Kinesin-4 KIF21B limits microtubule growth to allow rapid centrosome polarization in T cells
- Cell Biology, Neurobiology and Biophysics, Department of Biology, Faculty of Science, Utrecht University, Netherlands
- Center for Translational Immunology, University Medical Center Utrecht, Utrecht University, Netherlands
Figures
Figure 1 with 2 supplements
Immunological synapse formation is impaired in KIF21B-KO Jurkat T cells.
(A–B) Schematic representation of T cells forming an immunological synapse upon target recognition. In vivo, T cells recognize an antigen-presenting cell (APC) via the T cell receptor (CD3)-complex …
-
Figure 1—source data 1
An Excel sheet with numerical data on the quantification of indicated Jurkat cell lines analyzed for cell surface area, MT organization at the immunological synapse, and polarization of lysosomes toward the immunological synapse represented as plots (or cumulative frequency distribution for Figure 1J) in Figure 1E,G,J and K.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Scans of Western blot images corresponding to Figure 1C.
Areas used in Figure 1C are highlighted per blot (red). High exposure images for anti-tubulin and anti-Ku80 blots are included to make the blot background visible.
Figure 1—figure supplement 2
Characterization of KIF21B knockout cell lines.
(A–B) qRT-PCR measurements of IL-2 expression levels after stimulation at indicated timepoints. Indicated Jurkat T cell lines were treated with 2 ng/ml PMA and 100 ng/ml ionomycin (A, mild …
-
Figure 1—figure supplement 2—source data 1
An Excel sheet with numerical data on the quantification of indicated Jurkat cell lines analyzed for IL-2 expression levels after activation, total cell volume, and duration of immunological synapse formation represented as plots in Figure 1—figure supplement 2A, B, D and G.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig1-figsupp2-data1-v2.xlsx
Figure 2 with 4 supplements
Knockout of KIF21B causes microtubule (MT) overgrowth in Jurkat cells.
(A–B) STED images of indicated Jurkat T cell lines. Cells were added to poly-D-lysine-coated coverslips with immobilized anti-CD3 and fixed 7 min after incubation. Cells were stained for α-tubulin …
-
Figure 2—source data 1
An Excel sheet with numerical data on the quantification of indicated Jurkat cell lines analyzed for MT radiality at the immunological synapse and total 3D MT organization of Jurkat cells during polarization represented as plots in Figure 2C,F and G.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Characterization of microtubule (MT) network in polarizing T cells by Expansion Microscopy (ExM).
(A) Quantification of total estimated MT length per cell indicated in indicated Jurkat T cell lines. Values were obtained by multiplication of total MT numbers by the estimated average MT length per …
-
Figure 2—figure supplement 1—source data 1
An Excel sheet with numerical data on the quantification of indicated Jurkat cell lines analyzed for total MT length in 3D of Jurkat cells during polarization represented as a plot in Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig2-figsupp1-data1-v2.xlsx
Figure 2—video 1
3D volume render of an Expansion Microscopy (ExM) imaged Jurkat control cell 2 min after activation.
Volume rendering of a control Jurkat cell fixed 2 min after activation on anti-CD3 coated coverslips stained for α-tubulin. Samples were isotropically expanded using an ExM protocol and imaged on a …
Figure 2—video 2
3D volume render of an Expansion Microscopy (ExM) imaged Jurkat KIF21B-KO cell (KO #1) 2 min after activation.
Volume rendering of a KIF21B-KO Jurkat cell (KO #1) fixed 2 min after activation on anti-CD3-coated coverslips stained for α-tubulin. Samples were isotropically expanded using an ExM protocol and …
Figure 2—video 3
3D volume render of an Expansion Microscopy (ExM) imaged Jurkat KIF21B-KO cell (KO #2) 2 min after activation.
Volume rendering of a control KIF21B-KO Jurkat cell (KO #2) fixed 2 min after activation on anti-CD3-coated coverslips stained for α-tubulin. Samples were isotropically expanded using an ExM …
Figure 3 with 2 supplements
KIF21B induces microtubule (MT) pausing and catastrophes in T cells.
(A) Live imaging of indicated Jurkat KIF21B-KO T cells stably overexpressing KIF21B-GFP on Lab-Tek chambered coverglass with immobilized anti-CD3. Images show a single movie frame and a maximum …
-
Figure 3—source data 1
An Excel sheet with numerical data on the quantification of KIF21B-GFP velocities, single-molecule analysis of KIF21B-GFP in Jurkat cells and the effects of single KIF21B-GFP molecules on growing microtubule ends in Jurkat cells represented as frequency distributions (Figure 3B), frequency distributions with lognormal fits (Figure 3C), and as plots (Figure 3G, H and I).
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Characterization of KIF21B motility in cells.
(A) Workflow for GFP (monomer reference) and KIF21B-GFP single-molecule counting. Imaging was performed in a dual-chamber microscope slide in a single imaging session with identical microscope …
-
Figure 3—figure supplement 1—source data 1
An Excel sheet with numerical data on the quantification of single-molecule analysis of KIF21B-GFP in Jurkat cells and the effects of single KIF21B-GFP molecules on growing microtubule ends in Jurkat cells represented as a lognormal data fit (Figure 3—figure supplement 1B) and as plots (Figure 3—figure supplement 1B and F).
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig3-figsupp1-data1-v2.xlsx
Figure 3—video 1
KIF21B-GFP motors imaged at the immunological synapse of an activated Jurkat T cell.
Live imaging of a Jurkat KIF21B-KO T cell (KO #2) stably overexpressing KIF21B-GFP. Video corresponds to Figure 3A. Images were collected using a TIRF microscope at 10 frames per second. Video is …
Figure 4 with 1 supplement
Mild inhibition of MT growth with vinblastine rescues centrosome repositioning in KIF21B-KO cells.
(A) Live-cell imaging of indicated EB3-GFP overexpressing Jurkat T cell lines. Cells were added to Lab-Tek chambered coverglass with immobilized anti-CD3 and imaged on a TIRF microscope at 2.5 fps. …
-
Figure 4—source data 1
An Excel sheet with numerical data on the quantification of indicated Jurkat cell lines for MT dynamics parameters and centrosome polarization toward the immunological synapse represented as plots (Figure 4B, C, E and I) and cumulative frequency distributions (Figure 4F and H).
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
KIF21B-depleted cells lack long MT pause events.
(A) Quantification of MT pause duration as shown in Figure 4F based on live-cell imaging of indicated β-tubulin-GFP overexpressing Jurkat T cell lines. Pause durations are derived from MT pausing …
-
Figure 4—figure supplement 1—source data 1
An Excel sheet with numerical data on the quantification of indicated Jurkat cell lines for MT pause durations represented as a plot in Figure 4—figure supplement 1A.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig4-figsupp1-data1-v2.xlsx
Figure 5 with 1 supplement
Biophysical simulation shows how KIF21B affects MT network length.
(A) A T cell is modeled as a circular cell with a nucleus (light blue) and centrosome confinement space (red). The cell is 14 µm in diameter, the nucleus is 10 µm in diameter. (B) Description of …
-
Figure 5—source data 1
A CSV file with numerical data of represented trajectories as plotted in Figure 5D, left panel.
The mean MT length of the represented plot is obtained from each trajectory for every 0.4 s of simulation.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-data1-v2.zip
-
Figure 5—source data 2
A CSV file with numerical data of mean MT length at time t = 300 s as plotted in Figure 5D, right panel.
Values were obtained from the trajectories represented in the left panel of Figure 5D.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-data2-v2.zip
-
Figure 5—source data 3
A CSV file with numerical data of represented trajectories as plotted in Figure 5F, left panel.
The mean MT length of the represented plot is obtained from each trajectory for every 0.4 s of simulation.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-data3-v2.zip
-
Figure 5—source data 4
A CSV file with numerical data of mean MT length at time t = 300 s as plotted in Figure 5F, right panel.
Values were obtained from the trajectories represented in the left panel of Figure 5F.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-data4-v2.zip
Figure 5—figure supplement 1
Characterization of T cell force-dependent catastrophe.
(A) Reverse cumulative distribution plot showing MT pause times for KIF21B-KO and control with the immediate catastrophes at t = 0 s. The exponential fit (rate = mean pause time−1) corresponds to a …
-
Figure 5—figure supplement 1—source data 1
A CSV file with numerical data of the fraction of MT surviving as a function of time.
The analytical functions are indicated, and the experimental data is represented as a reverse cumulative distribution as plotted in Figure 5—figure supplement 1A.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-figsupp1-data1-v2.zip
-
Figure 5—figure supplement 1—source data 2
A CSV file with numerical data of MT surviving under force as a function of catastrophe rates for different MT forces exerted by polymerization.
This data is represented in Figure 5—figure supplement 1C.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-figsupp1-data2-v2.zip
-
Figure 5—figure supplement 1—source data 3
A CSV file with numerical data of the free catastrophe rate as a function of the growing force, used to obtain a linear fit and represented in Figure 5—figure supplement 1D.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig5-figsupp1-data3-v2.zip
Figure 6 with 3 supplements
KIF21B prevents centrosome stalling induced by force balance during polarization by limiting MT length.
(A) The T cell model is initialized to a steady state MT network in 300 s (Phase I) and is then extended to a polarizing model (Phase II). In this transition, the cell shape is changed to include a …
-
Figure 6—source data 1
A CSV file with numerical data of polarization time as a function of catastrophe rates represented in Figure 6C.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-data1-v2.zip
-
Figure 6—source data 2
A CSV file with numerical data of polarization time as a function of the numbers of KIF21B motors represented in Figure 6D.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-data2-v2.zip
-
Figure 6—source data 3
A CSV file with numerical data of the distance from the centrosome to the synapse as a function of time for different numbers of KIF21B motors, shown in Figure 6E.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-data3-v2.zip
-
Figure 6—source data 4
A CSV file with numerical data of force imbalance per time trace and per time point for different numbers of KIF21B motors, as plotted in Figure 6F.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-data4-v2.zip
-
Figure 6—source data 5
A CSV file with numerical data of the mean numbers of MT bound to dynein for different numbers of KIF21B motors, as shown in Figure 6G.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-data5-v2.zip
-
Figure 6—source data 6
A CSV file with numerical data of time traces of the centrosome-synapse distance and time traces of the difference between the number of MTs bound by dynein passing along the right and the left side of the nucleus.
The data is given for different numbers of KIF21B motors and shown in Figure 6H.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-data6-v2.zip
Figure 6—figure supplement 1
KIF21B affects the balance of force in T cell polarization.
Histogram showing the force on dynein at every timestep. The forces on dynein along the x-axis are summed, where left-pointing forces are taken as negative. This sum is taken for every recorded time …
-
Figure 6—figure supplement 1—source data 1
A CSV file with numerical data of summed horizontal forces on dynein per time trace and per time point for different numbers of KIF21B motors, as shown in Figure 6—figure supplement 1.
Appendix 1—table 1. Parameters used for simulations.
- https://cdn.elifesciences.org/articles/62876/elife-62876-fig6-figsupp1-data1-v2.zip
Figure 6—video 1
Recording of a simulated T cell in the ‘non-pausing’ model with 10 KIF21B motors added.
The T cell simulation consists of two phases. At first, the model is initialized to a steady state MT network in the first 300 s, during which the centrosome is confined to the red box at one side …
Figure 6—video 2
Recording of a simulated T cell in the ‘non-pausing’ model with 0 KIF21B motors added.
The T cell simulation consists of two phases. At first, the model is initialized to a steady state MT network in the first 300 s, during which the centrosome is confined to the red box at one side …
Figure 7
Overview of the experimental results and a model of centrosome polarization in T cells.
Centrosome polarization in T cells is driven by dynein attached to the immunological synapse. KIF21B is a pausing and catastrophe-promoting factor that limits MT growth in T cells; its depletion …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-11268 | |
| Cell line (Homo sapiens) | Jurkat, Clone E6-1 | ATCC | TIB-152 | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1 | This paper | CRISPR/Cas9 generated monoclonal Jurkat cell line | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2 | This paper | CRISPR/Cas9 generated monoclonal Jurkat cell line | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1, re-expressing KIF21B-GFP | This paper | Polyclonal line re-expressing KIF21B-GFP; generated from monoclonal KIF21B KO#1 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2, re-expressing KIF21B-GFP | This paper | Polyclonal line re-expressing KIF21B-GFP; generated from monoclonal KIF21B KO#2 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat cells (control), expressing EB3-GFP | This paper | Polyclonal Jurkat (control) line expressing EB3-GFP | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1, expressing EB3-GFP | This paper | Polyclonal line expressing EB3-GFP; generated from monoclonal KIF21B KO#1 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2, expressing EB3-GFP | This paper | Polyclonal line expressing EB3-GFP; generated from monoclonal KIF21B KO#2 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat cells (control), expressing β-tubulin-GFP | This paper | Polyclonal Jurkat (control) line expressing β-tubulin-GFP | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1, expressing β-tubulin-GFP | This paper | Polyclonal line expressing β-tubulin-GFP; generated from monoclonal KIF21B KO#1 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2, expressing β-tubulin-GFP | This paper | Polyclonal line expressing β-tubulin-GFP; generated from monoclonal KIF21B KO#2 Jurkat cells | |
| Transfected construct (Homo sapiens) | KIF21B-GFP | This paper | Lentiviral construct to transfect and express KIF21B-GFP in Jurkat cells | |
| Transfected construct (Homo sapiens) | EB3-GFP | Bouchet et al., 2016; PMID:27939686 | Lentiviral construct to transfect and express EB3-GFP in Jurkat cells | |
| Transfected construct (Homo sapiens) | β-tubulin-GFP | Bouchet et al., 2016; PMID:27939686 | Lentiviral construct to transfect and express β-tubulin-GFP in Jurkat cells | |
| Transfected construct (Homo sapiens) | EB3-mCherry | Stepanova et al., 2003; PMID:12684451 | Expression construct transfected in Jurkat cells | |
| Sequence-based reagent | gRNA targeting sequence against KIF21B | This paper | gRNA sequence | caccgTGTGTGAGCAAGCTCATCGA |
| Sequence-based reagent | GAPDH_fw | This paper | qPCR primer | CAACGGATTTGGTCGTATT |
| Sequence-based reagent | GAPDH_rev | This paper | qPCR primer | GATGGCAACAATATCCACTT |
| Sequence-based reagent | IL-2_fw | This paper | qPCR primer | AACTCACCAGGATGCTCACATTTA |
| Sequence-based reagent | IL-2_rev | This paper | qPCR primer | TCCCTGGGTCTTAAGTGAAAGTTT |
| Antibody | Anti-CD3, clone UCHT1 (mouse monoclonal) | StemCell Technologies | Cat# #60011 | Coverslip coating (10 μg/mL) WB (1:400) |
| Antibody | Anti-HA, clone 16B12 (mouse monoclonal) | Biolegend (Covance) | Cat# MMS-101P, RRID:AB_10064068 | Coverslip coating (10 μg/mL) |
| Antibody | anti-KIF21B (rabbit polyclonal) | Sigma-Aldrich | Cat# HPA027249, RRID:AB_10602241 | WB (1:1000) |
| Antibody | Anti-GFP (rabbit polyclonal) | Abcam | Cat# Ab290, RRID:AB_303395 | WB (1:5000) |
| Antibody | Anti-Ku80 (mouse monoclonal) | BD Bioscience | Cat# 611360, RRID:AB_398882 | WB (1:2000) |
| Antibody | Anti- Lamtor4, clone D6A4V (rabbit monoclonal) | Cell Signalling Technology | Cat# 12284, RRID:AB_2797870 | IF (1:200) |
| Antibody | anti-CEP135 (rabbit polyclonal) | Sigma-Aldrich | Cat# SAB4503685; RRID:AB_10746232 | IF (1:200) |
| Antibody | Anti- α-tubulin, clone EP1332Y (rabbit monoclonal) | Abcam | Cat# ab52866, RRID:AB_869989 | IF (1:250) for ExM samples |
| Antibody | Anti-α-tubulin (mouse monoclonal) | Sigma-Aldrich | Cat# T6199, RRID:AB_477583 | IF (1:250) for STED samples WB (1:10000) |
| Antibody | Anti- α-tubulin, clone γL1/2 (rat monoclonal) | Abcam | Cat# Ab6160, RRID:AB_305328 | IF (1:300) |
| Antibody | Alexa Fluor 488-, 594- and 647- secondaries | Molecular Probes | IF (1:200 – 1:400) | |
| Antibody | IRDye 680LT and 800CW secondaries | Li-Cor Biosciences | WB (1:10000) | |
| Commercial assay or kit | Amaxa Cell Line Nucleofector kit V | Lonza | Cat# VPB-1002 | program X-001 or X-005 |
| Commercial assay or kit | iScript cDNA synthesis kit | Bio-Rad | Cat# 1708891 | |
| Commercial assay or kit | SYBR Select mastermix | Life Technologies | Cat# 44-729-19 | |
| Peptide, recombinant protein | Proteinase-K | Thermo Fisher | Cat# EO0491 | |
| peptide, recombinant protein | Monomeric GFP | This paper | Obtained from HEK293T lysates containing overexpressed eGFP. (Clontech pEGFP-C1 vector) | |
| Chemical compound, drug | acryloyl X-SE (AcX) | Thermo Fisher | Cat# A20770 | |
| Chemical compound, drug | sodium acrylate | Sigma-Aldrich | Cat# 408220 | |
| Chemical compound, drug | AA/BIS solution | Sigma-Aldrich | Cat# A3699 | |
| Chemical compound, drug | BIS | Sigma-Aldrich | Cat# M1533 | |
| Chemical compound, drug | cOmplete protease inhibitor cocktail | Roche | Cat# 4693132001 | |
| Chemical compound, drug | Puromycin | InvivoGen | Cat# ant-pr5b | (2 μg/mL) |
| Chemical compound, drug | Hygromycin | Invivogen | Cat# ant-hm | (100 μg/mL) |
| Chemical compound, drug | Polybrene | Merck-Millipore | Cat# TR-1003-G | (8 μg/mL) |
| Chemical compound, drug | Poly-D-Lysine | Thermo Fisher | Cat# A3890401 | |
| Chemical compound, drug | Vinblastine | Sigma-Aldrich | Cat# V1377 | |
| Chemical compound, drug | Phorbol 12-myristate 13-acetate (PMA) | Sigma-Aldrich | Cat# P8139 | |
| Chemical compound, drug | ionomycin | Sigma-Aldrich | Cat# I0634 | |
| Chemical compound, drug | TRIzol | Thermo Fisher Scientific | Cat# 15596026 | |
| Software, algorithm | GraphPad Prism | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | |
| Software, algorithm | FIJI/ImageJ | FIJI/ImageJ (https://imagej.net/Fiji) | RRID:SCR_002285 | |
| Software, algorithm | ImageJ detection of molecules plugin (DoM) | Chazeau et al., 2016; PMID:26794511 | ||
| Software, algorithm | ImageJ KymoResliceWide plugin | https://github.com/ekatrukha/KymoResliceWide | ||
| Software, algorithm | ImageJ radiality plugin | Martin et al., 2018; PMID:29547120 | https://github.com/ekatrukha/radialitymap | |
| Software, algorithm | MetaMorph | Molecular Devices | RRID:SCR_002368 | |
| Software, algorithm | Leica Application Suite X | Leica Microsystems | RRID:SCR_013673 | |
| Software, algorithm | Micro-Manager | https://micro-manager.org/ | RRID:SCR_016865 | |
| Software, algorithm | Huygens Software | Scientific Volume Imaging https://svi.nl/HuygensSoftware | RRID:SCR_014237 | Drift correction of ExM sample acquisitions |
| Software, algorithm | Imaris, version 9.5.1 | Bitplane/Oxford instruments | RRID:SCR_007370 | |
| Software, algorithm | Cytosim | Nedelec and Foethke, 2007, PMID:19293826 | ||
| Software, algorithm | Python | https://www.python.org/ | RRID:SCR_008394 | |
| Software, algorithm | Seaborn | https://seaborn.pydata.org/ | RRID:SCR_018132 | |
| Software, algorithm | NumPy | https://numpy.org/ | RRID:SCR_008633 | |
| Software, algorithm | Pandas | https://pandas.pydata.org/ | RRID:SCR_018214 | |
| Software, algorithm | Adobe Illustrator | Adobe | RRID:SCR_010279 | Generation of cartoons and figures |
| Other | 8-well Chambered Coverglass w/ non-removable wells | Thermo | Cat# 155409 | |
| Other | Precision cover glasses thickness No. 1.5H | Marienfeld | Cat# 0107032 | Specific for ExM and STED samples |
| Other | silicone mold, 13mm inner diameter | Sigma-Aldrich | Cat# GBL664107 | |
| Other | Phalloidin-Alexa488 | Life Technologies | Cat# 12379 | IF (1:400) |
| Other | Phalloidin-Alexa594 | Life Technologies | Cat# 12381 | IF (1:400) |
| Other | DAPI-containing Vectashield mounting medium | Vector Laboratories | Cat# H-1200-10 | |
| Other | Vectashield mounting medium | Vector Laboratories | Cat# H-1000-10 | |
| Other | Prolong Gold | Thermo Fisher | Cat# P10144 |
Appendix 1—table 1
Parameters used for simulations.
| Parameter | Value | Description/Reference |
|---|---|---|
| MTs | ||
| Polymerization speed | 0.3 µm/s | This study |
| Depolymerization speed | 1 µm/s | This study |
| Rigidity | 20 pN/µm | Gittes et al., 1993 |
| Stall force | 5 pN | Describes the modulation of growth speed and catastrophe rate by antagonistic force (Dogterom and Yurke, 1997) |
| Catastrophe rate | 0.02 s-1, 0.3 s-1 | Matched to TIRF GFP-β-tubulin data (Figure 4D-E) |
| Cell | ||
| Viscosity | 0.1 pN.s/µm^2 | Internal viscosity of T cells, like most blood cells, is usually estimated to be lower than that of somatic cells. Jurkat cell internal viscosity has been reported at different values (Daza et al., 2019; Khakshour et al., 2015). Because there is no consensus on the value, we used a viscosity such that the KIF21B-mediated polarization happens within the timescale measured for polarization. |
| Elasticity | 100 pN/µm | The spring stiffness of the cell for all objects with inertia. This same stiffness is used for interaction of MTs with the nucleus |
| Radius | 7 µm | This study, calculated from Figure 1—figure supplement 2C-D. |
| Synapse fraction | 0.9 | This corresponds to a synapse cutting off 10% of the height of the cell (1.4 µm). |
| Interpolation distance | 1 µm | The curvature starts 1 µm under the synapse (at 2.4 µm from the top of the unpolarized cell). |
| centrosome | ||
| First anchoring stiffness | 500 pN/µm | Rotational stiffness on the MTs at the center of the centrosome, as proposed previously (Letort et al., 2016). |
| Second anchoring stiffness | 500 pN/µm | Rotational stiffness on the MTs exerted at the periphery of the centrosome, as proposed previously (Letort et al., 2016). |
| Number of MTs | 90 | |
| Dynein | ||
| Walking speed | 1 µm/s | Average value from MT gliding over dynein (Laan et al., 2012) |
| Number | 50 | |
| Stall force | 4 pN | Belyy et al., 2016 |
| Unbinding rate | 1 s-1 | Ohashi et al., 2019 |
| Initialization | uniform on synapse | Dynein is initialized on the synapse and part of the interpolated curve connecting the synapse to the rest of the cell. The region is defined as being within 1.6 µm of the synapse along the vertical axis. |
| Link stiffness | 100 pN/µm | Describes the elastic stiffness of the link between MT-binding site and anchoring point (Letort et al., 2016). |
| KIF21B | ||
| Walking speed | 0.71 µm/s | This study |
| MT state after a KIF21B-induced pause | Shrinkage | We inflate the effect of KIF21B to always cause catastrophe in order to more clearly display the effect of KIF21B as a delayed catastrophe inducer. |
| Capable of pausing a shrinking MT | No | This means that the KIF21B motors do not cooperatively pause: if one of them unbinds, the fiber is set to shrinkage and another bound KIF21B cannot pause this shrinking fiber. |
| System | ||
| Dimensionality | 2D | The overgrown KIF21B-KO MT system requires much computation per timestep, and thus we were not able to expand to 3D and keep our fit of the system. |
| Number of repeats | 30 per condition | In some figures, fewer repeats are shown for readability. If so, the ones were chosen that were run first chronologically, to avoid bias in run selection. |
