1. Cell Biology

Optimized Vivid-derived Magnets photodimerizers for subcellular optogenetics in mammalian cells

  1. Lorena Benedetti  Is a corresponding author
  2. Jonathan S Marvin
  3. Hanieh Falahati
  4. Andres Guillén-Samander
  5. Loren L Looger  Is a corresponding author
  6. Pietro De Camilli  Is a corresponding author
  1. Department of Neuroscience and Cell Biology, Yale University School of Medicine, United States
  2. Howard Hughes Medical Institute, Yale University School of Medicine, United States
  3. Howard Hughes Medical Institute, Janelia Research Campus, United States
  4. Kavli Institute for Neuroscience, Yale University School of Medicine, United States
  5. Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale University School of Medicine, United States
https://doi.org/10.7554/eLife.63230
Share this article
Cite this article
  1. Lorena Benedetti
  2. Jonathan S Marvin
  3. Hanieh Falahati
  4. Andres Guillén-Samander
  5. Loren L Looger
  6. Pietro De Camilli
(2020)
Optimized Vivid-derived Magnets photodimerizers for subcellular optogenetics in mammalian cells
eLife 9:e63230.
https://doi.org/10.7554/eLife.63230
  2. Download BibTeX
  3. Download .RIS
4 figures, 11 videos, 1 table and 7 additional files

Figures

Figure 1 with 6 supplements
Download asset Open asset
Development and validation of enhanced Magnets (eMags).

(A) Schematic of the assay used to screen for light-dependent Magnets heterodimerization in living cells. The negative Magnet was anchored to the outer mitochondrial membrane (OMM), while the …

Figure 1—source data 1

Depletion of cytosolic pool of prey with original and enhanced Magnets.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Domain organization diagrams of the constructs used in this study.

(A) Constructs used to induce wild-type and mutant Magnets heterodimerization at the outer mitochondrial membrane. (B) Bait proteins used for the light-dependent recruitment of soluble prey proteins …

Figure 1—figure supplement 2
Download asset Open asset
Recruitment of the cytosolic prey to the membrane-associated bait upon light stimulation.

Accumulation of a soluble prey (eMagBF-TagRFP-T or eMagB-TagRFP-T) to a mitochondria-anchored bait (eMagAF-EGFP-Mito) (A) or to an ER-associated bait (ER-EGFP-eMagA) (B) upon whole-cell illumination …

Figure 1—figure supplement 3
Download asset Open asset
Magnets mutations tested to improve heterodimerization efficiency and thermodynamic stability.

(A) Primary sequence of the Neurospora crassa (strain ATCC 24698) photoreceptor Vivid (UniProtKB Q1K5Y8_NEUCR). The N-cap dimerization domain, the Per-ARNT-Sim (PAS) core domain (the photosensitive …

Figure 1—figure supplement 4
Download asset Open asset
Alignment of Vivid domain sequences from thermophilic ascomycetes.

Sequences were retrieved from NCBI. The two Rhizomucor sequences come from incomplete whole-genome sequencing projects. The nine mutations in eMags are shown in bold; all but one mutation was to an …

Figure 1—figure supplement 5
Download asset Open asset
Molecular modeling of effects of specific eMags mutations.

(A) Wild-type Thr69 leaves an unsatisfied hydrogen bond donor and acceptor at the dimer interface and packs poorly. Thr also prefers strand over helix (this position is in a helical turn). (B) …

Figure 1—figure supplement 6
Download asset Open asset
Light-dependent heterodimerization of the original Magnets at the mitochondrial surface with or without preincubation of cells at 28°C.

(A) Representative example of the light-dependent recruitment of the original Magnets prey (pMagFast2-TagRFP-T) to mitochondria in HeLa cells expressing the mitochondrial bait nMagHigh1-EGFP-Mito …

Figure 1—figure supplement 6—source data 1

Accumulation of soluble prey from the cytosol to mitochondria in cells expressing the original Magnets either without or with a preincubation at 28°C.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig1-figsupp6-data1-v2.xlsx
Figure 2
Download asset Open asset
eMags-dependent recruitment of soluble cytosolic proteins to intracellular organelles and modulation of PI(4,5)P2 at the plasma membrane.

(A) Rapid, reversible accumulation of a soluble prey to an endoplasmic reticulum-anchored bait upon whole-cell illumination of a COS7 cell. In this and other examples in the figure, global cell …

Figure 2—source data 1

PI(4,5)P2 dephosphorylation and re-phosphorylation events elicited in DIV7 primary hippocampal neurons.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig2-data1-v2.xlsx
Figure 3
Download asset Open asset
Optogenetic induction of organelle-organelle contacts.

(A) Graphical representation of the strategy used to establish contacts between membranes of intracellular organelles. Constructs encoding both components of the dimerization pair (eMagA and eMagB) …

Figure 3—source data 1

Relative increase in membranes overlap occurring upon optogentic induction of inter-organellar contacts.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig3-data1-v2.xlsx
Figure 4 with 3 supplements
Download asset Open asset
Light-dependent reconstitution of VAPB triggers PI4P transfer from the Golgi complex and endosomes to the ER.

(A) Domain organization of VAP and OSBP1, which together connect the ER to the PI4P-rich membranes of the Golgi complex (and an endosome subpopulation) to mediate PI4P transfer to the ER for …

Figure 4—source data 1

Changes of normalized iRFP-P4C (PI4P) fluorescence in the Golgi complex before, during, and after Opto-VAP activation in wild-type and VAP-DKO HeLa cells, with or without ITZ treatment.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Opto-VAP reconstitution induces PI4P loss from the Golgi complex and this effect is blocked by ITZ treatment.

The same wild-type HeLa cell expressing TagRFP-T-MSP(VAPB(1-218))-eMagB, ER-EGFP-eMagA and the PI4P reporter iRFP-P4C was imaged before (A) and 45 min after ITZ treatment (B). Before ITZ treatment, …

Figure 4—figure supplement 2
Download asset Open asset
ITZ treatment blocks PI4P loss from the Golgi complex but does not affect Opto-VAP reconstitution in WT and VAP-DKO HeLa cells.

Wild-type (A) and VAP-DKO (B) HeLa cells expressing TagRFP-T-MSP(VAPB(1-218))-eMagB, ER-EGFP-eMagA and the PI4P reporter iRFP-P4C imaged 30 min after ITZ treatment. Despite the rapid and efficient …

Figure 4—figure supplement 2—source data 1

Changes of normalized TagRFP-T-MSP-VAPB fluorescence in the ER during Opto-VAP activation in wild-type and VAP-DKO HeLa cells, with or without ITZ treatment.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig4-figsupp2-data1-v2.xlsx
Figure 4—figure supplement 3
Download asset Open asset
PHOSBP mediated tethering between the ER and PI4P-rich subcellular membranes is not associated with PI4P loss from these membranes.

(A) Graphical representation of the assay used to mediate VAP-independent membrane tethering of PI4P-enriched Golgi and endosomal membranes to the ER. Cells were transfected with (1) the PH domain …

Figure 4—figure supplement 3—source data 1

Changes of normalized iRFP-P4C (PI4P) fluorescence in the Golgi complex before, during, and after TagRFP-T-eMagB-PHOSBP recruitment to the ER in wild-type and VAP-DKO HeLa cells.

https://cdn.elifesciences.org/articles/63230/elife-63230-fig4-figsupp3-data1-v2.xlsx

Videos

Video 1
Download asset
Rapid and reversible recruitment of the cytosolic prey eMagB-TagRFP-T to the mitochondrially associated bait eMagA-EGFP-Mito (HeLa cells).

Whole-cell illumination with 0.5 Hz blue-light pulses for 60 s. Scale bar: 5 μm.

Video 2
Download asset
Rapid and reversible accumulation of the cytosolic prey eMagB-TagRFP-T on the surface of the endoplasmic reticulum in COS7 cells expressing the ER-associated bait ER-EGFP-eMagA.

Whole-cell illumination experiment. Scale bar: 2 μm.

Video 3
Download asset
Localized recruitment of the cytosolic prey eMagB-TagRFP-T to the ER-associated bait ER-EGFP-eMagA in a 3 µm x 3 µm ROI (blue square) of the ER.

HeLa cell. Scale bar: 5 μm.

Video 4
Download asset
Soluble prey (eMagB-TagRFP-T) recruitment to individual lysosomes identified by the lysosomal marker Lamp1-iRFP, in primary hippocampal neurons at 14 DIV, expressing the lysosome-specific bait Lys-eMagA-EGFP.

Scale bar: 5 μm.

Video 5
Download asset
Rapid cycles of PI(4,5)P2 dephosphorylation and rephosphorylation in primary hippocampal neurons at 7 DIV.

Scale bar: 5 μm.

Video 6
Download asset
Light-induced contacts between the ER and lysosomes in COS7 cells expressing ER-mCherry-eMagA (green) and Lys-eMagB-iRFP (magenta).

Scale bar: 2 μm.

Video 7
Download asset
Light-induced contacts between the ER and mitochondria in HeLa cells expressing ER-mCherry-eMagA (green) and eMagB-iRFP-Mito (magenta).

Scale bar: 2 μm.

Video 8
Download asset
Light-induced contacts between mitochondria and lysosomes in HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta).

Scale bar: 2 μm.

Video 9
Download asset
Fission of a mitochondrion caused by a moving lysosome anchored to the mitochondrion upon light-dependent interaction mediated by eMags dimerization.

HeLa cells expressing eMagA-mCherry-Mito (green) and Lys-eMagB-iRFP (magenta). Scale bar: 0.5 μm.

Video 10
Download asset
Rapid and reversible loss of iRFP-P4C from the Golgi upon light-dependent reconstitution of VAPB on ER membranes in wild-type HeLa cells.

TagRFP-T-VAPB(1-218)-eMagB is shown on the left, iRFP-P4C is shown on the right. Scale bar: 5 μm.

Video 11
Download asset
Rapid and reversible loss of iRFP-P4C from Golgi/endosome hybrid organelles in VAP-DKO HeLa cells upon light-dependent reconstitution of VAPB on ER membranes.

TagRFP-T-VAPB(1-218)-eMagB is shown on the left, iRFP-P4C is shown on the right. Scale bar: 5 μm.

Tables

Key resources table
Reagent type
(species) or resource		DesignationSource or referenceIdentifiersAdditional information
Sequence-based reagenteMagAF
ATGGGACACACTCTTTACGCCCCTGGAGGATACGACATTATGGGATATTTGGATCAGATTGCGAACCGCCCAAACCCTCAGGTCGAACTGGGGCCTGTGGACCTGTCATGTGCCCTGATCCTGTGCGATCTGAAGCAAAAGGACACTCCGATCGTCTACGCCTCGGAAGCCTTCTTGGAGATGACCGGATACAACAGACATGAGGTGCTCGGCAGGAACTGCAGATTCCTGCAGTCCCCCGACGGGATGGTGAAACCAAAGTCGACTCGCAAATATGTGGACTCGAACACGATCTTCACCATCAAGAAGGCCATCGACCGGAACGCCGAGGTCCAGGTGGAGGTGGTCAACTTTAAGAAGAACGGCCAGCGGTTCGTGAACTTTCTGACCATCATTCCGGTCCGGGATGAAACCGGAGAGTACAGATACTCCATCGGATTCCAGTGCGAAACCGAA		This paperGenBank accession number:
MW203024		See Main Text, Materials and methods and Supplementary file 3
Sequence-based reagenteMagBF
ATGGGACATACCCTCTACGCGCCGGGGGGTTATGACATCATGGGTTACCTCAGACAGATCAGAAACCGGCCGAACCCACAAGTGGAGCTGGGACCCGTCGACCTCTCCTGCGCCCTCGTGCTGTGTGACCTTAAGCAGAAGGACACCCCTGTGGTGTACGCCTCCGAAGCATTCCTGGAGATGACCGGGTACAACAGACACGAAGTGCTGGGACGGAACTGCCGCTTCCTGCAATCCCCGGATGGAATGGTGAAGCCTAAGTCAACCCGCAAATACGTGGACTCCAACACTATCTTCACCATGAAGAAGGCCATTGACCGCAATGCTGAGGTGCAAGTGGAAGTGGTGAACTTCAAGAAGAACGGACAGCGCTTCGTCAACTTCCTGACTATGATTCCCGTGCGGGACGAAACCGGCGAATACCGGTACAGCATCGGGTTTCAGTGCGAGACTGAG		This paperGenBank accession number:
MW203025		See Main Text, Materials and methods and Supplementary file 3
Sequence-based reagenteMagA
ATGGGACACACTCTTTACGCCCCTGGAGGATACGACATTATGGGATATTTGGATCAGATTGCGAACCGCCCAAACCCTCAGGTCGAACTGGGGCCTGTGGACCTGTCATGTGCCCTGATCCTGTGCGATCTGAAGCAAAAGGACACTCCGATCGTCTACGCCTCGGAAGCCTTCTTGGAGATGACCGGATACAACAGACATGAGGTGCTCGGCAGGAACTGCAGATTCCTGCAGTCCCCCGACGGGATGGTGAAACCAAAGTCGACTCGCAAATATGTGGACTCGAACACGATCTACACCATCAAGAAGGCCATCGACCGGAACGCCGAGGTCCAGGTGGAGGTGGTCAACTTTAAGAAGAACGGCCAGCGGTTCGTGAACTTTCTGACCATCATTCCGGTCCGGGATGAAACCGGAGAGTACAGATACTCCATCGGATTCCAGTGCGAAACCGAA		This paperGenBank accession number:
MW203026		See Main Text, Materials and methods and Supplementary file 3
Sequence-based reagenteMagB
ATGGGACATACCCTCTACGCGCCGGGGGGTTATGACATCATGGGTTACCTCAGACAGATCAGAAACCGGCCGAACCCACAAGTGGAGCTGGGACCCGTCGACCTCTCCTGCGCCCTCGTGCTGTGTGACCTTAAGCAGAAGGACACCCCTGTGGTGTACGCCTCCGAAGCATTCCTGGAGATGACCGGGTACAACAGACACGAAGTGCTGGGACGGAACTGCCGCTTCCTGCAATCCCCGGATGGAATGGTGAAGCCTAAGTCAACCCGCAAATACGTGGACTCCAACACTATCTACACCATGAAGAAGGCCATTGACCGCAATGCTGAGGTGCAAGTGGAAGTGGTGAACTTCAAGAAGAACGGACAGCGCTTCGTCAACTTCCTGACTATGATTCCCGTGCGGGACGAAACCGGCGAATACCGGTACAGCATCGGGTTTCAGTGCGAGACTGAG		This paperGenBank accession number:
MW203027		See Main Text, Materials and methods and Supplementary file 3
Recombinant DNA reagentnMagHigh1-EGFP-CAAXKawano et al., 2015 PMID:25708714RRID:addgene_67300
Recombinant DNA reagentpMagFast2(3x)-iRFPKawano et al., 2015 PMID:25708714RRID:addgene_67297
Recombinant DNA reagentiSH2-pMag(3x)-iRFPKawano et al., 2015 PMID:25708714RRID:addgene_67298
Recombinant DNA reagentnMagHigh1-EGFP-MitoThis paperSee Materials and methods
PCR primers:
Primer Fw: 5’ CGTCAGATCCGCTAGCATGGGACACACTCTTTACG
Primer Rw: 5’ TGCACCTGCACTCGAGCCCCCTTGTACAGCTCGTC 3
Recombinant DNA reagentpGFP-OMP25Nemoto and De Camilli, 1999 PMID:10357812
Recombinant DNA reagentpMagFast2(1x)-TagRFP-TThis paperSee Main Text, Materials and methods and Supplementary file 2
InFusion PCR primers:
Primer Fw: 5’ GTTTAAACTTAAGCTTgccaccatgggaCATACCCTCTACGCGCCG
Primer Rw: 5’ AAACGGGCCCTCTAGATCACTTGTACAGCTCGTCC
Recombinant DNA reagentpMagFast2(3x) -TagRFP-TBenedetti et al., 2018 PMID:29463750
Recombinant DNA reagenteMagAF-EGFP-MitoThis paperRRID:addgene_162243See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagenteMagA-EGFP-MitoThis paperRRID:addgene_162244See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagenteMagB-TagRFP-TThis paperRRID:addgene_162252See Main Text, Materials and methods and Supplementary file 2
Recombinant DNA reagenteMagBF-TagRFP-TThis paperRRID:addgene_162253See Main Text, Materials and methods and Supplementary file 2
Recombinant DNA reagentER-EGFP-eMagAThis paperRRID:addgene_162245See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagentER-mCherry-eMagAThis paperRRID:addgene_162248See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagenteMagA-mCherry-MitoThis paperRRID:addgene_162251See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagenteMagB-iRFP-MitoThis paperRRID:addgene_162250See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagentLys-eMagB-iRFPThis paperRRID:addgene_162249See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagentTagRFP-T-VAPB(1-218)-eMagBThis paperRRID:addgene_162255See Main Text, Materials and methods and Supplementary file 2
Recombinant DNA reagentLys-eMagA-EGFPThis paperRRID:addgene_162246See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagentLys-nMagHigh1-EGFPBenedetti et al., 2018 PMID:29463750
Recombinant DNA reagentLamp1-iRFPThis paperSee Materials and methods.
InFusion PCR primers:
Primer Fw: 5’ CTCAAGCTTCGAATTCATGGCGGCCCCCGGCAGC
Primer Rw: 5’ GGCGACCGGTGGATCCGGGATAGTCTGGTAGCCTGC
Recombinant DNA reagentpiRFP670-N1Shcherbakova and Verkhusha, 2013 PMID:23770755RRID:addgene_45457
Recombinant DNA reagenteMagAF-EGFP-PMThis paperRRID:addgene_162247See Main Text, Materials and methods and Supplementary file 1
Recombinant DNA reagentmCherry- eMagBF−5ptaseOCRLThis paperRRID:addgene_162254See Main Text, Materials and methods and Supplementary file 2
InFusion PCR primers:
Primer Fw: 5’
TCTCGAAGCGCGGCCGCGATGGGACATACCCTCTACGCG
Primer Rw: 5’
GAATGTTGACATACGATCGGGTACCTCCGCTGCCTCC
Recombinant DNA reagentmCherry-pMagFast2(3x)−5ptaseOCRLBenedetti et al., 2018 PMID:29463750
Recombinant DNA reagentiRFP-PHPLCδIdevall-Hagren et al., 2012 PMID:22847441
Recombinant DNA reagentTagRFP-T-eMagB-PHOSBPThis paperSee Main Text, Materials and methods and Supplementary file 2
InFusion PCR primers:
Primer Fw: 5’ CACCTGCATGCGGCCGCGCCACCATGGTGTCTAAGGG
Primer Rw: 5’ CGGGACCTCGAGGTTAACTCATTTCTGCCTTGATCTGTAGTAG
Recombinant DNA reagentGFP-PHOSBPDr. Tim Levine, UCL Institute of Ophthalmology
Recombinant DNA reagentiRFP-P4CThis paperSee Materials and methods
InFusion PCR primers:
Primer Fw: 5’ CGCTAGCGCTACCGGTATGGCGCGTAAGGTCGATCTCACC
Primer Rw: 5’ AGTCCGGACTTGTACAtGCGTTGGTGGTGGGCGGC
Recombinant DNA reagentGFP-P4CSidCDr. Yuxin Mao, Cornell
Commercial assay or kitIn-Fusion HD Cloning KitTakara BioCat. No. 638910
Cell line (Homo sapiens)HeLaATCCCCL-2
Cell line (Cercopithecus aethiops)COS-7ATCCCRL-1651
Cell line (Homo sapiens)HeLa VAPDKODong et al., 2016Cell line generated in the De Camilli Lab
Biological sample (Mus musculus)Primary hippocampal neuronsCharles RiverC57BL/6
Chemical compound, drugItraconazoleTocrisCat. No. 5981
Software, algorithmTBLASTNNCBI(TBLASTN, RRID:SCR_011822)
Software, algorithmPyMOLSchrödinger, Inc(PyMOL, RRID:SCR_000305)PyMOL 2.3.5.
Software, algorithmFijiNIHFiji, RRID:SCR_002285ImageJ Version: 2.0.0-rc-69/1.52 p, Wayne Rasband, National Institute of Health, USA, http://fiji.sc/wiki/index.php/Fiji
Software, algorithmMATLABMathWorks(MATLAB, RRID:SCR_001622)MATLAB 2019a
Software, algorithmGraph PadGraph Pad Software(GraphPad Prism, RRID:SCR_002798)GraphPad Prism 8.2.1

Additional files

Supplementary file 1

Constructs used to express wild-type or mutant Magnets on different subcellular compartments.

The organelle‐targeting sequences (OTS) used and their position, the fluorescent tag, and the original or mutant Magnets used in each construct are indicated.

https://cdn.elifesciences.org/articles/63230/elife-63230-supp1-v2.docx
Supplementary file 2

Constructs encoding the soluble prey proteins used in this study.

https://cdn.elifesciences.org/articles/63230/elife-63230-supp2-v2.docx
Supplementary file 3

Mutants tested.

https://cdn.elifesciences.org/articles/63230/elife-63230-supp3-v2.docx
Supplementary file 4

Primers for optimization of the Magnets heterodimer interface.

https://cdn.elifesciences.org/articles/63230/elife-63230-supp4-v2.docx
Supplementary file 5

Primers for thermostabilization of the Magnets proteins.

https://cdn.elifesciences.org/articles/63230/elife-63230-supp5-v2.docx
Supplementary file 6

Fit parameters.

https://cdn.elifesciences.org/articles/63230/elife-63230-supp6-v2.docx
Transparent reporting form
https://cdn.elifesciences.org/articles/63230/elife-63230-transrepform-v2.docx

Download links