGACATTATTTACGTTTCCGNNSCTCACGAATTTCAATTATTGTACT
oJT024Randomize rhesus TRIM5α at codon S342 (Rev primer, use w/oJT037 for N-term half)AGTACAATAATTGAAATTCGTGAGSNNCGGAAACGTAAATAATGTCCC
oJT025Randomize rhesus TRIM5α at codon L343 (Fwd primer, use w/oJT038 for C-term half)GACATTATTTACGTTTCCGTCANNSACGAATTTCAATTATTGTACTGGC
oJT026Randomize rhesus TRIM5α at codon L343 (Rev primer, use w/oJT037 for N-term half)GCCAGTACAATAATTGAAATTCGTSNNTGACGGAAACGTAAATAATGTC
oJT027Randomize rhesus TRIM5α at codon T344 (Fwd primer, use w/oJT038 for C-term half)CATTATTTACGTTTCCGTCACTCNNSAATTTCAATTATTGTACTGGCGTC
oJT028Randomize rhesus TRIM5α at codon T344 (Rev primer, use w/oJT037 for N-term half)GACGCCAGTACAATAATTGAAATTSNNGAGTGACGGAAACGTAAATAATG
oAS024Flanking primer for human DMS libraries (Rev), amplifies human TRIM5α 3' of BamHI site for Gibson cloning with pQCXIP-TRIM5α digested with NotI and BamHIAGCACATACCCCCAGGATCCAAGCAG
oAS002Amplify N-term half of human TRIM5α (WT or R332P) before codon G330, to hybridize w/randomized G330 C-term half (Rev primer, use w/oJT037)ATATATTATCTGTGGTTTCGGAGAGC
oAS001Randomize human TRIM5α (WT) at codon G330 (Fwd primer, use w/oAS024 for C-term half)GCTCTCCGAAACCACAGATAATATATNNSGCACGAGGGACAAGATACC
oJT142Randomize human TRIM5α (R332P) at codon G330 (Fwd primer, use w/oAS024 for C-term half)GCTCTCCGAAACCACAGATAATATATnnsGCACcAGGGACAAGATACCA
oAS004Amplify N-term half of human TRIM5α (WT or R332P) before codon A331, to hybridize w/randomized A331 C-term half (Rev primer, use w/oJT037)CCCATATATTATCTGTGGTTTCGG
oAS003Randomize human TRIM5α (WT) at codon A331 (Fwd primer, use w/oAS024 for C-term half)CCGAAACCACAGATAATATATGGGNNSCGAGGGACAAGATACCAGA
oJT143Randomize human TRIM5α (R332P) at codon A331 (Fwd primer, use w/oAS024 for C-term half)CCGAAACCACAGATAATATATGGGnnsCcAGGGACAAGATACCAGAC
oAS006Amplify N-term half of human TRIM5α (WT) before codon R332 to hybridizew/randomized R332 C-term half (Rev primer, use w/oJT037)TGCCCCATATATTATCTGTGGTTTC
oAS005Randomize human TRIM5α (WT) at codon R332 (Fwd primer, use w/oAS024 for C-term half)GAAACCACAGATAATATATGGGGCANNSGGGACAAGATACCAGACATTTG
oAS008Amplify N-term half of human TRIM5α (WT) before codon G333 to hybridizew/randomized G333 C-term half (Rev primer, use w/oJT037)TCGTGCCCCATATATTATCTGTG
oAS007Randomize human TRIM5α (WT) at codon G333 (Fwd primer, use w/oAS024 for C-term half)CACAGATAATATATGGGGCACGANNSACAAGATACCAGACATTTGTGAATT
oJT144Amplify N-term half of human TRIM5α (R332P) before codon G333 to hybridize w/randomized G333 C-term half (Rev primer, use w/oJT037)TgGTGCCCCATATATTATCTGTG
oJT145Randomize human TRIM5α (R332P) at codon G333 (Fwd primer, use w/oAS024 for C-term half)CACAGATAATATATGGGGCACcAnnsACAAGATACCAGACATTTGTGAATTTC
oAS010Amplify N-term half of human TRIM5α (WT) before codon T334 to hybridizew/randomized T334 C-term half (Rev primer, use w/oJT037)CCCTCGTGCCCCATATATTA
oAS009Randomize human TRIM5α (WT) at codon T334 (Fwd primer, use w/oAS024 for C-term half)TAATATATGGGGCACGAGGGNNSAGATACCAGACATTTGTGAATTTCA
oJT146Amplify N-term half of human TRIM5α (R332P) before codon T334 to hybridizew/randomized T334 C-term half (Rev primer, use w/oJT037)CCCTgGTGCCCCATATATTATCTG
oJT147Randomize human TRIM5α (R332P) at codon T334 (Fwd primer, use w/oAS024 for C-term half)CAGATAATATATGGGGCACcAGGGnnsAGATACCAGACATTTGTGAATTTCAATTA
oAS012Amplify N-term half of human TRIM5α (WT) before codon R335 to hybridizew/randomized R335 C-term half (Rev primer, use w/oJT037)TGTCCCTCGTGCCCCAT
oAS011Randomize human TRIM5α (WT) at codon R335 (Fwd primer, use w/oAS024 for C-term half)ATggggcacgagggacaNNStaccagacatttgtgAATTTCAATTATTG
oJT148Amplify N-term half of human TRIM5α (R332P) before codon R335 to hybridizew/randomized R335 C-term half (Rev primer, use w/oJT037)TGTCCCTgGTGCCCCATATA
oJT149Randomize human TRIM5α (R332P) at codon R335 (Fwd primer, use w/oAS024 for C-term half)TATATGGGGCACcAGGGACAnnsTACCAGACATTTGTGAATTTCAATTATTG
oAS014Amplify N-term half of human TRIM5α (WT) before codon Y336 to hybridizew/randomized Y336 C-term half (Rev primer, use w/oJT037)TCTTGTCCCTCGTGCCC
oAS013Randomize human TRIM5α (WT) at codon Y336 (Fwd primer, use w/oAS024 for C-term half)GGGCACGAGGGACAAGANNSCAGACATTTGTGAATTTCAATTATTG
oJT150Amplify N-term half of human TRIM5α (R332P) before codon Y336 to hybridize w/randomized Y336 C-term half (Rev primer, use w/oJT037)TCTTGTCCCTgGTGCCCC
oJT151Randomize human TRIM5α (R332P) at codon Y336 (Fwd primer, use w/oAS024 for C-term half)GGGGCACcAGGGACAAGAnnsCAGACATTTGTGAATTTCAATTATTGTAC
oAS016Amplify N-term half of human TRIM5α (WT) before codon Q337 to hybridize w/randomized Q337 C-term half (Rev primer, use w/oJT037)GTATCTTGTCCCTCGTGCC
oAS015Randomize human TRIM5α (WT) at codon Q337 (Fwd primer, use w/oAS024 for C-term half)GCACGAGGGACAAGATACNNSACATTTGTGAATTTCAATTATTGTACTG
oJT152Amplify N-term half of human TRIM5α (R332P) before codon Q337 to hybridize w/randomized Q337 C-term half (Rev primer, use w/oJT037)GTATCTTGTCCCTgGTGCC
oJT153Randomize human TRIM5α (R332P) at codon Q337 (Fwd primer, use w/oAS024 for C-term half)GGCACcAGGGACAAGATACnnsACATTTGTGAATTTCAATTATTGTACTGG
oAS018Amplify N-term half of human TRIM5α (WT) before codon T338 to hybridize w/randomized T338 C-term half (Rev primer, use w/oJT037)CTGGTATCTTGTCCCTCGTG
oAS017Randomize human TRIM5α (WT) at codon T338 (Fwd primer, use w/oAS024 for C-term half)CACGAGGGACAAGATACCAGNNSTTTGTGAATTTCAATTATTGTACTGG
oJT154Amplify N-term half of human TRIM5α (R332P) before codon T338 to hybridize w/randomized T338 C-term half (Rev primer, use w/oJT037)CTGGTATCTTGTCCCTgGTG
oJT155Randomize human TRIM5α (R332P) at codon T338 (Fwd primer, use w/oAS024 for C-term half)CACcAGGGACAAGATACCAGnnsTTTGTGAATTTCAATTATTGTACTGGCAT
oAS020Amplify N-term half of human TRIM5α (WT) before codon F339 to hybridizew/randomized F339 C-term half (Rev primer, use w/oJT037)TGTCTGGTATCTTGTCCCTC
oAS019Randomize human TRIM5α (WT) at codon F339 (Fwd primer, use w/oAS024 for C-term half)GAGGGACAAGATACCAGACANNSGTGAATTTCAATTATTGTACTGGC
oJT156Amplify N-term half of human TRIM5α (R332P) before codon F339 to hybridizew/randomized F339 C-term half (Rev primer, use w/oJT037)TGTCTGGTATCTTGTCCCTgG
oJT157Randomize human TRIM5α (R332P) at codon F339 (Fwd primer, use w/oAS024 for C-term half)CcAGGGACAAGATACCAGACAnnsGTGAATTTCAATTATTGTACTGGCATC
oAS022Amplify N-term half of human TRIM5α (WT) before codon V340 to hybridizew/randomized V340 C-term half (Rev primer, use w/oJT037)AAATGTCTGGTATCTTGTCCCTC
oAS021Randomize human TRIM5α (WT) at codon V340 (Fwd primer, use w/oAS024 for C-term half)AGGGACAAGATACCAGACATTTNNSAATTTCAATTATTGTACTGGCATCC
oJT158Amplify N-term half of human TRIM5α (R332P) before codon V340 to hybridizew/randomized V340 C-term half (Rev primer, use w/oJT037)AAATGTCTGGTATCTTGTCCCTg
oJT159Randomize human TRIM5α (R332P) at codon V340 (Fwd primer, use w/oAS024 for C-term half)cAGGGACAAGATACCAGACATTTnnsAATTTCAATTATTGTACTGGCATCCTG
Illumina library construction
oJT055Illumina library construction, PCR1 Fwd primer (rhesus TRIM5α only), amplifies v1 loop and adds adaptortcgtcggcagcgtcagatgtgtataagagacagTGAGCTCTCGGAACCCACAGATAATGTAT
oJT056Illumina library construction, PCR1 Rev primer (rhesus TRIM5α only), amplifies v1 loop and adds adaptorgtctcgtgggctcggagatgtgtataagagacagGCCCAGGACGCCAGTACAATAATTGAAATT
oJT113Illumina library construction, PCR1 Fwd primer (human TRIM5α libraries) amplifies v1 loop and adds adaptortcgtcggcagcgtcagatgtgtataagagacagCAAGTGAGCTCTCCGAAACCACAGATAATATAT
oJT114Illumina library construction, PCR1 Rev primer (human TRIM5α libraries), amplifies v1 loop and adds adaptorgtctcgtgggctcggagatgtgtataagagacagGAGCCCAGGATGCCAGTACAATAATTGAAATT
oJT057Illumina library construction, PCR2 Fwd primer (all libraries), adds P5 adaptorAATGATACGGCGACCACCGAGATCTACACtagatcgcTCGTCGGCAGCGTC
oJT058Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N701 barcoodeCAAGCAGAAGACGGCATACGAGATtcgccttaGTCTCGTGGGCTCGG
oJT059Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N702 barcoodeCAAGCAGAAGACGGCATACGAGATctagtacgGTCTCGTGGGCTCGG
oJT060Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N703 barcoodeCAAGCAGAAGACGGCATACGAGATttctgcctGTCTCGTGGGCTCGG
oJT115Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N704 barcoodeCAAGCAGAAGACGGCATACGAGATgctcaggaGTCTCGTGGGCTCGG
oJT116Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N705 barcoodeCAAGCAGAAGACGGCATACGAGATaggagtccGTCTCGTGGGCTCGG
oJT117Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N706 barcoodeCAAGCAGAAGACGGCATACGAGATcatgcctaGTCTCGTGGGCTCGG
oJT118Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N707 barcoodeCAAGCAGAAGACGGCATACGAGATgtagagagGTCTCGTGGGCTCGG
oJT119Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N708 barcoodeCAAGCAGAAGACGGCATACGAGATcctctctgGTCTCGTGGGCTCGG
oJT138Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N709 barcoodeCAAGCAGAAGACGGCATACGAGATagcgtagcGTCTCGTGGGCTCGG
oJT139Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N710 barcoodeCAAGCAGAAGACGGCATACGAGATcagcctcgGTCTCGTGGGCTCGG
oJT140Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N711 barcoodeCAAGCAGAAGACGGCATACGAGATtgcctcttGTCTCGTGGGCTCGG
oJT141Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N712 barcoodeCAAGCAGAAGACGGCATACGAGATtcctctacGTCTCGTGGGCTCGG
oJT166Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N714 barcoodeCAAGCAGAAGACGGCATACGAGATTCATGAGCGTCTCGTGGGCTCGG
oJT167Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N715 barcoodeCAAGCAGAAGACGGCATACGAGATCCTGAGATGTCTCGTGGGCTCGG
oJT168Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N716 barcoodeCAAGCAGAAGACGGCATACGAGATTAGCGAGTGTCTCGTGGGCTCGG
oJT169Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N718 barcoodeCAAGCAGAAGACGGCATACGAGATGTAGCTCCGTCTCGTGGGCTCGG
oJT170Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N719 barcoodeCAAGCAGAAGACGGCATACGAGATTACTACGCGTCTCGTGGGCTCGG
oJT171Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N720 barcoodeCAAGCAGAAGACGGCATACGAGATAGGCTCCGGTCTCGTGGGCTCGG
oJT172Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N721 barcoodeAAGCAGAAGACGGCATACGAGATGCAGCGTAGTCTCGTGGGCTCGG
oJT173Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N722 barcoodeCAAGCAGAAGACGGCATACGAGATCTGCGCATGTCTCGTGGGCTCGG
oJT174Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N723 barcoodeCAAGCAGAAGACGGCATACGAGATGAGCGCTAGTCTCGTGGGCTCGG
oJT175Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N724 barcoodeCAAGCAGAAGACGGCATACGAGATCGCTCAGTGTCTCGTGGGCTCGG
oJT176Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N726 barcoodeCAAGCAGAAGACGGCATACGAGATGTCTTAGGGTCTCGTGGGCTCGG
oJT177Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N727 barcoodeCAAGCAGAAGACGGCATACGAGATACTGATCGGTCTCGTGGGCTCGG
oJT178Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N728 barcoodeCAAGCAGAAGACGGCATACGAGATTAGCTGCAGTCTCGTGGGCTCGG
oJT179Illumina library construction, PCR2 Rev primer (all libraries), adds P7 adaptor and N729 barcoodeCAAGCAGAAGACGGCATACGAGATGACGTCGAGTCTCGTGGGCTCGG
RhT5-IlluminaFCustom sequencing primer for rhesus TRIM5α Illumina libraries, sequences rhesus TRIM5α v1 loop (39 nt)TGAGCTCTCGGAACCCACAGATAATGTAT
HsT5-IlluminaFCustom sequencing primer for human TRIM5α Illumina libraries, sequences human TRIM5α v1 loop (33 nt)CAAGTGAGCTCTCCGAAACCACAGATAATATAT
Quikchange PCR for targeted mutagenesis
oCY001Generate G330E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY002)CTCCGAAACCACAGATAATATATGaGGCACGAGGGACAAGATAC
oCY002Generate G330E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY001)GTATCTTGTCCCTCGTGCCtCATATATTATCTGTGGTTTCGGAG
oCY003Generate A331E mutation in human TRIM5α F(wd primer, amplify full plasmid with oCY004)GAAACCACAGATAATATATGGGGaACGAGGGACAAGATACCAG
oCY004Generate A331E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY003)CTGGTATCTTGTCCCTCGTtCCCCATATATTATCTGTGGTTTC
oCY005Generate R332E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY006)ACCACAGATAATATATGGGGCAgaAGGGACAAGATACCAGACATT
oCY006Generate R332E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY005)AATGTCTGGTATCTTGTCCCTtcTGCCCCATATATTATCTGTGGT
oJT040Generate R332P mutation in human TRIM5α (Fwd primer, amplify full plasmid with oJT041)CCACAGATAATATATGGGGCACcAGGGACAAGATACCAGACATTTG
oJT041Generate R332P mutation in human TRIM5α (Rev primer, amplify full plasmid with oJT040)CAAATGTCTGGTATCTTGTCCCTgGTGCCCCATATATTATCTGTGG
oCY007Generate G333Y mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY008)CACAGATAATATATGGGGCACGAtacACAAGATACCAGACATTTGTGAATT
oCY008Generate G333Y mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY007)AATTCACAAATGTCTGGTATCTTGTgtaTCGTGCCCCATATATTATCTGTG
oCY009Generate G333D mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY010)CAGATAATATATGGGGCACGAGatACAAGATACCAGACATTTGTGAATTTC
oCY010Generate G333D mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY009)GAAATTCACAAATGTCTGGTATCTTGTatCTCGTGCCCCATATATTATCTG
oCY011Generate T334D mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY012)GATAATATATGGGGCACGAGGGgacAGATACCAGACATTTGTGAATTTC
oCY012Generate T334D mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY011)GAAATTCACAAATGTCTGGTATCTgtcCCCTCGTGCCCCATATATTATC
oJT246Generate R335A mutation in human TRIM5α (Fwd primer, amplify full plasmid with oJT247)TATGGGGCACGAGGGACAgcATACCAGACATTTGTGAATTTCAATTATTG
oJT247Generate R335A mutation in human TRIM5α (Rev primer, amplify full plasmid with oJT246)CAATAATTGAAATTCACAAATGTCTGGTATgcTGTCCCTCGTGCCCCATA
oCY013Generate R335E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY014)TGGGGCACGAGGGACAgaATACCAGACATTTGTGAATTTCAATTATTG
oCY014Generate R335E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY013)CAATAATTGAAATTCACAAATGTCTGGTATtcTGTCCCTCGTGCCCCA
oCY015Generate Y336E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY016)GGGCACGAGGGACAAGAgAaCAGACATTTGTGAATTTCAATTATTGTAC
oCY016Generate Y336E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY015)GTACAATAATTGAAATTCACAAATGTCTGtTcTCTTGTCCCTCGTGCCC
oCY017Generate Q337D mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY018)GGCACGAGGGACAAGATACgAtACATTTGTGAATTTCAATTATTGTACTG
oCY018Generate Q337D mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY017)CAGTACAATAATTGAAATTCACAAATGTaTcGTATCTTGTCCCTCGTGCC
oAS2019-05Generate Q337N mutation in human TRIM5α (Fwd primer, amplify full plasmid with oAS2019-06)GGCACGAGGGACAAGATACaacACATTTGTGAATTTCAATTATTGTACTGG
oAS2019-06Generate Q337N mutation in human TRIM5α (Rev primer, amplify full plasmid with oAS2019-05)CCAGTACAATAATTGAAATTCACAAATGTgttGTATCTTGTCCCTCGTGCC
oCY019Generate T338E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY020)ACGAGGGACAAGATACCAGgaATTTGTGAATTTCAATTATTGTACTGGC
oCY020Generate T338E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY019)GCCAGTACAATAATTGAAATTCACAAATtcCTGGTATCTTGTCCCTCGT
oCY021Generate F339E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY022)GAGGGACAAGATACCAGACAgaaGTGAATTTCAATTATTGTACTGGCA
oCY022Generate F339E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY021)TGCCAGTACAATAATTGAAATTCACttcTGTCTGGTATCTTGTCCCTC
oCY023Generate V340E mutation in human TRIM5α (Fwd primer, amplify full plasmid with oCY024)GGGACAAGATACCAGACATTTGaGAATTTCAATTATTGTACTGGCATCC
oCY024Generate V340E mutation in human TRIM5α (Rev primer, amplify full plasmid with oCY023)GGATGCCAGTACAATAATTGAAATTCtCAAATGTCTGGTATCTTGTCCC
oAS2019-07Generate V340H mutation in human TRIM5α (Fwd primer, amplify full plasmid with oAS2019-08)GAGGGACAAGATACCAGACATTTcacAATTTCAATTATTGTACTGGCATCCT
oAS2019-08Generate V340H mutation in human TRIM5α (Rev primer, amplify full plasmid with oAS2019-07)AGGATGCCAGTACAATAATTGAAATTgtgAAATGTCTGGTATCTTGTCCCTC
oJT162Generate V340stop mutation in human TRIM5α (Fwd primer, amplify full plasmid with oJT163)GAGGGACAAGATACCAGACATTTtaGAATTTCAATTATTGTACTGGCATCC
oJT163Generate V340stop mutation in human TRIM5α (Rev primer, amplify full plasmid with oJT162)GGATGCCAGTACAATAATTGAAATTCtaAAATGTCTGGTATCTTGTCCCTC
oJT248Generate R335A double mutation in human TRIM5α-R332P (Fwd primer, amplify full plasmid with oJT249)TATGGGGCACcAGGGACAgcATACCAGACATTTGTGAATTTCAATTATTG
oJT249Generate R335A double mutation in human TRIM5α-R332P (Rev primer, amplify full plasmid with oJT248)CAATAATTGAAATTCACAAATGTCTGGTATgcTGTCCCTgGTGCCCCATA
oAS2019-03Generate R335E double mutation in human TRIM5α-R332P (Fwd primer, amplify full plasmid with oAS2019-04)TGGGGCACcAGGGACAgaaTACCAGACATTTGTGAATTTCAATTATTG
oAS2019-04Generate R335E double mutation in human TRIM5α-R332P (Rev primer, amplify full plasmid with oAS2019-03)CAATAATTGAAATTCACAAATGTCTGGTAttcTGTCCCTgGTGCCCCA
oAS2019-01Generate Q337D double mutation in human TRIM5α-R332P (Fwd primer, amplify full plasmid with oAS2019-02)GGCACcAGGGACAAGATACgacACATTTGTGAATTTCAATTATTGTACTGG
oAS2019-02Generate Q337D double mutation in human TRIM5α-R332P (Rev primer, amplify full plasmid with oAS2019-01)CCAGTACAATAATTGAAATTCACAAATGTgtcGTATCTTGTCCCTgGTGCC
oAS2019-09Generate Q337N double mutation in human TRIM5α-R332P (Fwd primer, amplify full plasmid with oAS2019-10)GGCACcAGGGACAAGATACaacACATTTGTGAATTTCAATTATTGTACTGG
oAS2019-10Generate Q337N double mutation in human TRIM5α-R332P (Rev primer, amplify full plasmid with oAS2019-09)CCAGTACAATAATTGAAATTCACAAATGTgttGTATCTTGTCCCTgGTGCC
oJT122Generate Q332E mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT123)CTCGGAACCCACAGATAATGTATgAGGCACCAGGGACATTATTTAC
oJT123Generate Q332E mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT122)GTAAATAATGTCCCTGGTGCCTcATACATTATCTGTGGGTTCCGAG
oJT120Generate A333E mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT121)GAACCCACAGATAATGTATCAGGaACCAGGGACATTATTTACGTTTCC
oJT121Generate A333E mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT120)GGAAACGTAAATAATGTCCCTGGTtCCTGATACATTATCTGTGGGTTC
oCY063Generate A333W mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oCY064)GAACCCACAGATAATGTATCAGtggCCAGGGACATTATTTACGTTTC
oCY064Generate A333W mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oCY063)GAAACGTAAATAATGTCCCTGGCCACTGATACATTATCTGTGGGTTC
oJT124Generate P334M mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT125)CCCACAGATAATGTATCAGGCAatgGGGACATTATTTACGTTTCCGTC
oJT125Generate P334M mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT124)GACGGAAACGTAAATAATGTCCCcatTGCCTGATACATTATCTGTGGG
oJT095Generate G335I mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT096)ACAGATAATGTATCAGGCACCAatcACATTATTTACGTTTCCGTCACTC
oJT096Generate G335I mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT095)GAGTGACGGAAACGTAAATAATGTgatTGGTGCCTGATACATTATCTGT
oJT097Generate T336Q mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT098)GATAATGTATCAGGCACCAGGGcaaTTATTTACGTTTCCGTCACTCAC
oJT098Generate T336Q mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT097)GTGAGTGACGGAAACGTAAATAAttgCCCTGGTGCCTGATACATTATC
oJT099Generate L337N mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT100)GTATCAGGCACCAGGGACAaacTTTACGTTTCCGTCACTCACG
oJT100Generate L337N mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT99)CGTGAGTGACGGAAACGTAAAgttTGTCCCTGGTGCCTGATAC
oJT103Generate F338K mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT104)TCAGGCACCAGGGACATTAaagACGTTTCCGTCACTCACG
oJT104Generate F338K mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT103)CGTGAGTGACGGAAACGTcttTAATGTCCCTGGTGCCTGA
oJT126Generate F338Q mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT127)TCAGGCACCAGGGACATTAcagACGTTTCCGTCACTCACGA
oJT127Generate F338Q mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT126)TCGTGAGTGACGGAAACGTctgTAATGTCCCTGGTGCCTGA
oJT105Generate T339F mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT106)CAGGCACCAGGGACATTATTTttcTTTCCGTCACTCACGAATTTCA
oJT106Generate T339F mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT105)TGAAATTCGTGAGTGACGGAAAgaaAAATAATGTCCCTGGTGCCTG
oJT128Generate T339Q mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT129)CAGGCACCAGGGACATTATTTcaGTTTCCGTCACTCACGAATTTC
oJT129Generate T339Q mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT128)GAAATTCGTGAGTGACGGAAACtgAAATAATGTCCCTGGTGCCTG
oJT130Generate F340D mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT131)GCACCAGGGACATTATTTACGgaTCCGTCACTCACGAATTTCAATTA
oJT131Generate F340D mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT130)TAATTGAAATTCGTGAGTGACGGAtcCGTAAATAATGTCCCTGGTGC
oJT132Generate P341G mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT133)CACCAGGGACATTATTTACGTTTggGTCACTCACGAATTTCAATTATTGT
oJT133Generate P341G mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT132)ACAATAATTGAAATTCGTGAGTGACccAAACGTAAATAATGTCCCTGGTG
oJT107Generate P341I mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT108)CACCAGGGACATTATTTACGTTTataTCACTCACGAATTTCAATTATTGTAC
oJT108Generate P341I mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT107)GTACAATAATTGAAATTCGTGAGTGAtatAAACGTAAATAATGTCCCTGGTG
oJT109Generate P341IK mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT110)CACCAGGGACATTATTTACGTTTaaaTCACTCACGAATTTCAATTATTGTAC
oJT110Generate P341IK mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT109)GTACAATAATTGAAATTCGTGAGTGAtttAAACGTAAATAATGTCCCTGGTG
oJT134Generate S342G mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT135)AGGGACATTATTTACGTTTCCGggACTCACGAATTTCAATTATTGTACTG
oJT135Generate S342G mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT134)CAGTACAATAATTGAAATTCGTGAGTccCGGAAACGTAAATAATGTCCCT
oJT101Generate T344E mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT102)CATTATTTACGTTTCCGTCACTCgagAATTTCAATTATTGTACTGGCGTC
oJT102Generate T344E mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT101)GACGCCAGTACAATAATTGAAATTctcGAGTGACGGAAACGTAAATAATG
oJT111Generate T344stop mutation in rhesus TRIM5α (Fwd primer, amplify full plasmid with oJT112)CATTATTTACGTTTCCGTCACTCtagAATTTCAATTATTGTACTGGCGTC
oJT112Generate T344stop mutation in rhesus TRIM5α (Rev primer, amplify full plasmid with oJT111)GACGCCAGTACAATAATTGAAATTctaGAGTGACGGAAACGTAAATAATG
Sequencing primers
pQCXIP-FSequencing primer from pQCXIP backbone 5' of multiple cloning site (Fwd)acaccgggaccgatccag
HsT5-midFSequencing primer from midpoint of human TRIM5α (Fwd)GATCTGGAGCATCGGCTG
HsT5-midRSequencing primer from midpoint of human TRIM5α (Rev)CAAGGTCACGTTCTCCGTC
RhT5-midFSequencing primer from midpoint of rhesus TRIM5α (Fwd)CTCATCTCAGAACTGGAGCATC
RhT5-midRSequencing primer from midpoint of rhesus TRIM5α (Rev)CTTCAAGGTCATGTTCTCAATCC

Data availability

Sequencing data are available at the following GitHub repository: https://github.com/jtenthor/T5DMS_data_analysis (copy archived at https://github.com/elifesciences-publications/T5DMS_data_analysis).

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)