Epidermal PAR-6 and PKC-3 are essential for larval development of C. elegans and organize non-centrosomal microtubules
- Division of Developmental Biology, Institute of Biodynamics and Biocomplexity, Department of Biology, Faculty of Science, Utrecht University, Netherlands
Figures
Figure 1 with 1 supplement
PAR-6 and PKC-3 are essential for larval development.
(A) Overview of the AID system, which enables targeted degradation of AID-tagged proteins by the plant-derived E3 ubiquitin ligase specificity factor TIR1 upon addition of auxin. (B) Schematic …
-
Figure 1—source data 1
Source data for Figure 1.
This zip archive contains the data graphed in panels C–E, and the microscopy images shown in panel G. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig1-data1-v2.zip
Figure 1—figure supplement 1
Isoform-specific expression pattern of PAR-3.
(A, B) Schematic representation of endogenous tagging of par-3 isoforms with sequences encoding a green fluorescent protein (GFP) and auxin-inducible degradation degron (AID) tag. (C) Graphical …
-
Figure 1—figure supplement 1—source data 1
Source data for Figure 1—figure supplement 1.
This zip archive contains the microscopy images shown in panels D and E. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig1-figsupp1-data1-v2.zip
Figure 2 with 1 supplement
PAR-6 and PKC-3 are essential in the epidermis to support larval growth.
(A, B) Distribution of PAR-6::AID::GFP and GFP::AID::PKC-3 in the intestine (A) and epidermis (B) in absence (- auxin) or presence (+ auxin) of 1 mM auxin for 1 hr. Images are maximum intensity …
-
Figure 2—source data 1
Source data for Figure 2.
This zip archive contains the microscopy images shown in panel A and B, and the data graphed in panels C–J. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig2-data1-v2.zip
Figure 2—figure supplement 1
PKC-3 does not act redundantly with PAR-6 in the C. elegans intestine.
Growth curves of N2, par-6::aid::gfp, gfp::aid::pkc-3, and par-6::aid::gfp; gfp::aid::pkc-3 (double depletion) animals in absence (- aux) or presence (+ aux) of 4 mM auxin from hatching. Data of …
-
Figure 2—figure supplement 1—source data 1
Source data for Figure 2—figure supplement 1.
This zip archive contains the data graphed in the figure. The raw graph data is in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig2-figsupp1-data1-v2.zip
Figure 3 with 2 supplements
PAR-6 and PKC-3 are required in the epidermis for molting and seam-cell development.
(A) DIC microscopy images of molting defects upon epidermal depletion of PAR-6 or PKC-3. Animals were grown in absence (-auxin) or presence (+auxin) of 1 mM auxin from hatching, and images were …
-
Figure 3—source data 1
Source data for Figure 3.
This zip archive contains the microscopy images shown in panels A, B, and D, and the data graphed in panel C. The images are in Adobe Photoshop format. The Photoshop file contains the original unadjusted image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig3-data1-v2.zip
Figure 3—figure supplement 1
Effect of PAR-6 epidermal degradation on canal outgrowth.
(A) Schematic drawing of the excretory canal system in an L2 animal. Green indicates localization of PAR-6. (B) Quantification of excretory canal outgrowth in L1 and L2 animals. One anterior and one …
-
Figure 3—figure supplement 1—source data 1
Source data for Figure 3—figure supplement 1.
This zip archive contains the data graphed in B. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig3-figsupp1-data1-v2.zip
Figure 3—figure supplement 2
Hypodermal expression of PAR-6 is necessary for larval development.
(A) DIC microscopy images of par-6::aid::gfp; Pwrt-2::tir-1::bfp animals carrying (Pdpy-7::par-6::mCherry) or lacking (Control) an extrachromosomal array expressing PAR-6 in the hypodermis. Worms …
-
Figure 3—figure supplement 2—source data 1
Source data for Figure 3—figure supplement 2.
This zip archive contains the microscopy images shown in panels A, C, and E, and the data graphed in panels B, D, and F. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale image (A) or the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack (C and E). The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig3-figsupp2-data1-v2.zip
Figure 4 with 2 supplements
PKC-3 excludes LGL-1 from the apical cortex and, together with PAR-6, regulates junctions.
(A, B) Distribution and quantification of LGL-1::GFP in the epidermis of lgl-1::gfp animals without auxin and in lgl-1::gfp; gfp::aid::pkc-3; Pwrt-2::tir-1::bfp animals in the presence of 4 mM auxin …
-
Figure 4—source data 1
Source data for Figure 4.
This zip archive contains the microscopy images shown in panels A, C, E, and F, and the data graphed in panels B, D. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig4-data1-v2.zip
Figure 4—figure supplement 1
PAR-6 and PKC-3 are not essential for LGL-1 localization or junction maintenance in the larval intestine.
(A) Distribution of LGL-1::GFP, in lgl-1::gfp animals without auxin and in lgl-1::gfp; gfp::aid::pkc-3; Pelt-2::tir-1::bfp animals in presence of 4 mM auxin from hatching. Images are maximum …
-
Figure 4—figure supplement 1—source data 1
Source data for Figure 4—figure supplement 1.
This zip archive contains the microscopy images shown in panels A and B. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig4-figsupp1-data1-v2.zip
Figure 4—figure supplement 2
Localization dependencies of PAR-6 and, PKC-3.
Left panels are of animals not exposed to auxin, right panels are of animals exposed to 1 mM auxin for 1 hr. (A, B) Distribution and quantification of mCherry::PKC-3 upon intestinal depletion of …
-
Figure 4—figure supplement 2—source data 1
Source data for Figure 4—figure supplement 2.
This zip archive contains the microscopy images and the data graphed in panels A–D. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig4-figsupp2-data1-v2.zip
Figure 5
PAR-6 and PKC-3 control microtubule organization in the C.elegans epidermis.
(A) Actin organization visualized by the Plin-26::ABDvab-10::mCherry reporter in par-6::aid::gfp animals in absence (- auxin) or presence (+ auxin) of 1 mM auxin for 24 hr. Images are maximum …
-
Figure 5—source data 1
Source data for Figure 5.
This zip archive contains the microscopy images shown in panels A, C, and E, and the data graphed in panels B, D, F, G, and H. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig5-data1-v2.zip
Figure 6 with 1 supplement
PAR-6 promotes the localization of its binding partner NOCA-1, as well as of GIP-1 and PTRN-1.
(A, B) Distribution and quantification of NOCA-1de::GFP in the epidermis of noca-1de::gfp animals without auxin, and noca-1de::gfp; par-6::aid::gfp; Pwrt-2::tir-1::bfp animals in the presence of 4 …
-
Figure 6—source data 1
Source data for Figure 6.
This zip archive contains the microscopy images shown in panels A, C, E, G, and I, and the data graphed in panels B, D, F, H, and J. The images are in TIFF and Adobe Photoshop format. The TIFF file is the unadjusted grayscale maximum intensity projection image generated in ImageJ from an image stack. The Photoshop file contains the original image with the adjustment layers used to arrive at the final image displayed in the main figure. The raw graph data are in Microsoft Excel format, and the summary data and actual graph in Graphpad Prism format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig6-data1-v2.zip
Figure 6—figure supplement 1
Interaction of PAR-6 and NOCA-1 in the yeast two-hybrid system.
The PAR-6 PDZ domain fused to the Gal4 DNA binding domain was co-expressed with full-length NOCA-1 fused to the Gal4 activation domain. Growth on -Leu -Trp -His + 2 mM 3-AT, and on -Leu -Trp -Ade …
-
Figure 6—figure supplement 1—source data 1
Source data for Figure 6—figure supplement 1.
This zip archive contains the uncropped TIFF images of the yeast growth on the three types of selective plates.
- https://cdn.elifesciences.org/articles/62067/elife-62067-fig6-figsupp1-data1-v2.zip
Videos
Video 1
Time-lapse imaging of PAR-6::AID::GFP and PKC-3::mCherry in animals expressing intestine-specific TIR1 upon addition of 1 mM Auxin.
Video 2
Time-lapse imaging of EBP-2::GFP in control animals and PAR-6 depleted animals.
Freeze frame circles EBP-2 comets as an example of quantification. Final frames show a time projection as displayed in Figure 5E.
Video 3
Dual-color time-lapse imaging of EBP-2::mKate2 and MAPH-1.1::GFP.
New microtubules largely grow along existing bundles.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background(C. elegans) | BOX289 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; ieSi57[eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II | |
| Strain, strain background(C. elegans) | BOX570 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; ieSi57[eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II | |
| Strain, strain background(C. elegans) | BOX292 | This paper | ieSi57[eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II; par-3(mib68[eGFP-Lox2272::AID::par-3b+eGFP(noIntrons)-LoxP::AID::par-3g]) III | |
| Strain, strain background(C. elegans) | BOX276 | This paper | par-3b(mib65[eGFP-Lox2272::AID::par-3b]) III | |
| Strain, strain background(C. elegans) | BOX667 | This paper | par-3(mib68[eGFP-Lox2272::AID::par-3b+eGFP(noIntrons)-LoxP::AID::par-3g]) III; ieSi64 [gld-1p::TIR1::mRuby::gld-1 3’UTR + Cbr-unc-119(+)] II | |
| Strain, strain background(C. elegans) | BOX409 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX607 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX444 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs48[Pelt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX285 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs48[Pelt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX506 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X; mgIs49[mlt-10::gfp-pest] | |
| Strain, strain background(C. elegans) | BOX412 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; heIs63[Pwrt-2::GFP::PH, Pwrt-2::GFP::H2B, Plin-48::mCherry]V | |
| Strain, strain background(C. elegans) | BOX490 | This paper | ouIs10[Pscm::NLS::tdTomato(pAW584)+Pwrt2::GFP::PH(pAW561)+Pdpy-7::2xNLS::YFP(pAW516)] I; par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX041 | This paper | mibIs23 [lgl-1::GFP-2TEV-Avi 10 ng + Pmyo-3::mCherry 10 ng + lambda DNA 60 ng] V | |
| Strain, strain background(C. elegans) | BOX553 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; mibIs23 [lgl-1::GFP-2TEV-Avi 10 ng + Pmyo-3::mCherry 10 ng + lambda DNA 60 ng] V | |
| Strain, strain background(C. elegans) | BOX554 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; par-1(it324[par-1::gfp::par-1 exon 11a]) | |
| Strain, strain background(C. elegans) | BOX493 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X | |
| Strain, strain background(C. elegans) | BOX402 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X | |
| Strain, strain background(C. elegans) | BOX494 | This paper | mcIs40 [Plin-26::ABDvab-10::mCherry + Pmyo-2::GFP]; par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; heIs63[Pwrt-2::GFP::PH, Pwrt-2::GFP::H2B, Plin-48::mCherry] V | |
| Strain, strain background(C. elegans) | BOX483 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; maph-1.1(mib12[egfp::maph-1.1]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X | |
| Strain, strain background(C. elegans) | BOX505 | This paper | maph-1.1(mib12[egfp::maph-1.1]) I; pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X | |
| Strain, strain background(C. elegans) | BOX592 | This paper | maph-1.1(mib12[egfp::maph-1.1]) I; noca-1(ok3692)V/nT1[qIs51](IV;V) | |
| Strain, strain background(C. elegans) | BOX658 | This paper | maph-1.1(mib12)I; par-6(mib24[par-6::egfp-loxp] I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)]) IV; noca-1(ok3692)V/nT1[qIs51](IV;V) | |
| Strain, strain background(C. elegans) | BOX487 | This paper | par-6(mib25[par-6::mCherry-LoxP]) I; ebp-2(he293[ebp-2::egfp]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX580 | This paper | ebp-2(he293[ebp-2::egfp]) II; noca-1(ok3692)V/nT1[qIs51](IV;V) | |
| Strain, strain background(C. elegans) | BOX659 | This paper | par-6(mib24[par-6::egfp-loxp] I; ebp-2(he293[ebp-2::egfp]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)]) IV; noca-1(ok3692)V/nT1[qIs51](IV;V) | |
| Strain, strain background(C. elegans) | BOX567 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; ltSi540[pOD1343/pSW160; Pnoca-1de::noca-1de::sfGFP; cb-unc-119(+)]II; unc-119(ed3)III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX355 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; ltSi540[pOD1343/pSW160; Pnoca-1de::noca-1de::sfGFP; cb-unc-119(+)]II; unc-119(ed3)III; ieSi57[eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II | |
| Strain, strain background(C. elegans) | BOX568 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; gip-1(wow25[tagRFP-t::3xMyc::gip-1]) III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX502 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X; ptrn-1(wow4[PTRN-1::GFP]) X | |
| Strain, strain background(C. elegans) | BOX657 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; Pnoca-1de::noca-1de::superfolderGFP; cb-unc-119(+)II; unc-119(ed3)III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX579 | This paper | gip-1(wow25[tagRFP-t::3xMyc::gip-1]) III; noca-1(ok3692)V/nT1[qIs51](IV;V) | |
| Strain, strain background(C. elegans) | BOX561 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; mibEx221(Pdpy-7::par-6::mch) | |
| Strain, strain background(C. elegans) | BOX563 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; heIs63[Pwrt-2::GFP::PH, Pwrt-2::GFP::H2B, Plin-48::mCherry] V; mibEx222(Pdpy-7::par-6::mch; Pmyo-2::egfp) | |
| Strain, strain background(C. elegans) | BOX608 | This paper | pw27[nekl-2::aid];pwSi10[phyp7::bfp::tir-1];pw17[chc-1::GFP]; mibEx223(Pwrt-2::mCh::H2B; Pwrt-2::mCh::PH) | |
| Strain, strain background(C. elegans) | BOX447 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs48[Pelt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; mibIs23 [lgl-1::GFP-2TEV-Avi 10 ng + Pmyo-3::mCherry 10 ng + lambda DNA 60 ng] V | |
| Strain, strain background(C. elegans) | BOX431 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; mibIs48[Pelt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV; dlg-1(mib23[dlg-1::mCherry-LoxP]) X | |
| Strain, strain background(C. elegans) | BOX406 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; pkc-3(mib80[mcherry-loxp::pkc-3]) II; mibIs48[Pelt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX653 | This paper | par-6(mib24[par-6::egfp-loxp] I; pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs48[Pelt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)]) IV | |
| Strain, strain background(C. elegans) | BOX411 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; pkc-3(mib80[mcherry-loxp::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX578 | This paper | par-6(mib30[par-6::aid::egfp-loxp]) I; par-3(it300[par-3::mcherry]) III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX484 | This paper | par-6(mib25[par-6::mCherry-LoxP]) I; pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX485 | This paper | pkc-3(mib78[egfp-loxp::aid::pkc-3]) II; par-3(it300[par-3::mcherry]) III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX486 | This paper | par-6(mib25[par-6::mCherry-LoxP]) I; par-3(mib68[eGFP-Lox2272::AID::par-3b+eGFP(noIntrons)-LoxP::AID::par-3g]) III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | BOX492 | This paper | pkc-3(it309[GFP::pkc-3]) II; par-3(mib68[eGFP-Lox2272::AID::par-3b+eGFP(noIntrons)-LoxP::AID::par-3g]) III; mibIs49[Pwrt-2::TIR-1::tagBFP2-Lox511::tbb-2–3'UTR, IV:5014740–5014802 (cxTi10882 site)] IV | |
| Strain, strain background(C. elegans) | AW1015 | Hughes et al., 2014 | RRID:WB-STRAIN:WBStrain00042230 | ouIs10[Pscm::NLS::tdTomato(pAW584)+Pwrt2::GFP::PH(pAW561)+Pdpy-7::2xNLS::YFP(pAW516)] I |
| Strain, strain background(C. elegans) | BOX188 | Waaijers et al., 2016 | maph-1.1(mib12[egfp::maph-1.1]) I | |
| Strain, strain background(C. elegans) | CA1200 | CGC | RRID:WB-STRAIN:WBStrain00004055 | ieSi57[eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II; unc-119(ed3) III |
| Strain, strain background(C. elegans) | GR1395 | Hayes et al., 2006 | RRID:WB-STRAIN:WBStrain00007913 | mgIs49 [mlt-10::GFP-pest; ttx-1::GFP] |
| Strain, strain background(C. elegans) | JLF15 | Jessica Feldman | ptrn-1(wow4[PTRN-1::GFP]) X | |
| Strain, strain background(C. elegans) | JLF173 | Jessica Feldman | gip-1(wow25[tagRFP-t::3xMyc::gip-1]) III | |
| Strain, strain background(C. elegans) | KK1218 | CGC | RRID:WB-STRAIN:WBStrain00023582 | par-3(it300[par-3::mCherry]) III |
| Strain, strain background(C. elegans) | KK1228 | CGC | RRID:WB-STRAIN:WBStrain00023583 | pkc-3(it309[GFP::pkc-3]) II |
| Strain, strain background(C. elegans) | KK1262 | CGC | RRID:WB-STRAIN:WBStrain00023586 | par-1 (it324[par-1::gfp::par-1 exon 11a]) |
| Strain, strain background(C. elegans) | ML916 | CGC | RRID:WB-STRAIN:WBStrain00026581 | mcIs40 [Plin-26::ABDvab-10::mCherry + Pmyo-2::GFP] |
| Strain, strain background(C. elegans) | OD1652 | Karen Oegema | RRID:WB-STRAIN:WBStrain00044359 | ltSi540[pOD1343/pSW160; Pnoca-1de::noca-1de::sfGFP; cb-unc-119(+)]II; unc-119(ed3)III |
| Strain, strain background(C. elegans) | RT3638 | David Fay | pw27[nekl-2::aid];pwSi10[phyp7::bfp::tir-1];pw17[chc-1::GFP] | |
| Strain, strain background(C. elegans) | SV1009 | Wildwater et al., 2011 | RRID:WB-STRAIN:WBStrain00034608 | heIs63[Pwrt-2::GFP::PH, Pwrt-2::GFP::H2B, Plin-48::mCherry]V |
| Strain, strain background(C. elegans) | SV1937 | Sander van den Heuvel | ebp-2(he293[ebp-2::egfp]) II | |
| Strain, strain background(C. elegans) | VC2998 | CGC | RRID:WB-STRAIN:WBStrain00037614 | noca-1(ok3692)V/nT1[qIs51](IV;V) |
| Strain, strain background(C. elegans) | CA1352 | RRID:WB-STRAIN:WBStrain00004071 | ieSi64 [gld-1p::TIR1::mRuby::gld-1 3’UTR + Cbr-unc-119(+)] II | |
| Strain, strain background(C. elegans) | STR320 | Martin Harterink | maph-1.1(mib15[GFPKI]);hrtEx110[Pptrn-1::ebp-2::mKate2; Pmyo-2::tdTom] | |
| Recombinant DNA reagent | Plasmid: pJJR82 | Addgene | #75027 | EGFP^SEC^3xFlag vector with ccdB markers for cloning homology arms |
| Recombinant DNA reagent | Plasmid: pJJR83 | Addgene | #75028 | mCherry^SEC^3xFlag vector with ccdB markers for cloning homology arms |
| Recombinant DNA reagent | Plasmid: pMLS257 | Addgene | #73716 | SapTrap destination vector for building repair template only vectors |
| Recombinant DNA reagent | Plasmid: pDD379 | Addgene | #91834 | SapTrap destination vector for building combined sgRNA expression + repair template vectors, using the F+E sgRNA scaffold |
| Recombinant DNA reagent | Plasmid: pJJR50 | Addgene | #75026 | U6 promoter driven flipped + extended sgRNA expression vector |
| Recombinant DNA reagent | Plasmid: Peft-3::cas9 | Addgene | #46168 | codon optimized Cas9_SV40 NLS with intron |
| Recombinant DNA reagent | Plasmid: Pdpy-7::par-6::mCherry | This paper | Plasmid for expression of PAR-6::mCherry in the hypodermis (Figure 3—figure supplement 2). Full sequence in Supplementary file 1. | |
| Recombinant DNA reagent | Plasmid: PAR-6 PDZ in pMB28 | This paper | Yeast expression plasmid of PAR-6 PDZ fused to Gal4 DNA binding domain (Figure 6—figure supplement 1). Full sequence in Supplementary file 1. | |
| Recombinant DNA reagent | Plasmid: NOCA-1d in pMB29 | This paper | Yeast expression plasmid of NOCA-1d fused to Gal4 activation domain (Figure 6—figure supplement 1). Full sequence in Supplementary file 1. | |
| Sequence-based reagent | par-6 sgRNA | gacgcaaatgacagtgatagTGG | sgRNA target site used to engineer the par-6 locus. PAM site in uppercase. | |
| Sequence-based reagent | pkc-3 sgRNA | tgggtctccgacatcattagAGG | sgRNA target site used to engineer the pkc-3 locus. PAM site in uppercase. | |
| Sequence-based reagent | par-3 sgRNA 1 | tttcagatcgatcatcatgtCGG | sgRNA target site used to target the par-3 locus. PAM site in uppercase. | |
| Sequence-based reagent | par-3 sgRNA 2 | cacatgcataacggtcgtggTGG | sgRNA target site used to target the par-3 locus. PAM site in uppercase. | |
| Sequence-based reagent | dlg-1 sgRNA | gccacgtcattagatgaaatTGG | sgRNA target site used to target the dlg-1 locus. PAM site in uppercase. | |
| Sequence-based reagent | mos IV 5013690.5015700 sgRNA | agctcaatcgtgtacttgcgTGG | sgRNA target site for LG IV position 5013690.5015700, used to insert TIR-1 expression cassette. PAM site in uppercase. | |
| Sequence-based reagent | ebp-2 sgRNA 1 | gcaggcaaatctggacgataCGG | sgRNA target site used to edit the ebp-2 locus. | |
| Sequence-based reagent | ebp-2 sgRNA 2 | tacggggataggataagcaaTGG | sgRNA target site used to edit the ebp-2 locus. | |
| Sequence-based reagent | Pdpy-7_F | This paper | PCR primers | TGTAATACGACTCACTATAGGGCGAATTGGctcattccacgatttctcgc. See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | Pdpy-7_R | This paper | PCR primers | tctggaacaaaatgtaagaatattc See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | par-6_F1 | This paper | PCR primers | tttaagaatattcttacattttgttccagaATGTCCTACAACGGCTCCTA See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | par-6_R1 | This paper | PCR primers | GGCCATGTTGTCCTCCTCTCCCTTGGACATGTCCTCTCCACTGTCCGAAT See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | par-6_UTR_F | This paper | PCR primers | CACTCCACCGGAGGAATGGACGAGCTCTACTGAaaaactcttttcagcca See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | par-6_UTR_R | This paper | PCR primers | TAAAGGGAACAAAAGCTGGAGCTCCACCGCgaaataaataatttattctc See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | mCherry_F | This paper | PCR primers | TCCAAGGGAGAGGAGGACAA See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | mCherry_R | This paper | PCR primers | GTAGAGCTCGTCCATTCCTC See Materials and methods section ‘PAR-6::mCherry transgenic array’ for usage details. |
| Sequence-based reagent | par-6_F2 | This paper | PCR primers | ggaggcgcgccATGATTGTGCCAGAAGCTCATCG See Materials and methods section ‘yeast two-hybrid’ analysis for usage details. |
| Sequence-based reagent | par-6_R2 | This paper | PCR primers | ggagcggccgcTCAGGCGTTCGGTGTTCCTTGTT See Materials and methods section ‘yeast two-hybrid’ analysis for usage details. |
| Sequence-based reagent | noca-1d_F | This paper | PCR primers | ggaggcgcgccATGAATATTTGTTGTTGTGG See Materials and methods section ‘yeast two-hybrid’ analysis for usage details. |
| Sequence-based reagent | noca-1d_R | This paper | PCR primers | ggagcggccgcCTATTGAACTCTGCATACAT. See Materials and methods section ‘yeast two-hybrid’ analysis for usage details. |
Additional files
-
Supplementary file 1
A zip archive containing the DNA sequences of genome edits and plasmids described in this paper in genbank and SnapGene format.
- https://cdn.elifesciences.org/articles/62067/elife-62067-supp1-v2.zip
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/62067/elife-62067-transrepform-v2.docx
