The half-life of the bone-derived hormone osteocalcin is regulated through O-glycosylation in mice, but not in humans
- Molecular Physiology Research unit, Institut de Recherches Cliniques de Montréal, Canada
- Programme de biologie moléculaire, Université de Montréal, Canada
- Proteomics Discovery Platform, Institut de Recherches Cliniques de Montréal, Canada
- University of Copenhagen, Faculty of Health Sciences, Copenhagen Center for Glycomics, Departments of Cellular and Molecular Medicine, Denmark
- Département de Médecine, Université de Montréal, Canada
- Division of Experimental Medicine, McGill University, Canada
Figures
Figure 1
OCN is O-glycosylated in vitro and in vivo on serine 8.
(A) Western blot analysis on the secretion medium (SM) of HEK293 (WT) and HEK293 lacking COSMC (C1GALT1C1-/-) transfected with mouse OCN-V5. (B) Western blot analysis on the SM of CHO and CHO-ldlD …
-
Figure 1—source data 1
Original western blot image from Figure 1A.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data1-v2.xlsx
-
Figure 1—source data 2
Original western blot image from Figure 1B.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data2-v2.xlsx
-
Figure 1—source data 3
Original western blot image from Figure 1C.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data3-v2.xlsx
-
Figure 1—source data 4
Original western blot image from Figure 1D.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data4-v2.xlsx
-
Figure 1—source data 5
Original western blot image from Figure 1F.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data5-v2.xlsx
-
Figure 1—source data 6
Original western blot image from Figure 1G.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data6-v2.xlsx
-
Figure 1—source data 7
Raw proteomic data from Figure 1H.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig1-data7-v2.xlsx
Figure 2 with 1 supplement
OCN O-glycosylation by N-acetylgalactosaminyltransferase (GalNAc-Ts) is independent of its processing and γ-carboxylation.
(A) Galnts expression in pre-osteoblasts (undifferentiated) and osteoblasts (differentiated) by quantitative PCR (n = 3 per condition). Results are represented as copy number of Galnts normalized to …
-
Figure 2—source data 1
Numerical data from the graph in Figure 2A.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data1-v2.xlsx
-
Figure 2—source data 2
Original western blot image from Figure 2B.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data2-v2.xlsx
-
Figure 2—source data 3
Original western blot image from Figure 2C.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data3-v2.xlsx
-
Figure 2—source data 4
Numerical data from the graph in Figure 2C.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data4-v2.xlsx
-
Figure 2—source data 5
Original western blot image from Figure 2D.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data5-v2.xlsx
-
Figure 2—source data 6
Numerical data from the graph in Figure 2D.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data6-v2.xlsx
-
Figure 2—source data 7
Original western blot image from Figure 2E.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data7-v2.xlsx
-
Figure 2—source data 8
Numerical data from the graph in Figure 2E.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data8-v2.xlsx
-
Figure 2—source data 9
Original western blot image from Figure 2F.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig2-data9-v2.xlsx
Figure 2—figure supplement 1
Mouse OCN O-glycosylation occurs independently of its carboxylation and processing in HEK293 cells.
Western blot analysis on the secretion media (SM) of HEK293 cells transfected with mouse OCN-V5 and treated or not with 2 mM of GalNAc-bn, 50 μM warfarin or 50 μM Dec-RVKR-CMK (RVKR).
Figure 3 with 4 supplements
Mouse OCN O-glycosylation increases its half-life ex vivo and in vivo.
(A) Annotated and deconvoluted MS spectrum of purified glycosylated mouse OCN (O-gly ucOCN). (B) Annotated and deconvoluted MS spectrum of purified non-glycosylated mouse OCN (ucOCN). (C–D) Ex vivo …
-
Figure 3—source data 1
Raw proteomic data from Figure 3A.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Raw proteomic data from Figure 3B.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data2-v2.xlsx
-
Figure 3—source data 3
Numerical data from the graph in Figure 3C.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data3-v2.xlsx
-
Figure 3—source data 4
Numerical data from the graph in Figure 3D.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data4-v2.xlsx
-
Figure 3—source data 5
Numerical data from the graph in Figure 3E.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data5-v2.xlsx
-
Figure 3—source data 6
Numerical data from the graph in Figure 3F.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data6-v2.xlsx
-
Figure 3—source data 7
Numerical data from the graph in Figure 3G.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data7-v2.xlsx
-
Figure 3—source data 8
Numerical data from the graph in Figure 3H.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data8-v2.xlsx
-
Figure 3—source data 9
Numerical data from the graph in Figure 3I.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-data9-v2.xlsx
Figure 3—figure supplement 1
Purification of recombinant O-glycosylated mouse ucOCN.
(A) Map of the pcDNA3.1-Fc-hinge-Thr-OCN construct used to produce and purify mouse ucOCN fusion protein. (B) Coomassie staining of purified O-glycosylated mouse ucOCN (O-gly ucOCN) compared to non- …
-
Figure 3—figure supplement 1—source data 1
Original gel image from Figure 3—figure supplement 1 (panel B).
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-figsupp1-data1-v2.xlsx
Figure 3—figure supplement 2
Mouse OCN ELISA recognize O-glycosylated mouse ucOCN (O-gly ucOCN) and non-glycosylated mouse ucOCN (ucOCN).
Standard curve of O-gly ucOCN (n = 3–5) and ucOCN (n = 3–5) ranging from 0 to 100 ng/ml.
-
Figure 3—figure supplement 2—source data 1
Numerical data from the graph in Figure 3—figure supplement 2.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-figsupp2-data1-v2.xlsx
Figure 3—figure supplement 3
Effect of different protease inhibitors on non-glycosylated mouse ucOCN plasma half-life.
(A–B) Ex vivo half-life of O-gly ucOCN and ucOCN in OCN-deficient plasma (Bglap-/-; n = 3 plasma for each condition). (A) 100 ng/ml O-gly ucOCN (n = 3) and ucOCN (n = 3) were incubated for 2 hr in …
-
Figure 3—figure supplement 3—source data 1
Numerical data from the graph in Figure 3—figure supplement 3 (panel A).
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-figsupp3-data1-v2.xlsx
-
Figure 3—figure supplement 3—source data 2
Numerical data from the graph in Figure 3—figure supplement 3 (panel B).
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-figsupp3-data2-v2.xlsx
Figure 3—figure supplement 4
Mouse OCN O-glycosylation increases its stability in vivo in fed conditions.
(A) In vivo stability of O-gly ucOCN and ucOCN in fed condition in mice. O-gly ucOCN or ucOCN were injected intraperitoneally in OCN deficient male mice (Bglap-/-; n = 9 mice each) at a dose of 40 …
-
Figure 3—figure supplement 4—source data 1
Numerical data from the graph in Figure 3—figure supplement 4 (panel A).
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-figsupp4-data1-v2.xlsx
-
Figure 3—figure supplement 4—source data 2
Numerical data from the graph in Figure 3—figure supplement 4 (panel B).
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig3-figsupp4-data2-v2.xlsx
Figure 4
Effect of O-glycosylation on mouse OCN bioactivity and stability in culture.
(A) Insulin gene expression (Ins1) in INS-1 832/3 cells following an 8 hr treatment with vehicle (n = 6), non-glycosylated mouse OCN (ucOCN) (n = 10) or glycosylated mouse ucOCN (O-gly ucOCN) (n = 8–…
-
Figure 4—source data 1
Numerical data from the graph in Figure 4A.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig4-data1-v2.xlsx
-
Figure 4—source data 2
Numerical data from the graph in Figure 4B.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig4-data2-v2.xlsx
Figure 5 with 3 supplements
Human OCN O-glycosylation increases its half-life ex vivo.
(A) Amino acid alignment of mouse and human OCN. The six serine and threonine residues present in the mouse protein and their corresponding amino acids in human OCN are highlighted in gray. The site …
-
Figure 5—source data 1
Original western blot image from Figure 5B.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data1-v2.xlsx
-
Figure 5—source data 2
Original western blot image from Figure 5C.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data2-v2.xlsx
-
Figure 5—source data 3
Original western blot image from Figure 5D.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data3-v2.xlsx
-
Figure 5—source data 4
Raw proteomic data from Figure 5E.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data4-v2.xlsx
-
Figure 5—source data 5
Raw proteomic data from Figure 5F.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data5-v2.xlsx
-
Figure 5—source data 6
Numerical data from the graph in Figure 5G.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data6-v2.xlsx
-
Figure 5—source data 7
Numerical data from the graph in Figure 5H.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-data7-v2.xlsx
Figure 5—figure supplement 1
Purification of recombinant O-glycosylated human ucOCN.
(A) Map of pcDNA3.1-Fc-hinge-Thr-hOCN (Y12S) construct used to produce and purify O-glycosylated human ucOCN fusion protein. (B) Coomassie staining of purified O-glycosylated human ucOCN (O-gly …
-
Figure 5—figure supplement 1—source data 1
Original gel image from Figure 5—figure supplement 1 (panel B).
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-figsupp1-data1-v2.xlsx
Figure 5—figure supplement 2
Human ucOCN ELISA equally recognize O-glycosylated human ucOCN (O-gly uc-hOCN) and non-glycosylated human ucOCN (uc-hOCN).
Standard curve of O-gly uc-hOCN (n = 2) and uc-hOCN (n = 2) ranging from 0 to 100 ng/ml.
-
Figure 5—figure supplement 2—source data 1
Numerical data from the graph in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-figsupp2-data1-v2.xlsx
Figure 5—figure supplement 3
Effect of different protease inhibitors on non-glycosylated human ucOCN plasma half-life.
Ex vivo half-life of O-gly uc-hOCN and uc-hOCN in OCN deficient plasma (Bglap-/-; n = 3–4 plasma). 650 ng/ml O-gly uc-hOCN (n = 3) and uc-hOCN (n = 3) were incubated for 2 hr in normal plasma at …
-
Figure 5—figure supplement 3—source data 1
Numerical data from the graph in Figure 5—figure supplement 3.
- https://cdn.elifesciences.org/articles/61174/elife-61174-fig5-figsupp3-data1-v2.xlsx
Tables
Table 1
OCN serum levels in mouse and human at different ages.
| OCN serum levels (ng/ml) | ||
|---|---|---|
| Age (mice/human) | Mouse [mean ± SD (n)] | Human* [mean ± SD (n)] |
| 2 weeks/ 1 year old | 1369.7 ± 146.7 (8) | 62.9 ± 8.1 (43) |
| 4 weeks/ 11–13 years old | 617.2 ± 192.5 (5) | 74.1 ± 8.9 (41) |
| 13 weeks/ 25–29 years old | 252.2 ± 8.0 (4) | 21.0 ± 6.3 (49) |
| 60 weeks/ 50–54 years old | 50.0 ± 7.2 (4) | 13.5 ± 6.3 (127) |
-
Table 1—source data 1
Numerical data from Table 1.
- https://cdn.elifesciences.org/articles/61174/elife-61174-table1-data1-v2.xlsx
Table 2
The monoisotopic mass and relative abundance of the different OCN forms detected in the supernatant of differentiated osteoblasts.
| Monoisotopic mass range (Da) | Relative abundance (%) | Most probable modification | Most probable oligosaccharide |
|---|---|---|---|
| O-glycosylated OCN | 83.88 | ||
| 5767.6961 | 4.80 | Glycosylation | HexNAc, Hex, NANA |
| 5783.6801 | 0.25 | Glycosylation + oxidation | HexNAc, Hex, NANA |
| 5855.6676 | 4.60 | Glycosylation + 2x Gla | HexNAc, Hex, NANA |
| 5899.7161 | 3.16 | Glycosylation + 3x Gla | HexNAc, Hex, NANA |
| 5915.6386–5968.5796 | 5.51 | Glycosylation + 3x Gla + oxidation + additional unidentified modifications or adduct ions | HexNAc, Hex, NANA |
| 6058.7916 | 24.48 | Glycosylation | HexNAc, Hex, 2x NANA |
| 6074.7766–6096.7409 | 2.48 | Glycosylation + oxidation | HexNAc, Hex, 2x NANA |
| 6102.7681 | 7.89 | Glycosylation + 1x Gla | HexNAc, Hex, 2x NANA |
| 6146.7609 | 23.97 | Glycosylation + 2x Gla | HexNAc, Hex, 2x NANA |
| 6190.8061–6214.7278 | 6.72 | Glycosylation + 3x Gla + additional unidentified modifications or adduct ions | HexNAc, Hex, 2x NANA |
| Non O-glycosylated OCN | 16.12 | ||
| 5127.4676 | 3.00 | Oxidation | NA |
| 5171.4301 | 1.85 | 1x Gla + oxidation | NA |
| 5199.4446 | 2.08 | 2x Gla | NA |
| 5215.4296 | 8.50 | 2x Gla + oxidation | NA |
| 5259.4204 | 0.66 | 3x Gla + oxidation | NA |
-
Gla: Gamma-carboxyglutamic acid residue; HexNAc: N-acetylhexosamine; Hex: Hexose; NANA: N-acetylneuraminic acid; 1x: one time; 2x: two times; 3x: three times; NA: not applicable.
-
Table 2—source data 1
Raw proteomic data from Table 2.
- https://cdn.elifesciences.org/articles/61174/elife-61174-table2-data1-v2.xlsx
Table 3
The monoisotopic mass and relative abundance of the different OCN forms detected in mouse bone homogenates.
| Monoisotopic mass range | Relative abundance (%) | Most probable modification | Most probable oligosaccharide |
|---|---|---|---|
| O-glycosylated OCN | 99.07 | ||
| 5855.6676 | 0.54 | Glycosylation + 2x Gla | HexNAc, Hex, NANA |
| 5899.7161 | 7.43 | Glycosylation + 3x Gla | HexNAc, Hex, NANA |
| 5915.6386–6135.6796 | 36.07 | Glycosylation + 3x Gla + oxidation + additional unidentified modifications or adduct ions | HexNAc, Hex, NANA |
| 6146.7609–6162.7991 | 5.42 | Glycosylation + 2x Gla + additional unidentified modifications | HexNAc, Hex, 2xNANA |
| 6190.8061 | 4.49 | Glycosylation + 3x Gla | HexNAc, Hex, 2xNANA |
| 6206.8016–6441.7636 | 45.12 | Glycosylation + 3x Gla + oxidation + additional unidentified modifications or adduct ions | HexNAc, Hex, 2xNANA |
| Non O-glycosylated OCN | 0.93 | ||
| 5259.4204 | 0.93 | 3x Gla + oxidation | NA |
-
Gla: Gamma-carboxyglutamic acid residue; HexNAc: N-acetylhexosamine; Hex: Hexose; NANA: N-acetylneuraminic acid; 1x: one time; 2x: two times; 3x: three times; NA: not applicable.
-
Table 3—source data 1
Raw proteomic data from Table 3.
- https://cdn.elifesciences.org/articles/61174/elife-61174-table3-data1-v2.xlsx
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Bglap | GenBank | Gene ID: 12096 | Mouse osteocalcin gene 1 |
| Gene (M. musculus) | Bglap2 | GenBank | Gene ID: 12097 | Mouse osteocalcin gene 2 |
| Gene (Homo sapiens) | BGLAP | GenBank | Gene ID: 632 | Human osteocalcin gene |
| Genetic reagent (M. musculus) | Bglap-/- | PMID:8684484 | Bglap/Bglap2tm1Kry RRID:MGI:3837364 | Genetic background: C57BL/6J |
| Genetic reagent (M. musculus) | Furinfl/fl | PMID:15471862 | Furintm1Jwmc RRID:MGI:3700793 | Genetic background: C57BL/6J |
| Genetic reagent (M. musculus) | BGLAP-Cre | PMID:12215457 | Tg(BGLAP-cre)1Clem RRID:IMSR_JAX:019509 | Genetic background: C57BL/6J |
| Genetic reagent (M. musculus) | C57BL/6J wildtype mice | The Jackson Laboratory | Stock No: 000664 RRID:IMSR_JAX:000664 | For primary osteoblasts preparation |
| Cell line (R. norvegicus) | INS-1 832/3 | Millipore-Sigma | SCC208 RRID:CVCL_ZL55 | |
| Cell line (C. griseus) | Chinese hamster ovary (CHO-K1) cells | ATCC | CCL-61 RRID:CVCL_0214 | |
| Cell line (C. griseus) | Chinese hamster ovary ldlD cells (CHO-ldlD) | PMID:3948246 | RRID:CVCL_1V03 | Cell maintained in N. Seidah lab. |
| Cell line (M. musculus) | Primary osteoblasts | This paper | Prepared from C57BL/6J wildtype mice newborn calvaria | |
| Cell line (H. sapiens) | Human embryonic kidney cells HEK293 | ATCC | CRL-1573 RRID:CVCL_0045 | |
| Cell line (H. sapiens) | COSMC knockout HEK293 cells (C1GALT1C1-/-) | PMID:23584533 | RRID:CVCL_S025 | Cell maintained in H. Clausen lab. |
| Cell line (H. sapiens) | GALNT3/6 knockout HEK293 cells | PMID:31040225 | Cell maintained in H. Clausen lab. | |
| Cell line (H. sapiens) | GALNT3 knockout HEK293 cells | PMID:31040225 | Cell maintained in H. Clausen lab. | |
| Cell line (H. sapiens) | GALNT6 knockout HEK293 cells | PMID:31040225 | Cell maintained in H. Clausen lab. | |
| Cell line (H. sapiens) | GALNT1/2/3 knockout HEK293 cells | PMID:31040225 | Cell maintained in H. Clausen lab. | |
| Transfected construct (M. musculus) | pIRES2-EGFP-mOCN-V5 | This paper | To express mouse OCN V5 tagged in primary osteoblasts, CHO-K1, CHO-ldlD and HEK293 | |
| Transfected construct (M. musculus) | pIRES2- EGFP-mOCN (S5A/S8/AT15A) -V5 | This paper | To express (S5A/S8/AT15A) mutant mouse OCN V5 tagged in primary osteoblasts | |
| Transfected construct (M. musculus) | pIRES2- EGFP-mOCN (S29A/T36A/T45A) -V5 | This paper | To express (S29A/T36A/T45A) mutant mouse OCN V5 tagged in primary osteoblasts | |
| Transfected construct (M. musculus) | pIRES2- EGFP-mOCN (6XST→6XA)-V5 | This paper | To express (6XST→6XA) mutant mouse OCN V5 tagged in primary osteoblasts | |
| Transfected construct (M. musculus) | pIRES2- EGFP-mOCN (S5A)-V5 | This paper | To express (S5A) mutant mouse OCN V5 tagged in primary osteoblasts | |
| Transfected construct (M. musculus) | pIRES2- EGFP-mOCN (S8A)-V5 | This paper | To express (S8A) mutant mouse OCN V5 tagged in primary osteoblasts | |
| Transfected construct (M. musculus) | pIRES2- EGFP-mOCN (T15A)-V5 | This paper | To express (T15A) mutant mouse OCN V5 tagged in primary osteoblasts | |
| Transfected construct (H. sapiens) | pIRES2-EGFP-hOCN-V5 | This paper | To express human OCN V5 tagged in primary osteoblasts | |
| Transfected construct (H. sapiens) | pIRES2-EGFP-hOCN (Y12S)-V5 | This paper | To express (Y12S) mutant human OCN V5 tagged in primary osteoblasts | |
| Transfected construct (H. sapiens) | pIRES2-EGFP-hOCN (Y12L)-V5 | This paper | To express (Y12L) human OCN V5 tagged in primary osteoblasts | |
| Transfected construct (H. sapiens) | pcDNA3.1-Fc-hinge-Thr-mOCN | This paper | Used to produce O-gly ucOCN in HEK293 | |
| Transfected construct (H. sapiens) | pcDNA3.1-Fc-hinge-Thr-hOCN (Y12S) | This paper | Used to produce O-gly uc-hOCN in HEK293 | |
| Antibody | Anti-GFP, mouse monoclonal, clones 7.1 and 13.1 | Sigma-Aldrich | 11814460001 RRID:AB_390913 | WB (1:1000) |
| Antibody | Anti-V5, mouse monoclonal, clone V5-10 | Sigma-Aldrich | V8012 RRID:AB_261888 | WB (1:3000) |
| Antibody | Anti–β-actin, mouse monoclonal, clone AC-15 | Sigma-Aldrich | A5441 RRID:AB_476744 | WB (1:7000) |
| Antibody | Anti-Gla-OCN goat polyclonal antibody (recognize amino acids 11–26 of carboxylated mature mouse OCN) | PMID:20570657 | WB (1:3000) ELISA (2 μg/ml) | |
| Antibody | Anti-CTERM OCN goat polyclonal antibody recognize amino acids26–46 of mature mouse OCN | PMID:20570657 | WB (1:3000) ELISA (1:600) IP (1:100) | |
| Antibody | Anti-MID OCN goat polyclonal antibody recognize amino acids11 to 26 of mature mouse OCN | PMID:20570657 | ELISA (1.5 μg/ml) | |
| Recombinant DNA reagent | pTT5-Fc1_CTL | PMID:23951290 | Used as PCR template to amplify Fc and hinge region | |
| Peptide, recombinant protein | Collagenase type 2 | Worthington Biochemical Corporation | LS004176 | For primary osteoblasts preparation |
| Peptide, recombinant protein | O-Glycosidase and Neuraminidase Bundle | NEB | E0540S | Deglycosylation assay |
| Peptide, recombinant protein | Thrombin | GE Healthcare Life Sciences | 27-0846-01 | Protein purification |
| Peptide, recombinant protein | Human plasmin | Sigma | P1867 | |
| Chemical compound, drug | Warfarin | Santa Cruz Biotechnology | sc-205888 | VKORC1 inhibitor |
| Chemical compound, drug | Decamoyl-RVKR-CMK | Tocris | 3501/1 | Furin inhibitor |
| Chemical compound, drug | N-acetylgalactosaminyltransferase inhibitor (GalNAc-bn) | Sigma | 200100 | GalNAc-Ts inhibitor |
| Chemical compound, drug | Benzamidine sepharose | GE healthcare | 17-5123-10 | Protein purification |
| Chemical compound, drug | Pepstatin A | Sigma | P5318 | Aspartyl proteases inhibitor |
| Chemical compound, drug | Talabostat | Tocris, | 3719/10 | FAP inhibitor |
| Chemical compound, drug | Phenylmethylsulfonyl fluoride (PMSF) | Amresco | 329-98-6 | Serine proteases inhibitor |
| Chemical compound, drug | Vitamin K1 | Sigma | V3501 | Cofactor for gamma carboxylation |
| Commercial assay or kit | HiTrap protein A high performance | GE Healthcare Life Sciences | GE29-0485-76 | Protein purification |
| Commercial assay or kit | Human ucOCN ELISA | BioLegend (PMID:31935114) | 446707 | |
| Commercial assay, kit | JetPrime | Polypus transfection | 114–15 | |
| Commercial assay, kit | Lipofectamine 2000 | Thermo Fisher | 11668019 | |
| Software, algorithm | Prism version 7.03 | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | Xcalibur 4.0 | Thermo Fisher Scientific | RRID:SCR_014593 |
Appendix 1—table 1
Additional key resources.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Sequence-based reagent | mOCN-For-EcoRI | This paper | PCR primers (Cloning of mOCN in pIRES2-EGFP-V5) | AATTGAATTCgCcaccatgaggaccctctctc |
| Sequence-based reagent | mOCN-For-EcoRI | This paper | PCR primer (cloning of mOCN in pIRES2-EGFP-V5) | AATTGAATTCGCCACCATGAGGACCCTCTCTC |
| Sequence-based reagent | mOCN-Rev-Stop-AgeI | This paper | PCR primer (cloning of mOCN in pIRES2-EGFP-V5, No V5 tagged protein) | AATTACCGGTCTAAATAGTGATACCGTAGATG |
| Sequence-based reagent | mOCN-Rev-AgeI | This paper | PCR primer (cloning of mOCN in pIRES2-EGFP-V5) | AATTACCGGTAATAGTGATACCGTAGATGCG |
| Sequence-based reagent | mOCNSTT-stop-Age1-Rev | This paper | PCR primer (cloning of S29A/T36A/T45A mOCN in pIRES2-EGFP-V5, No V5 tagged protein) | AATTACCGGTCTAAATAGCGATACCGTAGATG |
| Sequence-based reagent | mOCNSTT-Age1-Rev | This paper | PCR primer (cloning of S29A/T36A/T45A mOCN in pIRES2-EGFP-V5) | AATTACCGGTAATAGCGATACCGTAGATGCG |
| Sequence-based reagent | mOCN-S5A-For | This paper | PCR primer (mutagenesis of Serine five to Alanine in mOCN) | TACCTTGGAGCCGCCGTCCCCAGCCCA |
| Sequence-based reagent | mOCN-S5A-Rev | This paper | PCR primer (mutagenesis of Serine five to Alanine in mOCN) | TGGGCTGGGGACGGCGGCTCCAAGGTA |
| Sequence-based reagent | mOCN-S8A-For | This paper | PCR primer (mutagenesis of Serine eight to Alanine in mOCN) | GCCTCAGTCCCCGCCCCAGATCCCCTG |
| Sequence-based reagent | mOCN-S8A-Rev | This paper | PCR primer (mutagenesis of Serine eight to Alanine in mOCN) | CAGGGGATCTGGGGCGGGGACTGAGGC |
| Sequence-based reagent | mOCN-T15A-For | This paper | PCR primer (mutagenesis of Threonine 15 to Alanine in mOCN) | CTGGAGCCCGCCCGGGAGCAG |
| Sequence-based reagent | mOCN-T15A-Rev | This paper | PCR primer (mutagenesis of Threonine 15 to Alanine in mOCN) | CTGCTCCCGGGC GGGCTCCAG |
| Sequence-based reagent | hOCN-EcoRI-For | This paper | PCR primer (cloning human osteocalcin in pIRES2-EGFP-V5) | AATTGAATTCGCCACCATGAGAGCCCTCACACTCCT |
| Sequence-based reagent | hOCN-AgeI-Rev | This paper | PCR primer (cloning human osteocalcin in pIRES2-EGFP-V5) | AATT ACCGGT GACCGGGCCGTAGAAGCG |
| Sequence-based reagent | hOCN-Y12S-For | This paper | PCR primer (mutagenesis of Tyrosine 12 to Serine in hOCN) | GCCCCAGTCCCCAGCCCGGATCCCCTG |
| Sequence-based reagent | hOCN-Y12S-Rev | This paper | PCR primer (mutagenesis of Tyrosine 12 to Serine in hOCN) | CAGGGGATCCGGGCTGGGGACTGGGGC |
| Sequence-based reagent | hOCN-Y12L-For | This paper | PCR primer (mutagenesis of Tyrosine 12 to Leucine in hOCN) | GCCCCAGTCCCCCTACCGGATCCCCTG |
| Sequence-based reagent | hOCN-Y12L-Rev | This paper | PCR primer (mutagenesis of Tyrosine 12 to Leucine in hOCN) | CAGGGGATCCGGTAGGGGGACTGGGGC |
| Sequence-based reagent | HindIII-FchIgG1 -For | This paper | PCR primer (amplification of FC fragment+ hinge region in pTT5FC-CTL plasmid, and cloning in pcDNA3 in HindIII-BamHI) | AATTAAGCTTGCCACCATGGAGTTTGGGCTG |
| Sequence-based reagent | BamHI-FchIgG1-Rev | This paper | PCR primer (amplification of FC fragment+ hinge region in pTT5FC-CTL plasmid, and cloning in pcDNA3 in HindIII-BamHI) | AATTGGATCCTGGGCACGGTGGGCATGTG |
| Sequence-based reagent | BamHI-Thrombin-mOCN-For | This paper | PCR primer (cloning of Thrombin mOCN in pcDNA3 FchIgG1 using BamHI-EcoRI) | AATTGGATCCCTGGTTCCGCGTGGATCTTACCTTGGAGCCTCAGTCC |
| Sequence-based reagent | EcoRI-mOCN-Rev | This paper | PCR primer (cloning of Thrombin mOCN in pcDNA3 FchIgG1 using BamHI-EcoRI) | AATTGAATTCCTAAATAGTGATACCGTAGATG |
| Sequence-based reagent | BglII-Thrombin-hOCN- For | This paper | PCR primer (cloning of Thrombin hOCN (Y12S) in pcDNA3 FchIgG1 using BglII-EcoRI) | AATTAGATCTCTGGTTCCGCGTGGATCTTACCTGTATCAATGGCTGG |
| Sequence-based reagent | EcoRI-hOCN-Rev | This paper | PCR primer (cloning of Thrombin hOCN (Y12S) in pcDNA3 FchIgG1 using BglII-EcoRI) | AATTGAATTCCTAGACCGGGCCGTAGAAGCGC |
| Sequence-based reagent | GalnT1-For | This paper | QPCR primer (amplify Galnt1, M. musculus) | GCAGCATGTGAACAGCAATCA |
| Sequence-based reagent | GalnT1-Rev | This paper | QPCR primer (amplify Galnt1, M. musculus) | GCTGAGGTAGCCCAGTCAATC |
| Sequence-based reagent | GalnT2-For | This paper | QPCR primer (amplify Galnt2, M. musculus) | GGCAACTCCAAACTGCGACA |
| Sequence-based reagent | GalnT2-Rev | This paper | QPCR primer (amplify Galnt2, M. musculus) | TCAACAAACTGGGCCGGTG |
| Sequence-based reagent | GalnT3-For | This paper | QPCR primer (amplify Galnt3, M. musculus) | ACTTAGTGCCATGTGACGCA |
| Sequence-based reagent | GalnT3-Rev | This paper | QPCR primer (amplify Galnt3, M. musculus) | GGGTTTCTGCAGCGGTTCTA |
| Sequence-based reagent | GalnT4-For | This paper | QPCR primer (amplify Galnt4, M. musculus) | CAAAACTGCCCCAAAGACGG |
| Sequence-based reagent | GalnT4-Rev | This paper | QPCR primer (amplify Galnt4, M. musculus) | CGCTCTGCTGCTAGCCTATT |
| Sequence-based reagent | GalnT5-For | This paper | QPCR primer (amplify Galnt5, M. musculus) | CCCTGAAACTGGCTGCTTGT |
| Sequence-based reagent | GalnT5-Rev | This paper | QPCR primer (amplify Galnt5, M. musculus) | ATGGAGAGAAATTCAGTCAGCAA |
| Sequence-based reagent | GalnT6-For | This paper | QPCR primer (amplify Galnt6, M. musculus) | CCAGCTCTGGCTGTTTGTCTA |
| Sequence-based reagent | GalnT6-Rev | This paper | QPCR primer (amplify Galnt6, M. musculus) | TTGGGCCAAGTAGCATGTGA |
| Sequence-based reagent | GalnT7-For | This paper | QPCR primer (amplify Galnt7, M. musculus) | GCACAGGTTTACGCACATCA |
| Sequence-based reagent | GalnT7-Rev | This paper | QPCR primer (amplify Galnt7, M. musculus) | TTCCAGGCGGTTTTCAGTCC |
| Sequence-based reagent | GalnT9-For | This paper | QPCR primer (amplify Galnt9, M. musculus) | CAACTTTGGGCTGCGGTTAG |
| Sequence-based reagent | GalnT9-Rev | This paper | QPCR primer (amplify Galnt9, M. musculus) | CCCACATTGCTCTTGGGTCT |
| Sequence-based reagent | GalnT10-For | This paper | QPCR primer (amplify Galnt10, M. musculus) | GGAGTACCGCCACCTCTCAG |
| Sequence-based reagent | GalnT10-Rev | This paper | QPCR primer (amplify Galnt10, M. musculus) | AGGTCCCAGGCAATTTTGGT |
| Sequence-based reagent | GalnT11-For | This paper | QPCR primer (amplify Galnt11, M. musculus) | GGCTGTACCAAGTGTCCGTT |
| Sequence-based reagent | GalnT11-Rev | This paper | QPCR primer (amplify Galnt11, M. musculus) | GCAGGCATGACAAAACCAGG |
| Sequence-based reagent | GalnT12-For | This paper | QPCR primer (amplify Galnt12, M. musculus) | ACAACGGCTTTGCACCATAC |
| Sequence-based reagent | GalnT12-Rev | This paper | QPCR primer (amplify Galnt12, M. musculus) | ACACTCTTGTGACACCCAGC |
| Sequence-based reagent | GalnT13-For | This paper | QPCR primer (amplify Galnt13, M. musculus) | CTGGCAATGTGGAGGTTCTT |
| Sequence-based reagent | GalnT13-Rev | This paper | QPCR primer (amplify Galnt13, M. musculus) | AATTCATCCATCCACACTTCTGC |
| Sequence-based reagent | GalnT14-For | This paper | QPCR primer (amplify Galnt14, M. musculus) | TCTTTCCGAGTGTGGATGTGT |
| Sequence-based reagent | GalnT14-Rev | This paper | QPCR primer (amplify Galnt14, M. musculus) | CCCATCGGGGAAAACATAAGGA |
| Sequence-based reagent | GalnT15-For | This paper | QPCR primer (amplify Galnt15, M. musculus) | CTGCGGTGGCTCTGTTGAAA |
| Sequence-based reagent | GalnT15-Rev | This paper | QPCR primer (amplify Galnt15, M. musculus) | CTGGGATGTGCCTGTAGAAGG |
| Sequence-based reagent | GalnT16-For | This paper | QPCR primer (amplify Galnt16, M. musculus) | TGGTGACCAGCAAATGTCAGA |
| Sequence-based reagent | GalnT16-Rev | This paper | QPCR primer (amplify Galnt16, M. musculus) | TCCGGTCGAAATGTGAGGAG |
| Sequence-based reagent | GalnT18-For | This paper | QPCR primer (amplify Galnt18, M. musculus) | CAGAAGTGCTCGGGACAACA |
| Sequence-based reagent | GalnT18-Rev | This paper | QPCR primer (amplify Galnt18, M. musculus) | TTGGCTCTCCCTCTCAGACT |
| Sequence-based reagent | Galntl5-For | This paper | QPCR primer (amplify Galntl5, M. musculus) | AGTGAGCGCGTGGAATTAAG |
| Sequence-based reagent | Galntl5-Rev | This paper | QPCR primer (amplify Galntl5, M. musculus) | AGATTTGTCCTGTGGTGCGA |
| Sequence-based reagent | Wbscr17-For | This paper | QPCR primer (amplify Wbscr17, M. musculus) | CTTAGGTGCTCTGGGGACCA |
| Sequence-based reagent | Wbscr17-Rev | This paper | QPCR primer (amplify Wbscr17, M. musculus) | TGTACAAGCTGCTCTTGACCT |
| Sequence-based reagent | Galntl6-For | This paper | QPCR primer (amplify Galntl6, M. musculus) | ACCGAGACTAGCAGTTCCCT |
| Sequence-based reagent | Galntl6-Rev | This paper | QPCR primer (amplify Galntl6, M. musculus) | GTCATGCGCTCTGTTTCCAC |
| Sequence-based reagent | Actin beta- For | This paper | QPCR primer (amplify Actb, M. musculus) | GACCTCTAT GCCAACACAGT |
| Sequence-based reagent | Actin beta- Rev | This paper | QPCR primer (amplify Actb, M. musculus) | AGTACTTGC GCTCAGGAGGA |
| Sequence-based reagent | Ins1- For | This paper | QPCR primer (amplify Ins1, R. Norvegicus) | ACCCTAAGTGACCAGCTACA |
| Sequence-based reagent | Ins1-Rev | This paper | QPCR primer (amplify Ins1, R. Norvegicus) | TTCACGACGGGACTTGGG |
| Sequence-based reagent | Gapdh-For | This paper | QPCR primer (amplify Gapdh, R. Norvegicus) | AGTGCCAGCCTCGTCTCATA |
| Sequence-based reagent | Gapdh-Rev | This paper | QPCR primer (amplify Gapdh, R. Norvegicus) | GATGGTGATGGGTTTCCCGT |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/61174/elife-61174-transrepform-v2.docx
-
Reporting standard 1
Check list for the "Reporting guidelines for mass spectrometry".
- https://cdn.elifesciences.org/articles/61174/elife-61174-repstand1-v2.docx
