1. Biochemistry and Chemical Biology
  2. Medicine
Download icon

The half-life of the bone-derived hormone osteocalcin is regulated through O-glycosylation in mice, but not in humans

  1. Omar Al Rifai
  2. Catherine Julien
  3. Julie Lacombe
  4. Denis Faubert
  5. Erandi Lira-Navarrete
  6. Yoshiki Narimatsu
  7. Henrik Clausen
  8. Mathieu Ferron  Is a corresponding author
  1. Molecular Physiology Research unit, Institut de Recherches Cliniques de Montréal, Canada
  2. Programme de biologie moléculaire, Université de Montréal, Canada
  3. Proteomics Discovery Platform, Institut de Recherches Cliniques de Montréal, Canada
  4. University of Copenhagen, Faculty of Health Sciences, Copenhagen Center for Glycomics, Departments of Cellular and Molecular Medicine, Denmark
  5. Département de Médecine, Université de Montréal, Canada
  6. Division of Experimental Medicine, McGill University, Canada
Research Article
Cite this article as: eLife 2020;9:e61174 doi: 10.7554/eLife.61174
5 figures, 5 tables and 2 additional files

Figures

OCN is O-glycosylated in vitro and in vivo on serine 8.

(A) Western blot analysis on the secretion medium (SM) of HEK293 (WT) and HEK293 lacking COSMC (C1GALT1C1-/-) transfected with mouse OCN-V5. (B) Western blot analysis on the SM of CHO and CHO-ldlD cells transfected with mouse OCN-V5. CHO-ldlD cells were treated or not with 0.1 mM Galactose (Gal) and/or 1 mM N-acetylgalactosamine (GalNAc). (C) Effect of N-acetylgalactosaminyltransferase (GalNAc-Ts) inhibition on mouse OCN O-glycosylation in osteoblasts. Western blot analysis on the SM and cell extract (CE) of primary osteoblasts transfected with mouse OCN-V5 and treated or not with 2 mM of GalNAc-bn. (D) OCN deglycosylation assay. Bone extracts of C57BL/6J mice were treated or not with O-glycosidase and neuraminidase for 4 hr at 37°C and analyzed by western blot using anti-C-termimal OCN antibody (Cterm OCN). β-actin was used as a loading control. Rec OCN: Non-glycosylated OCN produced in bacteria. (E) Structure of mouse pre-pro-OCN and amino acid sequence of mature mouse OCN. The serine (S) and threonine (S) residues are in red. (F) Western blot analysis on the SM and cell extract (CE) of primary osteoblasts transfected with OCN-V5 containing or not the indicated mutations. In the 6XST→6XA mutant, all six serine and threonine residues from OCN were mutated to alanine. (G) Western blot analysis on the SM and cell extract (CE) of primary osteoblasts transfected with OCN-V5 containing or not the indicated mutations. (H) Annotated HCD MS/MS spectrum of a modified form of OCN (HexNAc-Hex-NANA + 3 Gla + S-S) pulled down from the bone homogenate of C57BL/6J mice. The precursor m/z value is 1180.95003 (M+5H)+5 and mass accuracy with the annotated OCN modified form is 4.6 ppm. In C, F and G, GFP co-expressed from OCN-V5 expression vector, was used as a loading control.

Figure 2 with 1 supplement
OCN O-glycosylation by N-acetylgalactosaminyltransferase (GalNAc-Ts) is independent of its processing and γ-carboxylation.

(A) Galnts expression in pre-osteoblasts (undifferentiated) and osteoblasts (differentiated) by quantitative PCR (n = 3 per condition). Results are represented as copy number of Galnts normalized to Actb. (B) Western blot analysis of OCN in the secretion media (SM) of HEK293 cells deficient for specific GalNAc-Ts. OCN-V5 was transfected in parental, C1GALT1C1-/- (Δ C1GALT1C1), or GALNTs deficient (Δ) HEK293 cells and analysed by western blot using anti-V5 antibody. (C) Western blot analysis on the SM of osteoblasts transfected with mouse OCN-V5 and treated or not with 2 mM of GalNAc-bn, 50 μM warfarin or 50 μM Dec-RVKR-CMK (RVKR) (upper panel), and percentage of carboxylated OCN (Gla-OCN) over total OCN measured by ELISA (lower panel; n = 2 per condition). (D) Western blot analysis on the SM of osteoblasts transfected with mouse OCN-V5 containing or not the S8A mutation and treated with 50 μM Dec-RVKR-CMK (RVKR) (upper panel), and percentage of carboxylated OCN (Gla-OCN) over total OCN measured by ELISA (lower panel; n = 3 per condition). (E) Western blot analysis on the SM of osteoblasts transfected with mouse OCN-V5 containing or not the S8A mutation and treated with 50 μM warfarin (upper panel), and percentage of carboxylated OCN over total OCN measured by ELISA (lower panel; n = 3 per condition). (F) Western blot analysis of OCN deglycosylation assay on bone extracts from Furinfl/fl and Furinfl/fl;BGLAP-Cre mice (n = 2 independent mice per genotype). Bone extracts were treated or not with O-glycosidase and neuraminidase for 4 hr at 37°C and analyzed by western blot using anti-C-termimal OCN antibody (Cterm OCN). **p<0.01; ***p<0.001 using one-way ANOVA with Bonferroni multiple comparisons test.

Figure 2—source data 1

Numerical data from the graph in Figure 2A.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data1-v2.xlsx
Figure 2—source data 2

Original western blot image from Figure 2B.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data2-v2.xlsx
Figure 2—source data 3

Original western blot image from Figure 2C.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data3-v2.xlsx
Figure 2—source data 4

Numerical data from the graph in Figure 2C.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data4-v2.xlsx
Figure 2—source data 5

Original western blot image from Figure 2D.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data5-v2.xlsx
Figure 2—source data 6

Numerical data from the graph in Figure 2D.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data6-v2.xlsx
Figure 2—source data 7

Original western blot image from Figure 2E.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data7-v2.xlsx
Figure 2—source data 8

Numerical data from the graph in Figure 2E.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data8-v2.xlsx
Figure 2—source data 9

Original western blot image from Figure 2F.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data9-v2.xlsx
Figure 2—figure supplement 1
Mouse OCN O-glycosylation occurs independently of its carboxylation and processing in HEK293 cells.

Western blot analysis on the secretion media (SM) of HEK293 cells transfected with mouse OCN-V5 and treated or not with 2 mM of GalNAc-bn, 50 μM warfarin or 50 μM Dec-RVKR-CMK (RVKR).

Figure 3 with 4 supplements
Mouse OCN O-glycosylation increases its half-life ex vivo and in vivo.

(A) Annotated and deconvoluted MS spectrum of purified glycosylated mouse OCN (O-gly ucOCN). (B) Annotated and deconvoluted MS spectrum of purified non-glycosylated mouse OCN (ucOCN). (C–D) Ex vivo half-life of O-gly ucOCN and ucOCN in OCN deficient (Bglap-/-) plasma. (C) 100 ng/ml of O-gly ucOCN or ucOCN were incubated in plasma at 37°C for 0 to 5 hr and OCN levels were measured at the indicated times (n = 4 independent plasma per condition). (D) 100 ng/ml of O-gly ucOCN or ucOCN were incubated in plasma for 2 hr at 37°C in different conditions or at 4°C. HI: heat-inactivated plasma (n = 3 independent plasma per condition). (E) 50 ng/ml of ucOCN was incubated in plasma from Bglap-/- mice for 4 hr at 37°C in the presence of vehicle (V) or 10 mM talabostat (T) (n = 3 per condition). (F) 50 ng/ml of ucOCN was incubated in plasma from Bglap-/- mice for 4 hr at 37°C in the presence of vehicle (V) or 10 mM phenylmethylsulfonyl fluoride (PMSF) (n = 3 per condition). (G) Effect of plasmin on OCN stability ex vivo. 50 ng/ml of O-gly ucOCN and ucOCN were incubated for two hours in Bglap-/- heat-inactivated plasma containing different concentration of plasmin (n = 2 per condition). Inset graph shows the stability of the O-gly ucOCN and ucOCN incubated for two hours with 0.3 U/ml of plasmin (n = 5). (H) OCN deficient male mice (Bglap-/-) were fasted for 16 hr, O-gly ucOCN (n = 5 mice) or ucOCN (n = 5 mice) were injected intraperitoneally at a dose of 40 ng/g of body weight and serum OCN levels were measured at the indicated time points. (I) Using the data in (H) the percentage (%) of OCN in the declining phase was calculated relative to the maxima of each OCN forms at 30 min. T0: start point, see Materials and methods; HexNAc: N-acetylhexosamine; Hex: Hexose; NANA: N-acetylneuraminic acid. OCN measurements were performed using total mouse OCN ELISA assay (see Materials and methods). Results are given as mean ± SEM. *p<0.05; **p<0.01; ***p<0.001 using two-way ANOVA for repeated measurements with Bonferroni multiple comparisons test.

Figure 3—source data 1

Raw proteomic data from Figure 3A.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data1-v2.xlsx
Figure 3—source data 2

Raw proteomic data from Figure 3B.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data2-v2.xlsx
Figure 3—source data 3

Numerical data from the graph in Figure 3C.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data3-v2.xlsx
Figure 3—source data 4

Numerical data from the graph in Figure 3D.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data4-v2.xlsx
Figure 3—source data 5

Numerical data from the graph in Figure 3E.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data5-v2.xlsx
Figure 3—source data 6

Numerical data from the graph in Figure 3F.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data6-v2.xlsx
Figure 3—source data 7

Numerical data from the graph in Figure 3G.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data7-v2.xlsx
Figure 3—source data 8

Numerical data from the graph in Figure 3H.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data8-v2.xlsx
Figure 3—source data 9

Numerical data from the graph in Figure 3I.

https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data9-v2.xlsx
Figure 3—figure supplement 1
Purification of recombinant O-glycosylated mouse ucOCN.

(A) Map of the pcDNA3.1-Fc-hinge-Thr-OCN construct used to produce and purify mouse ucOCN fusion protein. (B) Coomassie staining of purified O-glycosylated mouse ucOCN (O-gly ucOCN) compared to non- glycosylated mouse ucOCN (ucOCN) produced in bacteria.

Figure 3—figure supplement 2
Mouse OCN ELISA recognize O-glycosylated mouse ucOCN (O-gly ucOCN) and non-glycosylated mouse ucOCN (ucOCN).

Standard curve of O-gly ucOCN (n = 3–5) and ucOCN (n = 3–5) ranging from 0 to 100 ng/ml.

Figure 3—figure supplement 3
Effect of different protease inhibitors on non-glycosylated mouse ucOCN plasma half-life.

(A–B) Ex vivo half-life of O-gly ucOCN and ucOCN in OCN-deficient plasma (Bglap-/-; n = 3 plasma for each condition). (A) 100 ng/ml O-gly ucOCN (n = 3) and ucOCN (n = 3) were incubated for 2 hr in plasma at 37°C or 4°C and treated with vehicle (V) or with protease inhibitors or incubated in 3.5% BSA (bovine serum albumin prepared in saline solution). (B) 100 ng/ml O-gly ucOCN and ucOCN was incubated for 2 hr in normal plasma at 37°C or 4°C and treated with vehicle (V) or with EDTA (10 mM). T0: start point, see Materials and methods; Pep A: 10 μM Pepstatin A; RVKR: 50 μM Dec-RVKR-CMK.

Figure 3—figure supplement 4
Mouse OCN O-glycosylation increases its stability in vivo in fed conditions.

(A) In vivo stability of O-gly ucOCN and ucOCN in fed condition in mice. O-gly ucOCN or ucOCN were injected intraperitoneally in OCN deficient male mice (Bglap-/-; n = 9 mice each) at a dose of 40 ng/g of body weight and serum OCN levels were measured at the indicated time points. (B) O-gly ucOCN (n = 4 mice) or ucOCN (n = 4 mice) were injected intraperitoneally in OCN deficient male mice (Bglap-/-), in fed condition, at a dose of 40 or 80 ng/g of body weight. Serum OCN level was measured two hours post-injection.

Effect of O-glycosylation on mouse OCN bioactivity and stability in culture.

(A) Insulin gene expression (Ins1) in INS-1 832/3 cells following an 8 hr treatment with vehicle (n = 6), non-glycosylated mouse OCN (ucOCN) (n = 10) or glycosylated mouse ucOCN (O-gly ucOCN) (n = 8–10) at the indicated concentrations. (B) Concentration of OCN in the media incubated for 8 hr at 4°C without cells or for 8 hr in culture with INS-1 832/3 cells at 37°C (n = 3 for each condition). Results are shown as mean ± SEM. *p<0.05; ***p<0.001 using Student t-test or ordinary two-way ANOVA with Bonferroni multiple comparisons test.

Figure 5 with 3 supplements
Human OCN O-glycosylation increases its half-life ex vivo.

(A) Amino acid alignment of mouse and human OCN. The six serine and threonine residues present in the mouse protein and their corresponding amino acids in human OCN are highlighted in gray. The site of O-glycosylation in mouse OCN (S8) is indicated by an arrow. (B) Western Blot analysis on the secretion media (SM) of primary osteoblasts transfected with human OCN-V5 (hOCN) and mouse OCN-V5 (OCN). (C) Western blot analysis on the SM of primary osteoblasts transfected with hOCN-V5 containing or not the indicated mutations. (D) Western Blot analysis on the SM of primary osteoblasts transfected with hOCN-V5 containing or not the Y12S mutations and treated or not with 50 μM Dec-RVKR-CMK (RVKR). (E) Annotated and deconvoluted MS spectrum of purified O-glycosylated uncarboxylated human OCN (O-gly uc-hOCN). (F) Annotated and deconvoluted MS spectrum of and purified non-glycosylated uncarboxylated human OCN (uc-hOCN). (G–H) Ex vivo half-life of O-gly uc-hOCN and uc-hOCN in mouse plasma. (G) 60 ng/ml of O-gly uc-hOCN and uc-hOCN were incubated at 37°C in plasma of OCN deficient mice (Bglap-/-) (n = 4) for 0 to 5 hr and hOCN levels were measured at the indicated time. (H) O-gly uc-hOCN and uc-hOCN were incubated in Bglap-/- plasma for 2 hr at 37°C in different conditions or at 4°C (n = 4 independent plasma per condition). T0: start point, see Materials and methods; HI: heat-inactivated plasma; HexNAc: N-acetylhexosamine; Hex: Hexose; NANA: N-acetylneuraminic acid. Uc-hOCN levels were measured at the indicated time points using an uc-hOCN ELISA assay. Results are given as mean ± SEM. **p<0.01; ***p<0.001 using two-way ANOVA for repeated measurements with Bonferroni multiple comparisons test.

Figure 5—figure supplement 1
Purification of recombinant O-glycosylated human ucOCN.

(A) Map of pcDNA3.1-Fc-hinge-Thr-hOCN (Y12S) construct used to produce and purify O-glycosylated human ucOCN fusion protein. (B) Coomassie staining of purified O-glycosylated human ucOCN (O-gly uchOCN) compared to non-glycosylated human ucOCN (uc-hOCN) produced in bacteria.

Figure 5—figure supplement 2
Human ucOCN ELISA equally recognize O-glycosylated human ucOCN (O-gly uc-hOCN) and non-glycosylated human ucOCN (uc-hOCN).

Standard curve of O-gly uc-hOCN (n = 2) and uc-hOCN (n = 2) ranging from 0 to 100 ng/ml.

Figure 5—figure supplement 3
Effect of different protease inhibitors on non-glycosylated human ucOCN plasma half-life.

Ex vivo half-life of O-gly uc-hOCN and uc-hOCN in OCN deficient plasma (Bglap-/-; n = 3–4 plasma). 650 ng/ml O-gly uc-hOCN (n = 3) and uc-hOCN (n = 3) were incubated for 2 hr in normal plasma at 37°C or 4°C and treated with vehicle (V) or with protease inhibitors. T0: start point, see Materials and methods; Pep A: 10 μM Pepstatin A; RVKR: 50 μM Dec-RVKR-CMK.

Tables

Table 1
OCN serum levels in mouse and human at different ages.
OCN serum levels (ng/ml)
Age (mice/human)Mouse
[mean ± SD (n)]
Human*
[mean ± SD (n)]
2 weeks/ 1 year old1369.7 ± 146.7 (8)62.9 ± 8.1 (43)
4 weeks/ 11–13 years old617.2 ± 192.5 (5)74.1 ± 8.9 (41)
13 weeks/ 25–29 years old252.2 ± 8.0 (4)21.0 ± 6.3 (49)
60 weeks/ 50–54 years old50.0 ± 7.2 (4)13.5 ± 6.3 (127)
Table 2
The monoisotopic mass and relative abundance of the different OCN forms detected in the supernatant of differentiated osteoblasts.
Monoisotopic mass range (Da)Relative abundance (%)Most probable modificationMost probable oligosaccharide
O-glycosylated OCN83.88
5767.69614.80GlycosylationHexNAc, Hex, NANA
5783.68010.25Glycosylation + oxidationHexNAc, Hex, NANA
5855.66764.60Glycosylation + 2x GlaHexNAc, Hex, NANA
5899.71613.16Glycosylation + 3x GlaHexNAc, Hex, NANA
5915.6386–5968.57965.51Glycosylation + 3x Gla + oxidation + additional unidentified modifications or adduct ionsHexNAc, Hex, NANA
6058.791624.48GlycosylationHexNAc, Hex, 2x NANA
6074.7766–6096.74092.48Glycosylation + oxidationHexNAc, Hex, 2x NANA
6102.76817.89Glycosylation + 1x GlaHexNAc, Hex, 2x NANA
6146.760923.97Glycosylation + 2x GlaHexNAc, Hex, 2x NANA
6190.8061–6214.72786.72Glycosylation + 3x Gla + additional unidentified modifications or adduct ionsHexNAc, Hex, 2x NANA
Non O-glycosylated OCN16.12
5127.46763.00OxidationNA
5171.43011.851x Gla + oxidationNA
5199.44462.082x GlaNA
5215.42968.502x Gla + oxidationNA
5259.42040.663x Gla + oxidationNA
  1. Gla: Gamma-carboxyglutamic acid residue; HexNAc: N-acetylhexosamine; Hex: Hexose; NANA: N-acetylneuraminic acid; 1x: one time; 2x: two times; 3x: three times; NA: not applicable.

Table 3
The monoisotopic mass and relative abundance of the different OCN forms detected in mouse bone homogenates.
Monoisotopic mass rangeRelative abundance (%)Most probable modificationMost probable oligosaccharide
O-glycosylated OCN99.07
5855.66760.54Glycosylation + 2x GlaHexNAc, Hex, NANA
5899.71617.43Glycosylation + 3x GlaHexNAc, Hex, NANA
5915.6386–6135.679636.07Glycosylation + 3x Gla + oxidation + additional unidentified modifications or adduct ionsHexNAc, Hex, NANA
6146.7609–6162.79915.42Glycosylation + 2x Gla + additional unidentified modificationsHexNAc, Hex, 2xNANA
6190.80614.49Glycosylation + 3x GlaHexNAc, Hex, 2xNANA
6206.8016–6441.763645.12Glycosylation + 3x Gla + oxidation + additional unidentified modifications or adduct ionsHexNAc, Hex, 2xNANA
Non O-glycosylated OCN0.93
5259.42040.933x Gla + oxidationNA
  1. Gla: Gamma-carboxyglutamic acid residue; HexNAc: N-acetylhexosamine; Hex: Hexose; NANA: N-acetylneuraminic acid; 1x: one time; 2x: two times; 3x: three times; NA: not applicable.

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Gene (M. musculus)BglapGenBankGene ID: 12096Mouse osteocalcin gene 1
Gene (M. musculus)Bglap2GenBankGene ID: 12097Mouse osteocalcin gene 2
Gene (Homo sapiens)BGLAPGenBankGene ID: 632Human osteocalcin gene
Genetic reagent (M. musculus)Bglap-/-PMID:8684484Bglap/Bglap2tm1Kry
RRID:MGI:3837364
Genetic background: C57BL/6J
Genetic reagent (M. musculus)Furinfl/flPMID:15471862Furintm1Jwmc
RRID:MGI:3700793
Genetic background: C57BL/6J
Genetic reagent (M. musculus)BGLAP-CrePMID:12215457Tg(BGLAP-cre)1Clem
RRID:IMSR_JAX:019509
Genetic background: C57BL/6J
Genetic reagent (M. musculus)C57BL/6J wildtype miceThe Jackson LaboratoryStock No: 000664
RRID:IMSR_JAX:000664
For primary osteoblasts preparation
Cell line (R. norvegicus)INS-1 832/3Millipore-SigmaSCC208
RRID:CVCL_ZL55
Cell line (C. griseus)Chinese hamster ovary (CHO-K1) cellsATCCCCL-61
RRID:CVCL_0214
Cell line (C. griseus)Chinese hamster ovary ldlD cells (CHO-ldlD)PMID:3948246RRID:CVCL_1V03Cell maintained in N. Seidah lab.
Cell line (M. musculus)Primary osteoblastsThis paperPrepared from C57BL/6J wildtype mice newborn calvaria
Cell line (H. sapiens)Human embryonic kidney cells HEK293ATCCCRL-1573
RRID:CVCL_0045
Cell line (H. sapiens)COSMC knockout HEK293 cells
(C1GALT1C1-/-)
PMID:23584533RRID:CVCL_S025Cell maintained in H. Clausen lab.
Cell line (H. sapiens)GALNT3/6 knockout HEK293 cellsPMID:31040225Cell maintained in H. Clausen lab.
Cell line (H. sapiens)GALNT3 knockout HEK293 cellsPMID:31040225Cell maintained in H. Clausen lab.
Cell line (H. sapiens)GALNT6 knockout HEK293 cellsPMID:31040225Cell maintained in H. Clausen lab.
Cell line (H. sapiens)GALNT1/2/3 knockout HEK293 cellsPMID:31040225Cell maintained in H. Clausen lab.
Transfected construct (M. musculus)pIRES2-EGFP-mOCN-V5This paperTo express mouse OCN V5 tagged in primary osteoblasts, CHO-K1, CHO-ldlD and HEK293
Transfected construct (M. musculus)pIRES2- EGFP-mOCN (S5A/S8/AT15A) -V5This paperTo express (S5A/S8/AT15A) mutant mouse OCN V5 tagged in primary osteoblasts
Transfected construct (M. musculus)pIRES2- EGFP-mOCN (S29A/T36A/T45A) -V5This paperTo express (S29A/T36A/T45A) mutant mouse OCN V5 tagged in primary osteoblasts
Transfected construct (M. musculus)pIRES2- EGFP-mOCN (6XST→6XA)-V5This paperTo express (6XST→6XA) mutant mouse OCN V5 tagged in primary osteoblasts
Transfected construct (M. musculus)pIRES2- EGFP-mOCN (S5A)-V5This paperTo express (S5A) mutant mouse OCN V5 tagged in primary osteoblasts
Transfected construct (M. musculus)pIRES2- EGFP-mOCN (S8A)-V5This paperTo express (S8A) mutant mouse OCN V5 tagged in primary osteoblasts
Transfected construct (M. musculus)pIRES2- EGFP-mOCN (T15A)-V5This paperTo express (T15A) mutant mouse OCN V5 tagged in primary osteoblasts
Transfected construct (H. sapiens)pIRES2-EGFP-hOCN-V5This paperTo express human OCN V5 tagged in primary osteoblasts
Transfected construct (H. sapiens)pIRES2-EGFP-hOCN (Y12S)-V5This paperTo express (Y12S) mutant human OCN V5 tagged in primary osteoblasts
Transfected construct (H. sapiens)pIRES2-EGFP-hOCN (Y12L)-V5This paperTo express (Y12L) human OCN V5 tagged in primary osteoblasts
Transfected construct (H. sapiens)pcDNA3.1-Fc-hinge-Thr-mOCNThis paperUsed to produce O-gly ucOCN in HEK293
Transfected construct (H. sapiens)pcDNA3.1-Fc-hinge-Thr-hOCN (Y12S)This paperUsed to produce O-gly uc-hOCN in HEK293
AntibodyAnti-GFP, mouse monoclonal, clones 7.1 and 13.1Sigma-Aldrich11814460001
RRID:AB_390913
WB (1:1000)
AntibodyAnti-V5, mouse monoclonal, clone V5-10Sigma-AldrichV8012
RRID:AB_261888
WB (1:3000)
AntibodyAnti–β-actin, mouse monoclonal, clone AC-15Sigma-AldrichA5441
RRID:AB_476744
WB (1:7000)
AntibodyAnti-Gla-OCN goat polyclonal antibody (recognize amino acids 11–26 of carboxylated mature mouse OCN)PMID:20570657WB (1:3000)
ELISA (2 μg/ml)
AntibodyAnti-CTERM OCN goat polyclonal antibody recognize amino acids26–46 of mature mouse OCNPMID:20570657WB (1:3000)
ELISA (1:600)
IP (1:100)
AntibodyAnti-MID OCN goat polyclonal antibody recognize amino acids11 to 26 of mature mouse OCNPMID:20570657ELISA (1.5 μg/ml)
Recombinant DNA reagentpTT5-Fc1_CTLPMID:23951290Used as PCR template to amplify Fc and hinge region
Peptide, recombinant proteinCollagenase type 2Worthington Biochemical CorporationLS004176For primary osteoblasts preparation
Peptide, recombinant proteinO-Glycosidase and Neuraminidase BundleNEBE0540SDeglycosylation assay
Peptide, recombinant proteinThrombinGE Healthcare Life Sciences27-0846-01Protein purification
Peptide, recombinant proteinHuman plasminSigmaP1867
Chemical compound, drugWarfarinSanta Cruz Biotechnologysc-205888VKORC1 inhibitor
Chemical compound, drugDecamoyl-RVKR-CMKTocris3501/1Furin inhibitor
Chemical compound, drugN-acetylgalactosaminyltransferase inhibitor (GalNAc-bn)Sigma200100GalNAc-Ts inhibitor
Chemical compound, drugBenzamidine sepharoseGE healthcare17-5123-10Protein purification
Chemical compound, drugPepstatin ASigmaP5318Aspartyl proteases inhibitor
Chemical compound, drugTalabostatTocris,3719/10FAP inhibitor
Chemical compound, drugPhenylmethylsulfonyl fluoride (PMSF)Amresco329-98-6Serine proteases inhibitor
Chemical compound, drugVitamin K1SigmaV3501Cofactor for gamma carboxylation
Commercial assay or kitHiTrap protein A high performanceGE Healthcare Life SciencesGE29-0485-76Protein purification
Commercial assay or kitHuman ucOCN ELISABioLegend
(PMID:31935114)
446707
Commercial assay, kitJetPrimePolypus transfection114–15
Commercial assay, kitLipofectamine 2000Thermo Fisher11668019
Software, algorithmPrism version 7.03GraphPadRRID:SCR_002798
Software, algorithmXcalibur 4.0Thermo Fisher ScientificRRID:SCR_014593
Appendix 1—table 1
Additional key resources.
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Sequence-based reagentmOCN-For-EcoRIThis paperPCR primers
(Cloning of mOCN in pIRES2-EGFP-V5)
AATTGAATTCgCcaccatgaggaccctctctc
Sequence-based reagentmOCN-For-EcoRIThis paperPCR primer (cloning of mOCN in pIRES2-EGFP-V5)AATTGAATTCGCCACCATGAGGACCCTCTCTC
Sequence-based reagentmOCN-Rev-Stop-AgeIThis paperPCR primer (cloning of mOCN in pIRES2-EGFP-V5, No V5 tagged protein)AATTACCGGTCTAAATAGTGATACCGTAGATG
Sequence-based reagentmOCN-Rev-AgeIThis paperPCR primer (cloning of mOCN in pIRES2-EGFP-V5)AATTACCGGTAATAGTGATACCGTAGATGCG
Sequence-based reagentmOCNSTT-stop-Age1-RevThis paperPCR primer (cloning of S29A/T36A/T45A mOCN in pIRES2-EGFP-V5, No V5 tagged protein)AATTACCGGTCTAAATAGCGATACCGTAGATG
Sequence-based reagentmOCNSTT-Age1-RevThis paperPCR primer (cloning of S29A/T36A/T45A mOCN in pIRES2-EGFP-V5)AATTACCGGTAATAGCGATACCGTAGATGCG
Sequence-based reagentmOCN-S5A-ForThis paperPCR primer (mutagenesis of Serine five to Alanine in mOCN)TACCTTGGAGCCGCCGTCCCCAGCCCA
Sequence-based reagentmOCN-S5A-RevThis paperPCR primer (mutagenesis of Serine five to Alanine in mOCN)TGGGCTGGGGACGGCGGCTCCAAGGTA
Sequence-based reagentmOCN-S8A-ForThis paperPCR primer (mutagenesis of Serine eight to Alanine in mOCN)GCCTCAGTCCCCGCCCCAGATCCCCTG
Sequence-based reagentmOCN-S8A-RevThis paperPCR primer (mutagenesis of Serine eight to Alanine in mOCN)CAGGGGATCTGGGGCGGGGACTGAGGC
Sequence-based reagentmOCN-T15A-ForThis paperPCR primer (mutagenesis of Threonine 15 to Alanine in mOCN)CTGGAGCCCGCCCGGGAGCAG
Sequence-based reagentmOCN-T15A-RevThis paperPCR primer (mutagenesis of Threonine 15 to Alanine in mOCN)CTGCTCCCGGGC GGGCTCCAG
Sequence-based reagenthOCN-EcoRI-ForThis paperPCR primer (cloning human osteocalcin in pIRES2-EGFP-V5)AATTGAATTCGCCACCATGAGAGCCCTCACACTCCT
Sequence-based reagenthOCN-AgeI-RevThis paperPCR primer (cloning human osteocalcin in pIRES2-EGFP-V5)AATT ACCGGT GACCGGGCCGTAGAAGCG
Sequence-based reagenthOCN-Y12S-ForThis paperPCR primer (mutagenesis of Tyrosine 12 to Serine in hOCN)GCCCCAGTCCCCAGCCCGGATCCCCTG
Sequence-based reagenthOCN-Y12S-RevThis paperPCR primer (mutagenesis of Tyrosine 12 to Serine in hOCN)CAGGGGATCCGGGCTGGGGACTGGGGC
Sequence-based reagenthOCN-Y12L-ForThis paperPCR primer (mutagenesis of Tyrosine 12 to Leucine in hOCN)GCCCCAGTCCCCCTACCGGATCCCCTG
Sequence-based reagenthOCN-Y12L-RevThis paperPCR primer (mutagenesis of Tyrosine 12 to Leucine in hOCN)CAGGGGATCCGGTAGGGGGACTGGGGC
Sequence-based reagentHindIII-FchIgG1 -ForThis paperPCR primer (amplification of FC fragment+ hinge region in pTT5FC-CTL plasmid, and cloning in pcDNA3 in HindIII-BamHI)AATTAAGCTTGCCACCATGGAGTTTGGGCTG
Sequence-based reagentBamHI-FchIgG1-RevThis paperPCR primer (amplification of FC fragment+ hinge region in pTT5FC-CTL plasmid, and cloning in pcDNA3 in HindIII-BamHI)AATTGGATCCTGGGCACGGTGGGCATGTG
Sequence-based reagentBamHI-Thrombin-mOCN-ForThis paperPCR primer (cloning of Thrombin mOCN in pcDNA3 FchIgG1 using BamHI-EcoRI)AATTGGATCCCTGGTTCCGCGTGGATCTTACCTTGGAGCCTCAGTCC
Sequence-based reagentEcoRI-mOCN-RevThis paperPCR primer (cloning of Thrombin mOCN in pcDNA3 FchIgG1 using BamHI-EcoRI)AATTGAATTCCTAAATAGTGATACCGTAGATG
Sequence-based reagentBglII-Thrombin-hOCN- ForThis paperPCR primer (cloning of Thrombin hOCN (Y12S) in pcDNA3 FchIgG1 using BglII-EcoRI)AATTAGATCTCTGGTTCCGCGTGGATCTTACCTGTATCAATGGCTGG
Sequence-based reagentEcoRI-hOCN-RevThis paperPCR primer (cloning of Thrombin hOCN (Y12S) in pcDNA3 FchIgG1 using BglII-EcoRI)AATTGAATTCCTAGACCGGGCCGTAGAAGCGC
Sequence-based reagentGalnT1-ForThis paperQPCR primer (amplify Galnt1, M. musculus)GCAGCATGTGAACAGCAATCA
Sequence-based reagentGalnT1-RevThis paperQPCR primer (amplify Galnt1, M. musculus)GCTGAGGTAGCCCAGTCAATC
Sequence-based reagentGalnT2-ForThis paperQPCR primer (amplify Galnt2, M. musculus)GGCAACTCCAAACTGCGACA
Sequence-based reagentGalnT2-RevThis paperQPCR primer (amplify Galnt2, M. musculus)TCAACAAACTGGGCCGGTG
Sequence-based reagentGalnT3-ForThis paperQPCR primer (amplify Galnt3, M. musculus)ACTTAGTGCCATGTGACGCA
Sequence-based reagentGalnT3-RevThis paperQPCR primer (amplify Galnt3, M. musculus)GGGTTTCTGCAGCGGTTCTA
Sequence-based reagentGalnT4-ForThis paperQPCR primer (amplify Galnt4, M. musculus)CAAAACTGCCCCAAAGACGG
Sequence-based reagentGalnT4-RevThis paperQPCR primer (amplify Galnt4, M. musculus)CGCTCTGCTGCTAGCCTATT
Sequence-based reagentGalnT5-ForThis paperQPCR primer (amplify Galnt5, M. musculus)CCCTGAAACTGGCTGCTTGT
Sequence-based reagentGalnT5-RevThis paperQPCR primer (amplify Galnt5, M. musculus)ATGGAGAGAAATTCAGTCAGCAA
Sequence-based reagentGalnT6-ForThis paperQPCR primer (amplify Galnt6, M. musculus)CCAGCTCTGGCTGTTTGTCTA
Sequence-based reagentGalnT6-RevThis paperQPCR primer (amplify Galnt6, M. musculus)TTGGGCCAAGTAGCATGTGA
Sequence-based reagentGalnT7-ForThis paperQPCR primer (amplify Galnt7, M. musculus)GCACAGGTTTACGCACATCA
Sequence-based reagentGalnT7-RevThis paperQPCR primer (amplify Galnt7, M. musculus)TTCCAGGCGGTTTTCAGTCC
Sequence-based reagentGalnT9-ForThis paperQPCR primer (amplify Galnt9, M. musculus)CAACTTTGGGCTGCGGTTAG
Sequence-based reagentGalnT9-RevThis paperQPCR primer (amplify Galnt9, M. musculus)CCCACATTGCTCTTGGGTCT
Sequence-based reagentGalnT10-ForThis paperQPCR primer (amplify Galnt10, M. musculus)GGAGTACCGCCACCTCTCAG
Sequence-based reagentGalnT10-RevThis paperQPCR primer (amplify Galnt10, M. musculus)AGGTCCCAGGCAATTTTGGT
Sequence-based reagentGalnT11-ForThis paperQPCR primer (amplify Galnt11, M. musculus)GGCTGTACCAAGTGTCCGTT
Sequence-based reagentGalnT11-RevThis paperQPCR primer (amplify Galnt11, M. musculus)GCAGGCATGACAAAACCAGG
Sequence-based reagentGalnT12-ForThis paperQPCR primer (amplify Galnt12, M. musculus)ACAACGGCTTTGCACCATAC
Sequence-based reagentGalnT12-RevThis paperQPCR primer (amplify Galnt12, M. musculus)ACACTCTTGTGACACCCAGC
Sequence-based reagentGalnT13-ForThis paperQPCR primer (amplify Galnt13, M. musculus)CTGGCAATGTGGAGGTTCTT
Sequence-based reagentGalnT13-RevThis paperQPCR primer (amplify Galnt13, M. musculus)AATTCATCCATCCACACTTCTGC
Sequence-based reagentGalnT14-ForThis paperQPCR primer (amplify Galnt14, M. musculus)TCTTTCCGAGTGTGGATGTGT
Sequence-based reagentGalnT14-RevThis paperQPCR primer (amplify Galnt14, M. musculus)CCCATCGGGGAAAACATAAGGA
Sequence-based reagentGalnT15-ForThis paperQPCR primer (amplify Galnt15, M. musculus)CTGCGGTGGCTCTGTTGAAA
Sequence-based reagentGalnT15-RevThis paperQPCR primer (amplify Galnt15, M. musculus)CTGGGATGTGCCTGTAGAAGG
Sequence-based reagentGalnT16-ForThis paperQPCR primer (amplify Galnt16, M. musculus)TGGTGACCAGCAAATGTCAGA
Sequence-based reagentGalnT16-RevThis paperQPCR primer (amplify Galnt16, M. musculus)TCCGGTCGAAATGTGAGGAG
Sequence-based reagentGalnT18-ForThis paperQPCR primer (amplify Galnt18, M. musculus)CAGAAGTGCTCGGGACAACA
Sequence-based reagentGalnT18-RevThis paperQPCR primer (amplify Galnt18, M. musculus)TTGGCTCTCCCTCTCAGACT
Sequence-based reagentGalntl5-ForThis paperQPCR primer (amplify Galntl5, M. musculus)AGTGAGCGCGTGGAATTAAG
Sequence-based reagentGalntl5-RevThis paperQPCR primer (amplify Galntl5, M. musculus)AGATTTGTCCTGTGGTGCGA
Sequence-based reagentWbscr17-ForThis paperQPCR primer (amplify Wbscr17, M. musculus)CTTAGGTGCTCTGGGGACCA
Sequence-based reagentWbscr17-RevThis paperQPCR primer (amplify Wbscr17, M. musculus)TGTACAAGCTGCTCTTGACCT
Sequence-based reagentGalntl6-ForThis paperQPCR primer (amplify Galntl6, M. musculus)ACCGAGACTAGCAGTTCCCT
Sequence-based reagentGalntl6-RevThis paperQPCR primer (amplify Galntl6, M. musculus)GTCATGCGCTCTGTTTCCAC
Sequence-based reagentActin beta- ForThis paperQPCR primer (amplify Actb, M. musculus)GACCTCTAT GCCAACACAGT
Sequence-based reagentActin beta- RevThis paperQPCR primer (amplify Actb, M. musculus)AGTACTTGC GCTCAGGAGGA
Sequence-based reagentIns1- ForThis paperQPCR primer (amplify Ins1, R. Norvegicus)ACCCTAAGTGACCAGCTACA
Sequence-based reagentIns1-RevThis paperQPCR primer (amplify Ins1, R. Norvegicus)TTCACGACGGGACTTGGG
Sequence-based reagentGapdh-ForThis paperQPCR primer (amplify Gapdh, R. Norvegicus)AGTGCCAGCCTCGTCTCATA
Sequence-based reagentGapdh-RevThis paperQPCR primer (amplify Gapdh, R. Norvegicus)GATGGTGATGGGTTTCCCGT

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)