Translation in amino-acid-poor environments is limited by tRNAGln charging
- Cancer Biology & Genetics Program, Memorial Sloan Kettering Cancer Center, United States
- The Donald B. and Catherine C. Marron Cancer Metabolism Center, Memorial Sloan Kettering Cancer Center, United States
Figures
Figure 1 with 1 supplement
Amino acid deprivation triggers selective uncharging of tRNAGln.
(A) Mouse embryonic fibroblasts (MEFs) were treated with amino-acid-free DMEM for indicated periods of time in presence (+) or absence (-) of 100 nM bafilomycin A1 (BafA1). Cell lysates were …
-
Figure 1—source data 1
Summary data and statistics for O-propargyl-puromycin assays, tRNA charging assays and mass spectrometry measurements presented in Figure 1 and Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/62307/elife-62307-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Additional data on amino acid sensing and tRNA charging in amino-acid-depleted cells.
(A, B) Mouse embryonic fibroblasts (MEFs) were treated with amino-acid-free DMEM for indicated periods of time in presence (+) or absence (-) of 0.4 μM ISRIB and analyzed by O-propargyl-puromycin …
Figure 2 with 1 supplement
Glutaminase inhibition restores charged tRNAGln pools in amino-acid-deprived cells.
(A) Depiction of glutamine utilization pathways. (B) A method for a high-throughput profiling of tRNA charging (CHARGE-seq). (C) Mouse embryonic fibroblasts (MEFs) were treated with complete or …
-
Figure 2—source data 1
Summary data and statistics for tRNA charging and cell proliferation assays presented in Figure 2 and Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/62307/elife-62307-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Loss of tRNAGln charging and its restoration via the inhibition of glutaminase across a variety of cellular contexts.
(A–B) A498 (A) or MiaPaCa2 (B) cells were treated with complete or amino-acid-free DMEM for 6 hr in presence (+) or absence (-) of 1 μM glutaminase inhibitor CB-839. tRNA charging of indicated …
Figure 3 with 1 supplement
Glutaminase inhibition facilitates protein synthesis when amino acids are limiting.
(A) Mouse embryonic fibroblasts (MEFs) were treated with complete or amino-acid-free DMEM for 6 hr in presence (+) or absence (-) of 1 μM glutaminase inhibitor CB-839. Translational activity was …
-
Figure 3—source data 1
Summary data and statistics for O-propargyl-puromycin assays, GFP reporter assays and IgG secretion assay presented in Figure 3 and Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/62307/elife-62307-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Additional data on translational capacity of amino-acid-deprived cells across a variety of cellular contexts.
(A, B) MiaPaCa2 (A) or A498 (B) cells were treated as indicated for 6 hr and analyzed by O-propargyl-puromycin (OPP) incorporation assay. Data are shown as mean ± SD of N = 3 biological replicates. …
Figure 4 with 1 supplement
Polyglutamine-tract-containing proteins are depleted from amino-acid-deprived cells and can be recovered by glutaminase inhibition or glutamine addition.
(A) MiaPaCa2 cells were treated as shown for 48 hr. Levels of indicated proteins were examined by western blotting. A representative result (out of three independent experiments) is shown. (B) …
-
Figure 4—source data 1
Summary data and statistics for 5-ethynyl-uridine assays and GFP reporter assays in Figure 4 and Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/62307/elife-62307-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Additional data on the recovery of expression of polyglutamine-tract-containing proteins and cellular transcriptional activity via glutaminase inhibition or glutamine supplementation.
(A) MEFs were treated as shown for 48 hr and harvested for western blotting. Protein levels of indicated polyQ proteins were analyzed by western blotting. A representative result (out of N = 5 …
Figure 5 with 1 supplement
Amino acid depletion triggers frame shifting within polyglutamine-tract-containing proteins, which can be recovered by glutaminase inhibition or glutamine addition.
(A) A diagram depicting PolyQ−1-GFP reporter design and projected outcomes of an in-frame (relative to a (CAG)n stretch) or a −1 frame shifted translation. (B) Mouse embryonic fibroblasts (MEFs) …
-
Figure 5—source data 1
Summary data and statistics for GFP reporter assays presented in Figure 5 and Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/62307/elife-62307-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Additional data on the amino acid depletion-triggered translational fidelity loss associated with polyglutamine tracts.
(A, B) PolyQ−1-GFP-transduced MiaPaCa2 (A) or MC38 (B) cells were treated as indicated for 24 hr. GFP accumulation was measured by FACS. A representative result (out of two independent experiments) …
Figure 6
Clusters of cells undergoing frame shifting are detectable within solid tumors in vivo.
(A) MiaPaCa2 cells transduced with PolyQ−1-GFP reporter or empty vector control were injected subcutaneously into nude mice and xenografts were allowed to develop for 3 weeks. Paraffin-embedded …
-
Figure 6—source data 1
Summary data and statistics for GFP+ cell accumulation assay presented in Figure 6.
- https://cdn.elifesciences.org/articles/62307/elife-62307-fig6-data1-v2.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | GLS | GenBank | Gene ID: 2744 | |
| Strain, strain background (Mus musculus, female) | Athymic nude mice | Envigo | Athymic Nude-Foxn1nu, RRID:IMSR_JAX:007850 | |
| Cell line (Mus musculus) | Mouse embryonic fibroblasts (MEFs) | This laboratory | SV40-immortalized; confirmed mycoplasma-free | |
| Cell line (Mus musculus, female) | A20 | ATCC | TIB-208; RRID:CVCL_1940 | confirmed mycoplasma-free |
| Cell line (Mus musculus, female) | MC-38 | Dr. James Hodge laboratory | RRID:CVCL_B288 | confirmed mycoplasma-free |
| Cell line (Homo sapiens, male) | MiaPaCa2 | ATCC | CRL-1420; RRID:CVCL_0428 | Authenticated by STR; confirmed mycoplasma-free |
| Cell line (Homo sapiens, female) | A498 | Dr. James Hsieh laboratory | RRID:CVCL_1056 | Authenticated by STR; confirmed mycoplasma-free |
| Antibody | phospho-Thr899 GCN2, rabbit monoclonal | Abcam | Cat. #ab75836, RRID:AB_1310260 | (1:1000) dilution |
| Antibody | GCN2, rabbit polyclonal | Cell Signaling | Cat. #3302, RRID:AB_2277617 | (1:1000) dilution |
| Antibody | phospho-Thr-389-S6K1, rabbit monoclonal | Cell Signaling | Cat. #9234, RRID:AB_2269803 | (1:1000) dilution |
| Antibody | S6K1, rabbit monoclonal | Cell Signaling | Cat. #2708, RRID:AB_390722 | (1:1000) dilution |
| Antibody | vinculin, mouse monoclonal | Sigma-Aldrich | Cat. #V9131, RRID:AB_477629 | (1:2000) dilution |
| Antibody | ATF4, rabbit polyclonal | Santa Cruz | Cat. #sc-200, RRID:AB_2058752 | (1:250) dilution |
| Antibody | MED12, rabbit polyclonal | Bethyl | Cat. #A300-774A, RRID:AB_669756 | (1:1000) dilution |
| Antibody | TBP, rabbit polyclonal | Bethyl | Cat. #A301-229A, RRID:AB_890661 | (1:1000) dilution |
| Antibody | CBP, rabbit polyclonal | Bethyl | Cat. #A300-362A, RRID:AB_185573 | (1:1000) dilution |
| Antibody | CBFα1, rabbit monoclonal | Cell Signaling | Cat. #12556, RRID:AB_2732805 | (1:1000) dilution |
| Antibody | BRD4, rabbit monoclonal | Abcam | Cat. #ab128874, RRID:AB_11145462 | (1:1000) dilution |
| Antibody | CTCF, rabbit monoclonal | Bethyl | Cat. #A700-041-T, RRID:AB_2883994 | (1:1000) dilution |
| Antibody | RNA pol II, mouse monoclonal | Active Motif | Cat. #39497, RRID:AB_2732926 | (1:1000) dilution |
| Antibody | Histone H3, mouse monoclonal | Cell Signaling | Cat. #3638, RRID:AB_1642229 | (1:1000) dilution |
| Antibody | α-Tubulin, mouse monoclonal | Sigma-Aldrich | Cat. #T9026, RRID:AB_477593 | (1:1000) dilution |
| Antibody | β-Actin, mouse monoclonal | Sigma-Aldrich | Cat. #A5441, RRID:AB_476744 | (1:2000) dilution |
| Antibody | HA tag, mouse monoclonal | Cell Signaling | Cat. #2367, RRID:AB_10691311 | (1:1000) dilution |
| Antibody | Puromycin, mouse monoclonal | EMD Millipore | Cat. #MABE343, RRID:AB_2566826 | (1:500) dilution |
| Antibody | GLS, rabbit monoclonal | Abcam | Cat. #ab156876, RRID:AB_2721038 | (1:1000) dilution |
| Recombinant DNA reagent | pLKO.1-shCtrl1 | Gene Editing and Screening Core, MSKCC | SHC002 | Lentivirus-encoded non-targeting control shRNA |
| Recombinant DNA reagent | pLKO.1-shCtrl2 | Gene Editing and Screening Core, MSKCC | SHC007 | Lentivirus-encoded shRNA targeting luciferase |
| Recombinant DNA reagent | pLKO.1-shGLS-1 | Gene Editing and Screening Core, MSKCC | TRCN0000051136 | Lentivirus-encoded shRNA targeting human GLS |
| Recombinant DNA reagent | pLKO.1-shGLS-2 | Gene Editing and Screening Core, MSKCC | TRCN0000051135 | Lentivirus-encoded shRNA targeting human GLS |
| Recombinant DNA reagent | pTURN-hygro-GFP | This laboratory | Retrovirus-encoded, dox-inducible vector expressing GFP | |
| Recombinant DNA reagent | pTURN-hygro-d2GFP | This laboratory | Retrovirus-encoded, dox-inducible vector expressing d2GFP (GFP fused to a degron of mouse ODC) | |
| Recombinant DNA reagent | pTURN-hygro-PolyQ-GFP | This laboratory | Retrovirus-encoded, dox-inducible vector expressing PolyQ-GFP (GFP) fused to a first exon of human HTT; design details in ‘Reporter Design and Virus Production’ under Materials and methods | |
| Recombinant DNA reagent | pCDH-puro-PolyQ−1-GFP | This laboratory | Lentivirus-encoded frameshift reporter; design details in ‘Reporter Design and Virus Production’ under Materials and methods | |
| Recombinant DNA reagent | pCDH-puro-Luc−1-GFP | This laboratory | Lentivirus-encoded frameshift reporter control; design details in ‘Reporter Design and Virus Production’ under Materials and methods | |
| Sequence-based reagent | tRNA assay 5’-adenylated DNA adaptor | IDT DNA | 5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC /- 3′ | |
| Sequence-based reagent | 5’-phosphorylated DNA adaptor for CHARGE-seq | IDT DNA | 5’-/5phos/AGATCGGAAGAGCGTCGTGTAGGGA/3ddC /- 3’ | |
| Commercial assay or kit | Click-iT Plus Alexa Fluor 647 Picolyl Azide Toolkit | Thermo Scientific | C10643 | For O-propargyl-puromycin and 5-ethynyl-uridine incorporation assay |
| Chemical compound, drug | L-Valinol | Sigma-Aldrich | 186708 | Used at 2 mM |
| Chemical compound, drug | Cycloheximide | Sigma-Aldrich | C4859 | Used at 10 μg/mL |
| Chemical compound, drug | CB-839 | Selleck Chemicals | S7655 | Used at 1 μM |
| Chemical compound, drug | Bafilomycin A1 | Cayman Chemical | 88899-55-2 | Used at 100 nM |
| Chemical compound, drug | BPTES | Cayman Chemical | 19284 | Used at 10 μM |
| Chemical compound, drug | Compound 968 | Cayman Chemical | 17199 | Used at 10 μM |
| Chemical compound, drug | ISRIB | Sigma-Aldrich | SML0843 | Used at 400 nM |
| Chemical compound, drug | O-propargyl-puromycin | Thermo Scientific | C10459 | Used at 20 μM |
| Chemical compound, drug | 5-ethynyl-uridine | Abcam | ab146642 | Used at 200 μM |
| Other | GtRNA database | PMID:26673694 | RRID:SCR_006939 | Genomic tRNA Database, http://gtrnadb.ucsc.edu |
Additional files
-
Supplementary file 1
Additional oligonucleotide sequences (not listed in the key resources table).
- https://cdn.elifesciences.org/articles/62307/elife-62307-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/62307/elife-62307-transrepform-v2.pdf
