Conformation of the nuclear pore in living cells is modulated by transport state
- Laboratory of Cellular Biophysics, Rockefeller University, United States
- Department of Physics and Astronomy, Hofstra University, United States
Figures
Figure 1 with 1 supplement
The orientation of Nup-mEGFP fusion proteins can be measured in individual NPCs with pol-TIRFM.
(A) Using pol-TIRFM, the bottom of the nucleus is illuminated and Nup-mEGFP fusion proteins are excited with -polarized or -polarized light. -excitation is parallel and -excitation is …
-
Figure 1—source data 1
Source data for Figure 1.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
The orientation of Nup-mEGFP fusion proteins can be monitored with pol-TIRFM.
Four different Nup-mEGFP (Nup133, Nup93, Nup54, and Nup58) were transiently expressed for 48 hr in HeLa cells. (Columns 1–2) The constructs were alternately excited with -polarized (perpendicular …
-
Figure 1—figure supplement 1—source data 1
Source data for Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig1-figsupp1-data1-v1.xlsx
Figure 2
Varying the length of the linker between the Nup and the mEGFP by single amino acids to test validity of the orientational sensors.
(A) Nup133-mEGFP, with linkers of different lengths at its carboxyl terminus, conjugated to mEGFP. A change in the linker length by a single amino acid changes the p:s ratio. Pairs of different …
-
Figure 2—source data 1
Source data for Figure 1.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig2-data1-v1.xlsx
Figure 3 with 3 supplements
The Inner Ring Nups, Nup54 and Nup58, are reorganized with respect to the NPC after starvation.
Cells were maintained in complete media (CM) or starved for 24 hr in HBSS prior to imaging. The p:s ratios and representative images are presented for: (A) Nup133-mEGFP(−8a), (B) Nup93-mEGFP(–5), (C…
-
Figure 3—source data 1
Source data for Figure 3.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Nuclear transport is attenuated post-starvation.
(A) The NLS domain of the LANS construct normally is masked by the AsLOV2 domain and the protein remains predominantly in the cytosol. Upon stimulation with blue light, the NLS is unmasked and the …
-
Figure 3—figure supplement 1—source data 1
Source data for Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig3-figsupp1-data1-v1.xlsx
Figure 3—figure supplement 2
The Inner Ring Nups, Nup54 and Nup58, are reorganized with respect to the NPC after starvation.
Cells were maintained in complete media (CM) or starved for 24 hr in HBSS prior to imaging. The p:s ratios are presented for: (A) Nup133-mEGFP(−8b), (B) Nup133-mEGFP(−9a), (C) Nup133-mEGFP(−9b), (D) …
-
Figure 3—figure supplement 2—source data 1
Source data for Figure 3—figure supplement 2.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig3-figsupp2-data1-v1.xlsx
Figure 3—figure supplement 3
Cells were maintained in complete media (CM) or starved for 24 hr in HBSS prior to imaging.
The p:s ratios are presented for: (A) Nup54 no FG-mEGFP494(0), (B) Nup54 no FG-mEGFP494(1), (C) Nup54 no FG-mEGFP494(2) (n = 300 NPCs, 10 cells, boxes indicate quartiles, center bars indicate …
-
Figure 3—figure supplement 3—source data 1
Source data for Figure 3—figure supplement 3.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig3-figsupp3-data1-v1.xlsx
Figure 4 with 2 supplements
Conformational changes of the Inner Ring of the NPC revealed by perturbations of cargo state in CRISPR cell lines.
(A-B) No morphological distortions are detected in cell lines endogenously expressing orientational sensors. (C) Nup133-mEGFP cell lines with the mEGFP at the carboxyl-terminus of the protein with …
-
Figure 4—source data 1
Source data for Figure 4C–L.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Source data for Figure 4M–N.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig4-data2-v1.xlsx
Figure 4—figure supplement 1
Validation of CRISPR cell lines.
(A–B) PCR amplification of the Nup54 and Nup133 region reveal one band when the Nup-mEGFP region is homozygous for mEGFP incorporation and two bands when the region is heterozygous. The bands were …
Figure 4—figure supplement 2
The Inner Ring Nup Nup54 is reorganized with respect to the NPC after starvation.
Hap1 cell lines that had been engineered with CRISPR/Cas9 were maintained in complete media (CM) or starved for 24 hr in HBSS prior to imaging. The p:s ratios are presented for: (A) …
-
Figure 4—figure supplement 2—source data 1
Source data for Figure 4—figure supplement 2.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig4-figsupp2-data1-v1.xlsx
Figure 5 with 1 supplement
Karyopherin content at the nuclear periphery induces conformational changes in Nup54-mEGFP494 but not Nup133-mEGFP.
(A) Digitonin permeabilization allows the introduction of transport factors to the nuclear periphery. (B-E) Nup133-mEGFP does not experience a shift in orientation after removal of endogenous kaps …
-
Figure 5—source data 1
Source data for Figure 5.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Introduction of nuclear transport factors to the nuclear periphery using digitonin permeabilization of the plasma membrane.
(A) Cells were incubated with R-phycoerythrin after the digitonin permeabilization protocol was performed with (left) 0 µg/mL digitonin, for which no R-phycoerythrin is detected in the cell, …
-
Figure 5—figure supplement 1—source data 1
Source data for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig5-figsupp1-data1-v1.xlsx
Figure 6
FRET between Nup62 ‘finger’ domains increases after starvation.
Under starvation conditions, FRET increased between Nup62 ‘finger’ domains. (A) Schematic of Nup62 FRET probe labeling scheme. (B) FRET efficiency for HeLa cells were imaged 48 hr post transfection. …
-
Figure 6—source data 1
Source data for Figure 6.
- https://cdn.elifesciences.org/articles/60654/elife-60654-fig6-data1-v1.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | α- karyopherin α1/6 (2D9) (rat monoclonal) | Santa Cruz | sc-101540 RRID:AB_2133549 | IF 1:500 |
| Antibody | α-kap1ß/impß −1 (3E9) (mouse monoclonal) | Abcam | ab2811 RRID:AB_2133989 | IF 1:1000 |
| Antibody | anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (goat polyclonal) | Invitrogen | CAT # A-11008 RRID:AB_2534074 | IF 1:2000 |
| Antibody | anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (goat polyclonal) | Invitrogen | CAT # A-11005 RRID:AB_141372 | IF 1:2000 |
| Antibody | anti-GFP: Living Colors A.v. Monoclonal Antibody (JL-8) | Clontech | CAT # 632381 RRID:AB_2313808 | WB 1:1000 |
| Antibody | anti-Mouse IgG (Fab specific)–Peroxidase antibody (goat polyclonal) | Sigma-Aldrich | CAT # A9917 RRID:AB_258476 | WB 1:50,000 |
| Antibody | Anti-β-Actin antibody, Ac-74 (mouse monoclonal) | Sigma-Aldrich | CAT # A5316 RRID:AB_476743 | WB 1:1000 |
| Strain, strain background (Escherichia coli) | BL21-CodonPlus (DE3)-RIL | Agilent | CAT # 230245 | Chemically competent cells |
| Chemical compound, drug | Dulbecco’s Modified Eagle’s Medium | Gibco | CAT # 11995–065 | |
| Chemical compound, drug | Fetal Bovine Serum | Sigma-Aldrich | CAT #F4135 | |
| Chemical compound, drug | Hanks Balanced Salt Solution with Calcium and Magnesium | Gibco | CAT # 14025076 | |
| Chemical compound, drug | Leptomycin B | Sigma-Aldrich | CAT # L2913 | 25 nM |
| Chemical compound, drug | Fibronectin | Gibco | CAT # 33010018 | |
| Chemical compound, drug | Paraformaldehyde | Electron Microscopy Sciences | CAT #15711 | 4% w/v |
| Chemical compound, drug | PBS, pH 7.4 | Gibco | CAT # 10010023 | |
| Chemical compound, drug | Normal Donkey Serum | Sigma-Aldrich | CAT # 566460 | 2.5% v/v |
| Chemical compound, drug | Normal Goat Serum | Sigma-Aldrich | CAT # NS02L | 2.5% v/v |
| Chemical compound, drug | Bovine Serum Albumin | Sigma-Aldrich | CAT #A2153 | 1% v/v |
| Chemical compound, drug | SlowFade Diamond Antifade Mountant | Invitrogen | CAT # S36972 | |
| Chemical compound, drug | FuGENE 6 Transfection Reagent | Promega | CAT #E2691 | |
| Chemical compound, drug | Opti-MEM I Reduced Serum Medium, no phenol red | Gibco | CAT # 11058021 | |
| Chemical compound, drug | Digitonin, High Purity – Calbiochem | Millipore | CAT # 300410; CAS 11024-24-1 | 34 µg/mL |
| Chemical compound, drug | 360kD polyvinylpyrrolidone (PVP) | Sigma-Aldrich | CAT #PVP360; CAS 9003-39-8 | 1.5% w/v |
| Chemical compound, drug | R-phycoerythrin | ThermoFisher | CAT # P801 | 500 ng/mL |
| Chemical compound, drug | isopropyl β-D-1-thiogalactopyranoside (IPTG) | Sigma-Aldrich | CAT # I5502 | 0.5 mM |
| Chemical compound, drug | Benzonase Nuclease | EMD Millipore | CAT # 70746 | 25 U/mL |
| Chemical compound, drug | rLysozyme Solution | EMD Millipore | CAT # 71110 | 12 U/mL |
| Chemical compound, drug | cOmplete, EDTA-free Protease Inhibitor Cocktail | Roche | CAT # 11873580001 | |
| Chemical compound, drug | Imidazole | Alfa Aesar | CAT #47274; CAS 288-32-4 | |
| Chemical compound, drug | Ni-NTA Agarose | Qiagen | CAT # 30250 | |
| Chemical compound, drug | Guanosine-5'-Triphosphate Disodium Salt | Fisher Scientific | CAT # AAJ16800MC; CAS 56001-37-7 | 0.1 mM |
| Chemical compound, drug | Adenosine 5'-triphosphate disodium salt (ATP disodium salt) hydrate | VWR | CAT # TCA0157; CAS 34369-07-8 | 1 mM |
| Chemical compound, drug | Creatine phosphate | Sigma-Aldrich | CAT # CRPHO-RO; CAS 71519-72-7 | 1 mg/mL |
| Chemical compound, drug | Creatine Phosphokinase, Porcine Heart | Sigma-Aldrich | CAT # 238395; CAS 9001-15-4 | 15 U/mL |
| Chemical compound, drug | NucBlue Live ReadyProbes Reagent (Hoechst 33342) | ThermoFisher | CAT # R37605 | |
| Chemical compound, drug | FuGENE HD Transfection Reagent | Promega | CAT # E2311 | |
| Chemical compound, drug | Puromycin | Invivogen | CAT # ant-pr-5 | |
| Cell line (Homo-sapiens) | HeLa Cells | ATCC | CCL-2 RRID:CVCL_0030 | |
| Cell line (Homo-sapiens) | Hap1 Cells | Horizon | N/A | |
| Cell line (Homo-sapiens) | Nup133_mEGFP(−9) | This Paper | N/A | CRISPR-edited Hap1 cell line expressing Nup133_mEGFP(−9) |
| Cell line (Homo-sapiens) | Nup133_mEGFP(−8) | This Paper | N/A | CRISPR-edited Hap1 cell line expressing Nup133_mEGFP(−8) |
| Cell line (Homo-sapiens) | Nup54-mEGFP494(0) | This Paper | N/A | CRISPR-edited Hap1 cell line expressing Nup54-mEGFP494(0) |
| Cell line (Homo-sapiens) | Nup54-mEGFP494(1) | This Paper | N/A | CRISPR-edited Hap1 cell line expressing Nup54-mEGFP494(1) |
| Cell line (Homo-sapiens) | Nup54-mEGFP494(2) | This Paper | N/A | CRISPR-edited Hap1 cell line expressing Nup54-mEGFP494(2) |
| Cell line (Homo-sapiens) | Nup62_mCherry290_mEGFP321 | This Paper | N/A | CRISPR-edited Hap1 cell line expressing Nup62_mCherry290_mEGFP321 |
| Sequence-based reagent | Cloning Primer Nup54 CRISPR Forward | This Paper | PCR primers | CACCCGATCTAGAAGATATAAAGC (guide bolded) |
| Sequence-based reagent | Cloning Primer Nup54 CRISPR Reverse | This Paper | PCR primers | AAACGCTTTATATCTTCTAGATCG |
| Sequence-based reagent | Cloning Primer Nup133 CRISPR Forward | This Paper | PCR primers | CACCGCTCAGTGAGTACTTACCGG (guide bolded) |
| Sequence-based reagent | Cloning Primer Nup133 CRISPR Reverse | This Paper | PCR primers | AAACCCGGTAAGTACTCACTGAGC |
| Sequence-based reagent | PCR Primer Nup54 Forward | This Paper | PCR primers | CCTGTGACTAGCTTGCAGTT |
| Sequence-based reagent | PCR Primer Nup54 Reverse | This Paper | PCR primers | ACCTCTGATGTGGATGGTTTC |
| Sequence-based reagent | PCR Primer Nup133 Forward | This Paper | PCR primers | AGTCCAATCCTTACTTCGAGTTT |
| Sequence-based reagent | PCR Primer Nup133 Reverse | This Paper | PCR primers | AGGAACAACAACTGACACATTTC |
| Recombinant DNA reagent | Nup133_mEGFP(−8a) (plasmid) | Kampmann et al., 2011 | Addgene # 163417 | Mammalian expression of Nup133 fused at carboxy-terminus to mEGFP with total net fusion of (−8 amino acids) |
| Recombinant DNA reagent | Nup133_mEGFP(−8b) (plasmid) | Kampmann et al., 2011 | Addgene #163418 | Mammalian expression of Nup133 fused at carboxy-terminus to mEGFP with total net fusion of (−8 amino acids) |
| Recombinant DNA reagent | Nup133_mEGFP(−9a) (plasmid) | Kampmann et al., 2011 | Addgene # 163419 | Mammalian expression of Nup133 fused at carboxy-terminus to mEGFP with total net fusion of (−9 amino acids) |
| Recombinant DNA reagent | Nup133_mEGFP(−9b) (plasmid) | Kampmann et al., 2011 | Addgene # 163420 | Mammalian expression of Nup133 fused at carboxy-terminus to mEGFP with total net fusion of (−9 amino acids) |
| Recombinant DNA reagent | Nup93_mEGFP(−5) (plasmid) | This paper | Addgene # 163421 | Mammalian expression of Nup93 fused at carboxy-terminus to mEGFP with total net fusion of (−5 amino acids) |
| Recombinant DNA reagent | Nup93_mEGFP(−6) (plasmid) | This paper | Addgene # 163422 | Mammalian expression of Nup93 fused at carboxy-terminus to mEGFP with total net fusion of (−6 amino acids) |
| Recombinant DNA reagent | Nup58_mEGFP(−6) (plasmid) | This paper | Addgene # 163423 | Mammalian expression of Nup58 with mEGFP (missing first six amino acids) at position 412 |
| Recombinant DNA reagent | Nup58_mEGFP(−7) (plasmid) | This paper | Addgene # 163424 | Mammalian expression of Nup58 with mEGFP (missing first seven amino acids) at position 412 |
| Recombinant DNA reagent | Nup58_mEGFP(−8) (plasmid) | This paper | Addgene # 163425 | Mammalian expression of Nup58 with mEGFP (missing first eight amino acids) at position 412 |
| Recombinant DNA reagent | Nup54-mEGFP494(0) (plasmid) | This paper | Addgene # 163426 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 with five amino acid rigid alpha helical linker |
| Recombinant DNA reagent | Nup54-mEGFP494(1) (plasmid) | This paper | Addgene # 163427 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 with six amino acid rigid alpha-helical linker |
| Recombinant DNA reagent | Nup54-mEGFP494(2) (plasmid) | This paper | Addgene # 163428 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 with seven amino acid rigid alpha helical linker |
| Recombinant DNA reagent | Nup54-mEGFP494(flex0)(plasmid) | This paper | Addgene # 163429 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 with five amino acid flexible alpha-helical linker |
| Recombinant DNA reagent | Nup54-mEGFP494(flex1)(plasmid) | This paper | Addgene # 163430 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 with six amino acid flexible alpha-helical linker |
| Recombinant DNA reagent | Nup54-mEGFP494(flex2)(plasmid) | This paper | Addgene # 163431 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 with seven amino acid flexible alpha helical linker |
| Recombinant DNA reagent | Nup54_mEGFP494(−4) (plasmid) | This paper | Addgene # 163432 | Mammalian expression of Nup54 with mEGFP (missing first four amino acids) at amino acid 494 |
| Recombinant DNA reagent | Nup54_mEGFP494(−5) (plasmid) | This paper | Addgene # 163433 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at amino acid 494 |
| Recombinant DNA reagent | Nup54_mEGFP494(−6) (plasmid) | This paper | Addgene # 163434 | Mammalian expression of Nup54 with mEGFP (missing first six amino acids) at amino acid 494 |
| Recombinant DNA reagent | Nup54_mEGFP510(−4) (plasmid) | This paper | Addgene # 163435 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at the carboxy-terminus with total net fusion of (−4) amino acids |
| Recombinant DNA reagent | Nup54_mEGFP510(−5) (plasmid) | This paper | Addgene # 163436 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at the carboxy-terminus with total net fusion of (−5) amino acids |
| Recombinant DNA reagent | Nup54_mEGFP510(−6) (plasmid) | This paper | Addgene # 163437 | Mammalian expression of Nup54 with mEGFP (missing first five amino acids) at the carboxy-terminus with total net fusion of (−6) amino acids |
| Recombinant DNA reagent | pSpCas9(BB)−2A-Puro (PX459) V2.0 (plasmid) | Ran et al., 2013 | Addgene # 62988 | |
| Recombinant DNA reagent | pTriEx-mCherry::LANS4 (plasmid) | Yumerefendi et al., 2015 | Addgene #60785 | |
| Recombinant DNA reagent | BFP-RanQ69L (plasmid) | This paper | Addgene # 163438 | Mammalian expression of RanQ69L with tag-BFP |
| Recombinant DNA reagent | pET28-RAN (plasmid) | Günter Blobel | Addgene # 163439 | Ran in pET28 protein expression backbone |
| Recombinant DNA reagent | pET28_KPNA1 (plasmid) | This paper | Addgene #163440 | KPNA1 in pET28 protein expression backbone |
| Recombinant DNA reagent | pET28-KPNB1 (plasmid) | This paper | Addgene # 163441 | KPNB1 in pET28 protein expression backbone |
| Recombinant DNA reagent | pET28-NTF2 (plasmid) | This paper | Addgene # 163442 | NTF2 in pET28 protein expression backbone |
| Recombinant DNA reagent | Nup54 no FG-mEGFP494(0) | This paper | Addgene # 164269 | Mammalian expression of Nup54 without the FG-Nup domain, with mEGFP (missing the first 5 amino acids) at amino acid position 494 with a rigid alpha helix of 5 amino acids at the carboxyl end of mEGFP |
| Recombinant DNA reagent | Nup54 no FG-mEGFP494(1) | This paper | Addgene # 164270 | Mammalian expression of Nup54 without the FG-Nup domain, with mEGFP (missing the first 5 amino acids) at amino acid position 494 with a rigid alpha helix of 6 amino acids at the carboxyl end of mEGFP |
| Recombinant DNA reagent | Nup54 no FG-mEGFP494(2) | This paper | Addgene # 164271 | Mammalian expression of Nup54 without the FG-Nup domain, with mEGFP (missing the first 5 amino acids) at amino acid position 494 with a rigid alpha helix of 7 amino acids at the carboxyl end of mEGFP |
| Recombinant DNA reagent | NLS-tdTomato | This paper | Addgene # 163443 | Bacterial expression of His-tagged, SV40 NLS-tagged tdTomato in the modified pRSETB protein expression backbone |
| Software, algorithm | Metamorph Ver 7.7.8 | Molecular Devices | https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy#gref | |
| Software, algorithm | MatLab 2019A | Mathworks | https://www.mathworks.com/ | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | https://imagej.net/Fiji/Downloads | |
| Software, algorithm | CRISPR Guide RNA Design | Benchling | https://www.benchling.com/crispr/ | |
| Software, algorithm | Adobe Illustrator | Adobe | https://www.adobe.com/products/illustrator.html |
Additional files
-
Source code 1
Analysis code for quantification of orientation.
- https://cdn.elifesciences.org/articles/60654/elife-60654-code1-v1.zip
-
Supplementary file 1
Table of Nup-mEGFP transfected fusion protein linkage identities.
The size of mEGFP deletion describes the number of amino acids deleted from the amino terminus of mEGFP and the net linker size describes the number of amino acids in the linker minus the deletions from the Nup and mEGFP.
- https://cdn.elifesciences.org/articles/60654/elife-60654-supp1-v1.docx
-
Supplementary file 2
Table of Nup-mEGFP cell line linkage identities.
The size of mEGFP deletion describes the number of amino acids deleted from the amino terminus of mEGFP and the net linker size describes the number of amino acids in the linker minus the deletions from the Nup and mEGFP.
- https://cdn.elifesciences.org/articles/60654/elife-60654-supp2-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/60654/elife-60654-transrepform-v1.pdf
