The mechanism of kinesin inhibition by kinesin-binding protein
- Randall Centre for Cell and Molecular Biophysics, King’s College, United Kingdom
- Institute of Structural and Molecular Biology, Birkbeck, University of London, United Kingdom
- Cell Biology, Neurobiology and Biophysics, Department of Biology, Faculty of Science, Utrecht University, Netherlands
- Laboratory of Biomolecular Research, Division of Biology and Chemistry, Paul Scherrer Institut, Switzerland
- Department of Cancer Biology, Mayo Clinic, United States
- University of Basel, Biozentrum, Switzerland
Figures
Figure 1 with 3 supplements
Kinesin-binding protein (KBP) is a tetratricopeptide repeat (TPR)-containing right-handed α-solenoid.
(a) Model of KBP (ribbon representation) displayed in experimental cryo-electron microscopy density. The N-terminal (olive) and C-terminal (gold) subdomains are separated by a linker region (black). …
Figure 1—figure supplement 1
Kinesin-binding protein (KBP) reconstruction, structure, and loop lengths.
(a) Gold-standard Fourier shell correlation (FSC) curves between independent masked, unmasked, phase-randomised, and corrected half-maps (Chen et al., 2013) of KBP as calculated by RELION v3.1 (Zivan…
Figure 1—figure supplement 2
Kinesin-binding protein (KBP) loops, sequence, inter-species conservation, and experimental mutations.
The human KBP sequence (numbering above), with residues coloured by intra-species sequence identity as indicated in the key. The following species were included in the Clustal Omega multiple …
Figure 1—figure supplement 3
Approximate path of the kinesin-binding protein (KBP) linker loop (LL).
View of KBP’s LL, using the same KBP model subdomain colouring and representation as in Figure 1a and b. Only density for the LL is shown and a rough path for the LL is indicated with a solid black …
Figure 2 with 1 supplement
Kinesin-binding protein (KBP) conformationally adapts to bind KIF15’s motor domain via both subdomains.
(a) Model of the KBP–KIF15_MD6S complex (ribbon representation) displayed in experimental cryo-electron microscopy density. The N-terminal (olive) and C-terminal (gold) subdomains and the linker …
Figure 2—figure supplement 1
Kinesin-binding protein (KBP)–KIF15_MD6S reconstruction resolution estimation and 2D class analysis of KBP–KIF1A_MD and KBP–KIF15_MD complexes.
(a) KIF15_MD6S MT-activated steady-state ATPase velocity plotted as a function of [MT]. Data were fit to a Michaelis–Menten kinetic (pink curve) yielding values for kcat = 2.9 ± 0.5 s−1 and K0.5,MT =…
Figure 3 with 3 supplements
The KIF15 motor domain binds kinesin-binding protein (KBP) via rearrangement of its tubulin-binding subdomain.
(a) The crystallographic model of the KIF15_MD alone (PDB: 4BN2 Klejnot et al., 2014) was superimposed on the KIF15 region of the KBP–KIF15_MD6S complex, with the KIF15 part of the KBP–KIF15_MD6S …
Figure 3—figure supplement 1
KIF15_MD6S adopts a canonical MT-bound kinesin conformation.
(a) Gold-standard Fourier shell correlation (FSC) curves between independent masked, unmasked, phase-randomised, and corrected half-maps (Chen et al., 2013) of the KIF15_MD6S-MT complex as …
Figure 3—figure supplement 2
Movement of Kα4 of the Kin TBsd upon kinesin-binding protein (KBP) binding.
(a) The KIF15_MD alone crystal structure (PDB code:4BN2 Klejnot et al., 2014) is shown coloured by kinesin subdomain (as in Figure 3), fitted into the KBP–KIF15_MD6S complex cryo-electron microscopy …
Figure 3—figure supplement 3
Examples of tetratricopeptide repeat (TPR)-containing α-solenoid proteins binding α-helical SSE ligands.
(a–d) Comparison of (a) kinesin-binding protein (KBP)-KIF15_MD6S complex with other TPR-containing α-solenoids shown in blue, and binding peptide motifs shown in magenta or pink for helical and …
Figure 4 with 1 supplement
Kinesin-binding protein (KBP) binds kinesin MDs via conserved motifs in the α-solenoid edge loops and α-helices at the concave face.
(a) Pseudo-atomic model of the KBP–KIF15_MD6S complex (ribbon representation) displayed in cryo-electron microscopy density, using the same viewpoint as Figure 2a, but with the KIF15_MD6S now …
Figure 4—figure supplement 1
Additional kinesin-binding protein (KBP) α-solenoid edge loops proximal to KIF15_MD6S.
Colouring and representation as in Figure 4. (a) A view showing α-helical pairs αHP1, αHP2, αHP3, αHP8, and αHP9 of KBP and the KIF15_MD6S coloured by subdomain as labelled. (b) Left zoomed region …
Figure 5 with 3 supplements
Disruption of cryo-electron microscopy defined kinesin-binding protein (KBP)–kinesin interface perturbs KBP inhibition of KIF15- and KIF1A-mediated cargo translocation in cells.
(a) Schematic depiction of the inducible peroxisome motility assay, with the kinesin motor domain fused to an FRB domain and PEX fused to an FKBP domain. Addition of rapalog (Rap) links FRB and FKBP …
Figure 5—figure supplement 1
Kinesin-binding protein (KBP) mutants show similar expression profiles in COS-7 cells.
Representative images of COS-7 cells expressing HA–KBP mutant constructs. Scale bar, 10 µm.
Figure 5—figure supplement 2
Pull-down experiments demonstrate the effect of kinesin-binding protein (KBP) mutation on the interaction between KIF15 and KIF1A.
(a) Control pull-down experiment with bioGFP-EV, bioGFP-KIF1A_MDC or bioGFP-KIF15_MDC and HA–KBP showing that KBP interacts with KIF1A_MDC and KIF15_MDC, but not with bioGFP-EV. (b, c) Example of …
Figure 5—figure supplement 3
Kinesin motors show different properties in the peroxisome assay.
(a–c) Representative images of peroxisomes in COS-7 cells expressing KIF1A_MDC (a) or KIF15_MDC–FRB (b, c), PEX–mRFP–FKBP and HA (left panels) with addition of rapalog. Images were thresholded at …
Figure 6
Conserved motifs in kinesin-binding protein (KBP)-binding kinesin MDs.
(a) Sequence alignment of the tubulin-binding subdomain from kinesin motor domains, made using Clustal Omega multiple sequence alignment (Sievers et al., 2011). Residues are coloured according to …
Author response image 1
KIF15 localizes on microtubules in the peroxisome motility assay.
(a, b) Representative images of COS-7 cells expressing KIF15_MDC–HA–FRB and PEX–mRFP–FKBP treated with rapalog for three hours and co-stained for (a) microtubules (rabbit anti-α-tubulin, 1:1000, …
Author response image 2
Overview of pull-down experimental data.
Pull-down experiments showing the interaction between (a) KIF15_MDC or (b) KIF1A_MDC and mutated KBP constructs in HEK293T cell lysates. Two individual experiments for each pull-down are shown. …
Videos
Video 1
Kinesin-binding protein (KBP) undergoes conformational change to relieve clashes when forming a complex with KIF15_MD6S.
The KBP-alone model was superimposed on the KBP–KIF15_MD6S model using UCSF Chimera’s matchmaker (Pettersen et al., 2004). A conformational morph movie was then generated in Chimera between the …
Video 2
Interaction of kinesin-binding protein (KBP) with the KIF15 motor domain.
Model of the KBP–KIF15_MD6S complex (ribbon representation) displayed in experimental cryo-electron microscopy density. The N-terminal (olive) and C-terminal (gold) subdomains and the linker region …
Tables
Table 1
Cryo-electron microscopy reconstruction information and model refinement statistics and model geometry.
Data collection, processing, and model refinement information for the kinesin-binding protein (KBP), KBP–KIF15_MD6S, and KIF15_MD6S–MT datasets.
| KBP (EMDB: EMD-11338, PDB: 6ZPG) | KBP–KIF15_MD6S (EMDB: EMD-11339, PDB: 6ZPH) | KIF15_MD6S–MT (EMDB: EMD-11340, PDB: 6ZPI) | |
|---|---|---|---|
| Data collection and processing | |||
| Pixel size (Å)* | 1.055, 1.043, or 1.047 | 1.047 | 1.39 |
| Number of micrographs (collected, final)* | 9360, 7547 | 6497, 5138 | 214,202 |
| Final particle number | 258,049 (81,628 of which on graphene oxide) | 7513 | 12,674 |
| Map resolution (Å) FSC threshold† | 4.6 Independent half-map FSC 0.143 | 6.9 Independent half-map FSC 0.143 | 4.5 Independent half-map FSC 0.143 |
| Refinement | |||
| Refinement resolution (Å) CC_mask‡ | 4.6 0.64 | 6.9 0.74 | 6 0.60 |
| Map sharpening B-factor (Å2) | −200 | −495 | −134 |
| Model composition Nonhydrogen atoms Protein residues Ligands | 3808 610 0 | 6232 948 1 | 9420 1185 4 |
| R.m.s. deviations§ Bond lengths (Å) Bond angles (°) | 0.01 0.96 | 0.01 1.07 | 0.08 0.17 |
| Validation# MolProbity score Clashscore Poor rotamers (%) | 1.66 5.25 0.5% | 1.84 7.31 0.9% | 1.95 13.25 0.1% |
| Ramachandran plot# Favoured (%) Allowed (%) Outliers (%) | 94.38 5.62 0 | 93.13 6.87 0 | 95.38 4.62 0 |
-
*Inclusive of all data collection sessions.
†The resolution value at the gold-standard Fourier Shell Correlation (FSC) 0.143 criterion between independently refined half-maps.
-
‡Cross-correlation provided by Phenix real-space refine (Afonine et al., 2018).
§Root-mean-square deviations of bond lengths or angles in the model.
-
#As defined by the MolProbity validation server (Chen et al., 2010).
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | KIAA1279 | GenBank | HGNC:23419 | |
| Gene (Mus musculus) | KIF1A | GenBank | MGI:108391 | |
| Gene (Mus musculus) | KIF15 | GenBank | MGI:1098258 | |
| Strain, strain background (Escherichia coli) | BL21(DE3) | NEB | Cat. #: C2527H | Competent cells |
| Strain, strain background (Escherichia coli) | BL21-Gold (DE3) | Agilent | Cat. #: 230130 | Competent cells |
| Strain, strain background (Escherichia coli) | Rosetta2 (DE3) | Novagen | Cat. #: 71400 | Competent cells |
| Cell line (Homo sapiens) | Human embryonic kidney 239T (HEK293T) | ATCC | CRL-3216 RRID:CVCL_0063 | |
| Cell line (Cercopithecus aethiops) | Cercopithecus aethiops kidney (COS-7) | ATCC | CRL-1651 RRID:CVCL_0224 | |
| Peptide, recombinant protein | Porcine tubulin (>99% pure) | Cytoskeleton Inc | Cat. #: T240 | |
| Antibody | Anti-HA (mouse monoclonal) | Roche | Cat# 11666606001; RRID:AB_514506 | IF (1:500) |
| Antibody | Anti-mouse IgG1, Alexa488 (goat polyclonal) | Thermo Fisher Scientific | Cat# A-21121, RRID:AB_2535764 | IF (1:400) |
| Antibody | Anti-HA (mouse monoclonal) | Biolegend | Cat# 901533; RRID:AB_2801249 | WB (1:2000) |
| Antibody | Anti-GFP (rabbit polyclonal) | Abcam | Cat# ab290; RRID:AB_303395 | WB (1:10000) |
| Antibody | Anti-rabbit IgG antibody, IRDye 680LTconjugated (goat polyclonal) | LI-COR Biosciences | Cat# 827–11081; RRID:AB_10795015 | WB (1:20000) |
| Antibody | Anti-mouse IgG antibody, IRDye 800CWconjugated (goat polyclonal) | LI-COR Biosciences | Cat# 827–08364; RRID:AB_10793856 | WB (1:15000) |
| Recombinant DNA reagent | KBP (plasmid) | Kevenaar et al., 2016 | Described in Materials and methods | |
| Recombinant DNA reagent | KIF1A_MD (plasmid) | Atherton et al., 2014 | Described in Materials and methods | |
| Recombinant DNA reagent | KIF15_MD (plasmid) | This study | Described in Materials and methods | |
| Recombinant DNA reagent | pebioGFP (plasmid) | van der Vaart et al., 2013 | N/A | Described in Materials and methods |
| Recombinant DNA reagent | BirA coding vector (plasmid) | van der Vaart et al., 2013 | N/A | Described in Materials and methods |
| Recombinant DNA reagent | GW1–PEX3–mRFP–FKBP1 (plasmid) | Kevenaar et al., 2016 | N/A | Described in Materials and methods |
| Recombinant DNA reagent | β-actin–Kif1A_MDC–FRB (plasmid) | Kevenaar et al., 2016 | N/A | Described in Materials and methods |
| Recombinant DNA reagent | β-actin–Kif15_MDC–FRB (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pebioGFP-Kif1A_MDC (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pebioGFP-Kif15_MDC (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L1 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L3 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L5 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L10 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L12 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L14 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L16 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L18 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L10+L12 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L10+L14 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_L12+L14 (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_αHP4a (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_αHP4b (plasmid) | This study | N/A | Described in Materials and methods |
| Recombinant DNA reagent | pGW1–HA–KBP_αHP5a (plasmid) | This study | N/A | Described in Materials and methods |
| Sequence-based reagent | KBP_fwd | This study | PCR primer for KBP mutants | TATTATTATGGCGCGCCAGGATCCCCGGAATTCGGCACGAGGGAGGCCGCTATGGCGAACGTTCCGTGGGCA |
| Sequence-based reagent | KBP_rev | This study | PCR primer for KBP mutants | CTCGTCGACTCCTAATCCTTAAGTCAGGGCCATCTT |
| Sequence-based reagent | KBP_L1_fwd | This study | PCR primer for KBP_L1 | CTGCATAAAAATCCGGCAGCAGCACCAGCAGCATCCAAATACAGCGCC |
| Sequence-based reagent | KBP_L1_rev | This study | PCR primer for KBP_L1 | GGCGCTGTATTTGGATGCTGCTGGTGCTGCTGCCGGATTTTTATGCAG |
| Sequence-based reagent | KBP_L3_fwd | This study | PCR primer for KBP_L3 | TGAACCACATCGACGCAGGAGGACTGTCGGCGGGGGA |
| Sequence-based reagent | KBP_L3_rev | This study | PCR primer for KBP_L3 | TCCCCCGCCGACAGTCCTCCTGCGTCGATGTGGTTCA |
| Sequence-based reagent | KBP_L5_fwd | This study | PCR primer for KBP_L5 | ATCTTGTGGTCTGAAGCAGGAGCAATTGAAACTGCACAG |
| Sequence-based reagent | KBP_L5_rev | This study | PCR primer for KBP_L5 | CTGTGCAGTTTCAATTGCTCCTGCTTCAGACCACAAGAT |
| Sequence-based reagent | KBP_L10_fwd | This study | PCR primer for KBP_L10 | TTTGGTCAAACTGGAGCAGGAGCAGGAGCAGGAGCAGGACCAGCAGGAGCAGGAGCAGGACCAGGAGGATATCATCAAAGAAA |
| Sequence-based reagent | KBP_L10_rev | This study | PCR primer for KBP_L10 | TTTCTTTGATGATATCCTCCTGGTCCTGCTCCTGCTCCTGCTGGTCCTGCTCCTGCTCCTGCTCCTGCTCCAGTTTGACCAAA |
| Sequence-based reagent | KBP_L12_fwd | This study | PCR primer for KBP_L12 | GAGTTCTTTCAGATTGGCGGCGCGGTCACTGACCATATT |
| Sequence-based reagent | KBP_L12_rev | This study | PCR primer for KBP_L12 | AATATGGTCAGTGACCGCGCCGCCAATCTGAAAGAACTC |
| Sequence-based reagent | KBP_L14_fwd | This study | PCR primer for KBP_L14 | TAGAGCCCCTAACTGTAGCAGCAGGACCAGCAGCATATCTGTTGGTCAAC |
| Sequence-based reagent | KBP_L14_rev | This study | PCR primer for KBP_L14 | GTTGACCAACAGATATGCTGCTGGTCCTGCTGCTACAGTTAGGGGCTCTA |
| Sequence-based reagent | KBP_L16_fwd | This study | PCR primer for KBP_L16 | TCCCTGAGAGACCCAGCAGCAGGAGCACCAGCAGGAGCAGGAGCAGGAGCAGCACGCCCTGCCATGTTA |
| Sequence-based reagent | KBP_L16_rev | This study | PCR primer for KBP_L16 | TAACATGGCAGGGCGTGCTGCTCCTGCTCCTGCTCCTGCTGGTGCTCCTGCTGCTGGGTCTCTCAGGGA |
| Sequence-based reagent | KBP_L18_fwd | This study | PCR primer for KBP_L18 | ATTGTTGATTACTGTGCAGCAGGACCAGGAGCCGCCCAGGAAATA |
| Sequence-based reagent | KBP_L18_rev | This study | PCR primer for KBP_L18 | TATTTCCTGGGCGGCTCCTGGTCCTGCTGCACAGTAATCAACAAT |
| Sequence-based reagent | KBP_HP4a_fwd | This study | PCR primer for KBP_L HP4a | ACTCATAACCTATATGCACTAGCTGCAGTCTACCAGCATCTG |
| Sequence-based reagent | KBP_L HP4a _rev | This study | PCR primer for KBP_ HP4a | CAGATGCTGGTAGACTGCAGCTAGTGCATATAGGTTATGAGT |
| Sequence-based reagent | KBP_HP4b_fwd | This study | PCR primer for KBP_L HP4b | AGTACACTAAAACGCGCACTTGAGCACAATGCC |
| Sequence-based reagent | KBP_L HP4b _rev | This study | PCR primer for KBP_ HP4b | GGCATTGTGCTCAAGTGCGCGTTTTAGTGTACT |
| Sequence-based reagent | KBP_HP5a_fwd | This study | PCR primer for KBP_L HP5a | GCTATCAATGCTGCTGCGTTGTCAGCGTTTTACATCAATAAG |
| Sequence-based reagent | KBP_ HP5a _rev | This study | PCR primer for KBP_ HP5a | CTTATTGATGTAAAACGCTGACAACGCAGCAGCATTGATAGC |
| Sequence-based reagent | KIF15_FRB_fwd | This study | PCR primer for KIF15–FRB | AAGCTTGCCACCATGGGCGCGCCTGCCACCATGGCTCCTGGCTGCAAATCT |
| Sequence-based reagent | KIF15_FRB_rev | This study | PCR primer for KIF15–FRB | AGAGGATTCTAGAAGCAGGCGCGCCAGCGTAGTCTGGGACGTCGTATGGGTAGAATTCTCCTGGTGTCAGCTGCCCAGA |
| Sequence-based reagent | bioGFPKIF15 _fwd | This study | PCR primer for bioGFPKIF15 | AGCTCAAGCTTCGAATTGGGCGCGCCAGCCACCATGGCTCCTGGCTGCAAATCT |
| Sequence-based reagent | bioGFPKIF15_rev | This study | PCR primer for bioGFPKIF15 | GAATTCGATATCCTGCAGGTCGACTCCAGATCCTCATCCTGGTGTCAGCTGCCCAGA |
| Sequence-based reagent | bioGFPKIF1A _fwd | This study | PCR primer for bioGFPKIF1A | TATTATAATGGCGCGCCAGCCACCGCCGGGGCCTCTGTGAAGGT |
| Sequence-based reagent | bioGFPKIF1A_rev | This study | PCR primer for bioGFPKIF1A | CTCGTCGACTCCTCCTCCTCATTTGGGAGAAAACACACCCAA |
| Commercial assay or kit | EnzChek Phosphate Assay Kit | Invitrogen | E6646 | |
| Chemical compound, drug | AP21967 | TaKaRa | Cat# 635057 | 1 µM |
| Chemical compound, drug | PEI | PolySciences | Cat# 24765–2 | |
| Chemical compound, drug | Fugene | Promega | Cat# E2692 | |
| Software, algorithm | ImageJ | NIH | https://imagej.nih.gov/ij/; RRID:SCR_003070 | |
| Software, algorithm | RELION | Zivanov et al., 2018 | n/a | |
| Software, algorithm | CryoSparc2 | Punjani et al., 2017 | n/a | |
| Software, algorithm | CisTEM | Grant et al., 2018 | n/a | |
| Software, algorithm | MiRP | Cook et al., 2020 | n/a | Protocol implemented in RELION |
Table 2
Kinesin-binding protein (KBP) mutants used in this study.
The original and mutated amino acid (top) and nucleotide sequences (bottom) are shown for each construct.
| Construct | Original sequence | Mutated to |
|---|---|---|
| L1 | EKEPYK gagaaggaaccatacaag | AAAPAA gcagcagcaccagcagca |
| L3 | TEE acggaggag | AGG gcaggagga |
| L5 | REE agagaagaa | AGA gcaggagca |
| L10 | KISATEDTPEAEGEVPEL aagatctcagccacagaagacactcctgaagctgaaggagaagtgccagagctt | AGAGAGAGPAGAGAGPGG gcaggagcaggagcaggagcaggaccagcaggagcaggagcaggaccaggagga |
| L12 | DGY gatggttat | GGA ggcggcgcg |
| L14 | DLNPQY gacctgaatccacagtat | AAGPAA gcagcaggaccagcagca |
| L16 | NKVFPEHIGEDVL aataaagtattccctgagcatataggggaagatgttctt | AAGAPAGAGAGAA gcagcaggagcaccagcaggagcaggagcaggagcagca |
| L18 | EKHPE gaaaagcatcctgag | AAGPG gcagcaggaccagga |
| αHP4a | YLAQ tacctagctcaa | ALAA gcactagctgca |
| αHP4b | Q cag | A gca |
| αHP5a | TLSQ accttgtcacag | ALSA gcgttgtcagcg |
