1. Cell Biology
Download icon

Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1

  1. Naemi Luithle
  2. Jelmi uit de Bos
  3. Ruud Hovius
  4. Daria Maslennikova
  5. Renard TM Lewis
  6. Rosemarie Ungricht
  7. Beat Fierz
  8. Ulrike Kutay  Is a corresponding author
  1. Institute of Biochemistry, Department of Biology, ETH Zurich, Switzerland
  2. Molecular Life Sciences Ph.D. Program, Switzerland
  3. Institute of Chemical Sciences and Engineering - ISIC, EPFL, Switzerland
Research Article
Cite this article as: eLife 2020;9:e63614 doi: 10.7554/eLife.63614
6 figures, 2 videos, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Overexpression of LAP1B and LAP1C causes post-mitotic nuclear envelope (NE) aberrations.

(A) Vectors encoding the indicated inner nuclear membrane (INM) proteins were transfected into HeLa cells. Cells were fixed after 24 or 48 hr and analyzed by confocal microscopy. Scale bar, 10 μm. (B) Time-lapse images of LAP1B-GFP or LAP2β-GFP expressing HeLa cells progressing through mitosis. Expression of the constructs was induced 24 hr prior to imaging. DNA was visualized by SirHoechst and used to define anaphase onset (t = 00:00 hr:min). Scale bar, 5 μm. (C) Scheme depicting the two human LAP1 isoforms, LAP1B and LAP1C. (D) Representative images of stable HeLa cells lines expressing LAP1B-GFP and LAP1C-GFP after induction with different tetracycline (tet) concentrations for 48 hr. Please note that we observed some ‘twin’ nuclei upon overexpression of LAP1B (white arrow), which can be a sign of binucleation, as further analyzed in Figure 5. Scale bar, 10 μm. (E) LAP1 levels at the NE of cells from the experiment shown in panel D were analyzed by quantification of the integrated GFP density (IntDen GFP) per nucleus. (F) LAP1 levels in cell lysates derived from the experiment shown in panel D were analyzed by immunoblotting. Note that the LAP1B-GFP cell line expressed LAP1C-GFP independent of tetracycline addition, due to an alternative transcriptional start site used for the production of the shorter LAP1 isoform (Santos et al., 2014). (G) Left: Maximum intensity z-projections (5 × 0.63 μm) of confocal images from fixed metaphase HeLa cells expressing LAP1B-GFP or LAP1C-GFP after 48 hr of induction. Scale bar, 5 μm. Right: Confocal images of fixed HeLa cells in interphase. Scale bar, 10 μm.

Figure 1—figure supplement 1
Interphase and mitotic localization of LAP1B-GFP and endogenous nuclear envelope (NE) proteins.

(A) Vector encoding LAP1B-GFP was transiently transfected into HCT116 or HepG2 cells. Cells were fixed after 48 hr and analyzed by confocal microscopy. Scale bars, 10 μm. (B) Western blot analysis (left) and integrated GFP fluorescence intensities (right) in LAP1B-GFP and LAP2β-GFP-expressing cells of the experiment depicted in Figure 1B. (C) Comparison of the metaphase localization of nuclear lamins and select inner nuclear membrane (INM) proteins in an inducible LAP1B-GFP cell line without and with tetracycline (tet) induction. Maximum intensity projections (5 × 0.63 μm). Scale bar, 5 μm.

Figure 1—figure supplement 2
Lamin A/C and lamin B1 contribute to the retention of LAP1B at the nuclear envelope (NE).

(A) FRAP analysis of LAP1B-GFP, LAP1C-GFP and LAP2β-GFP at the NE (N = 5, n > 18, mean +/- SD). (B) Diffusional mobility of LAP1B-GFP (N = 5, n > 26, mean +/- SD) and LAP1C-GFP (N = 4, n > 21, mean +/- SD) after RNAi-mediated depletion of lamins analyzed by FRAP (N = 5, n > 21, mean +/- SD). (C) Depletion of lamins by RNAi was efficient, as shown by immunofluorescence analysis of lamin A/C, lamin B1 and lamin B2. Scale bar, 10 μm.

Figure 2 with 3 supplements
The nucleoplasmic domain of LAP1 contains a central chromatin-binding region (CBR) that can confer chromatin association during mitosis.

(A) Scheme depicting the generated fragments of the nucleoplasmic domain of LAP1B. (B) Metaphase localization of the depicted LAP1 fragments, transiently expressed in synchronized HeLa cells. Maximum intensity z-projections (3 × 1 μm). Scale bar, 5 μm. (C) Localization of LAP1(CBR)-GST-GFP during mitosis in HeLa cells. Scale bar, 5 μm. (D) LAP1B-GFP and LAP1B(ΔCBR)-GFP localization during metaphase. Scale bar, 5 μm. (E) Localization of wild-type SPAG4-GFP and (F) LAP1B(98-136)-SPAG4-GFP derivatives in interphase and prometaphase cells (arrested with nocodazole for 3 hr) 48 hr after transfection. Scale bars, 10 μm (upper panels) and 5 μm (lower panels). (G) Alignment of sequences of the CBR of LAP1B from the indicated mammalian species. The three mutated residues are boxed in red. (H) Left: Interphase HeLa cells expressing LAP1B-GFP or LAP1B(ΔCBR)-GFP for 48 hr. Scale bar, 10 μm. Middle and right: Percentage of nuclei with nuclear envelope (NE) aberrations, quantified as in Figure 3, in cells expressing LAP1B-GFP or LAP1B(ΔCBR)-GFP at similar levels, based on the integrated GFP density (IntDen GFP) (N = 3, n > 264, mean +/- SEM).

Figure 2—figure supplement 1
Delineation of the lamina-binding regions in LAP1B.

(A) Scheme illustrating the disorder probability of LAP1. (B) LAP1B fragments used to delineate lamina-binding regions in the nucleoplasmic domain of LAP1B. (C) Localization of the indicated LAP1B derivatives fused to GST-GFP (I) or NLS-GST-GFP (II) in interphase HeLa cells. An NLS-GST-GFP fusion served as control. Note that enrichment of protein fragments at the nuclear rim reflects lamina association, as confirmed in panel D. Scale bars, 10 μm. (D) Localization of LAP1 fragments fused to GST-GFP-NLS in either wild-type or LMN A/C KO HeLa cells, with or without downregulation of lamin B1. Note that nuclear envelope (NE) localization of LAP1(1–337) is strongly affected in LMN A/C KO cells, whereas the N-terminal fragment LAP1(1–72) is more strongly impaired in NE localization upon downregulation of lamin B1. Scale bar, 10 μm. (E) Characterization of LMN A/C knockout HeLa cells generated by CRISPR/Cas9 by DNA sequencing. (F) Analysis of LMN A/C knockout HeLa cells by immunofluorescence against lamin A/C. Scale bar, 10 μm.

Figure 2—figure supplement 2
Delineation of the chromatin-binding region (CBR) of LAP1B.

(A) LAP1B fragments used to map the minimal CBR in the nucleoplasmic domain of LAP1. (B) Localization of the indicated GST-GFP fusion proteins in synchronized HeLa cells during metaphase. DNA was stained with Hoechst. Maximum intensity projections (5 × 0.63 μm). Scale bar, 5 μm. (C) Electrophoretic mobility shift assays used for quantitative analysis of DNA and nucleosome binding of the isolated recombinant CBR of LAP1B. Increasing concentrations of zz-LAP1(98–136), zz-LAP1(98–136; S108E, T124E (‘2E’)) (I and II) or zz-His (III) were incubated with either ‘601’ DNA or reconstituted mononucleosomes and subjected to native gel electrophoresis. DNA was stained with GelRed. (D) Quantification of experiments in C based on integration of gel-band intensities from three independent experiments (N = 3), (I) for binding to mononucleosomes, (II) to DNA. Normalized band intensities (mean +/- SD) were plotted over the protein concentration and Kd values calculated using the Hill equation.

Figure 2—figure supplement 3
The chromatin-binding region (CBR) of LAP1 contributes to its retention at the inner nuclear membrane.

(A) FRAP analysis of LAP1B-GFP wild-type in comparison to truncation constructs lacking the N-terminal lamin-binding domain (LAP1(73-end)) or an extended part including the CBR (LAP1(184-end)); (N = 3, n > 20, mean +/- SD). Scale bar, 5 µm. (B) FRAP analysis of LAP1B and LAP1C-GFP and the indicated mutants of the CBR (N = 3, n > 14, mean +/- SD).

Figure 3 with 1 supplement
LAP1B-induced nuclear envelope (NE) aberrations can be rescued by co-expression of Torsins.

(A) HeLa cells were transiently transfected with constructs encoding for LAP1B-GFP or LAP1B(1-359), either alone or together with the depicted Torsin constructs. After 48 hr, cells were fixed, subjected to immunostaining of Torsins using an anti-HA antibody and analyzed by confocal microscopy. Scale bar, 10 μm. (B) Representative images of pre-defined classes of cell nuclei used for the classification of NE aberration phenotypes. Based on nuclear shape, cells were assigned into one of the five shown categories for the quantification in C. The two upper classes were regarded as normal (no; no NE aberration), and the three lower classes as aberrant (yes). Scale bar, 5 μm. (C) The percentage of cells with NE aberrations was quantified by assigning cells into one of five predefined phenotypic classes shown in B. (left; N = 3, n > 103, mean +/- SEM). Only cells with similar LAP1B-GFP expression levels, based on quantification of the integrated GFP density per cell (IntDen GFP, normalized to the LAP1B minus Torsin control; right) were considered. (D) Depiction of the mutant LAP1B constructs; R563G: Torsin activation deficient-mutant; E482A, disease-causing mutant. (E) HeLa cells were transiently transfected with constructs encoding for the indicated LAP1B-GFP derivatives, either alone or together with Tor1B-mRFP. After 48 hr, cells were fixed and analyzed by confocal microscopy. Scale bar, 10 μm. (F) The fraction of cells with NE aberrations was quantified as in C (N = 3, n > 114, mean +/- SEM).

Figure 3—figure supplement 1
Nuclear envelope (NE) aberrations induced by LAP1B cannot be rescued by LULL1 co-expression.

(A) HeLa cells were transfected with constructs encoding for LAP1B-GFP, either alone or together with LULL1-HASt and Tor1B-mRFP expression vectors. Cell were fixed 48 hr after transfection and nuclear morphology analyzed by confocal microscopy. Scale bar, 10 μm. (B) Quantification of NE aberrations in cells with similar LAP1B-GFP expression levels as in Figure 3 (N = 3, n > 99, mean +/- SEM).

Mobility of LAP1B at the nuclear envelope (NE) of interphase cells is influenced by Torsins.

(A) FRAP analysis of HeLa cells expressing either wildtype LAP1B-GFP or the indicated mutant variants and treated with a control siRNA (N = 5, n > 18, mean +/- SD). (B) FRAP analysis as in B after RNAi-mediated co-depletion lamin A/C and lamin B1 (N = 5, n > 21, mean +/- SD). Corresponding mobile fractions (mean +/- SEM, *p<0.05). (C) FRAP analysis of LAP1B-GFP and the chromatin-binding deficient variants in cells expressing either Tor1B wild-type or the dominant-negative Tor1B(E178Q) mutant both tagged with mRFP, and treated with a control siRNA (N = 4, n > 18, mean +/- SD). (D) FRAP analysis in lamin-depleted cells as in C (N = 4, n > 25, mean +/- SD). Corresponding mobile fractions (mean +/-, *p<0.05).

LAP1B mutants deficient in Torsin activation lead to increased binucleation dependent on chromatin interaction of LAP1.

(A) Expression of LAP1B(1-359)-GFP was induced with 0.01 μg/ml tetracycline and expression of LAP1B-GFP wild-type, LAP1(R563G)-GFP and LAP1(E482A)-GFP with 1 μg/ml tetracycline for 48 hr. The parental HeLa cell line was used as a negative control. Then, cells were fixed, immunostained for tubulin and analyzed by confocal microscopy. Scale bar, 10 μm. White arrows denote binucleated cells. (B) Images representing the categories used for classification of binucleation. (C) Quantification of the fraction of binucleated cells (N = 3, n > 540, mean +/- SEM). (D) The integrated density (IntDen) of the GFP signal was measured and normalized to LAP1B-GFP. (E) Binucleation caused by LAP1B is prevented by point mutations that abolish chromatin-binding. Expression of LAP1B(1-359)-GFP or LAP1B(1-359-2E)-GFP was induced with tetracycline (0.01 μg/ml and 1 μg/ml, respectively) in stable HeLa cell lines for 48 hr. Cells were immunostained for tubulin and counterstained with Hoechst. Binucleated cells were quantified (N = 3, n > 300, mean +/- SEM; ****p<0.0001). Expression levels of LAP1B(1-359)-GFP and LAP1B(1-359-2E)-GFP were compared by immunoblotting. (F) LAP1B(1-359)-GFP expression was induced for 48 hr as in E in either mock-treated or in lamin A/C and lamin B1-co-depleted cells (RNAi for 72 hr, induction of LAP1B constructs for the last 48 hr). Cells fixed and analyzed as in E. The number of binucleated cells was quantified (N = 3, n > 383, mean +/- SEM). LAP1B(1-359)-GFP expression levels were determined based on the integrated GFP intensity (IntDen). Lamin RNAi was controlled by immunofluorescence. Scale bars, 10 μm.

Figure 6 with 2 supplements
A dominant-negative, ATPase-deficient Torsin1B mutant increases binucleation in a LAP1-dependent manner.

(A) Endogenous LAP1 remains associated with chromatin in metaphase upon overexpression of Tor1B(E178Q)-GFP. Representative maximum intensity projections (5 × 0.63 μm) of confocal images of metaphase HeLa cells upon induction of either Tor1B-GFP and Tor1B(E178Q)-GFP expression with 1 μg/ μl tetracycline for 48 hr. Localization of endogenous LAP1 was analyzed by immunofluorescence staining. Scale bar, 5 μm. (B) Confocal images of Tor1B-GFP and Tor1B(E178Q)-GFP-expressing cells stained with Hoechst and immunostained for tubulin. Scale bar, 10 μm. Quantification of binucleated cells (N = 3, n > 835, mean +/- SD). (C) Expression of Tor1B(E178Q)-GFP was induced for 48 hr in LAP1-depleted or mock-treated cells. Binucleation was analyzed by confocal microscopy and quantified (N = 3, n > 1915, mean+/-SEM). Scale bar, 10 μm. (D) Quantification of chromosome segregation defects (DNA bridges and lagging chromosomes) in fixed GFP-KDEL, Tor1B-GFP, and Tor1B(E178Q)-GFP expressing anaphase cells after 24 hr of induction with tetracycline. Segregation errors were manually quantified (N = 3, n > 130, mean+/-SEM).

Figure 6—figure supplement 1
Expression of a dominant-negative Torsin1B variant leads to an increase in binucleated cells in a LAP1-dependent manner.

(A) Expression of Tor1B(E178Q)-GFP was induced for 48 hr in LAP1-depleted cells (1 μg/ml tet) and control siRNA-treated cells (0.1 μg/ml and 0.02 μg/ml tet). Scale bar, 10 μm. (B) Quantification of binucleated cells (N = 3, n > 631, mean+/-SEM). (C) Quantitative western blot analysis of Tor1B(E178Q)-GFP levels relative to actin for depicted conditions.

Figure 6—figure supplement 2
Downregulation of LULL1 does not prevent Tor1B(E178Q)-induced binucleation.

(A) Expression of Tor1B(E178Q)-GFP was induced for 48 hr in control or LULL1-depleted cells. Binucleation was quantified as in Figures 56 (N = 3, n > 631, mean+/-SEM). Scale bar, 10 μm. (B) Depletion of LAP1 (I) and LULL1 (II) was controlled by immunofluorescence. Tor1B(E178Q)-GFP was expressed at comparable levels as shown by immunoblotting in panel D. (C) Localization of endogenous LAP1 at metaphase chromatin upon overexpression of Tor1B(E178Q)-GFP disappears upon LAP1 depletion, but is not influenced by LULL1 depletion. Representative confocal images (maximal z-projections: 5 × 0.63 μm) of metaphase HeLa cells with TorsinB-E178Q-GFP expression. Localization of LAP1 was analyzed by immunofluorescence staining. Scale bar, 5 μm. (D) Western blot analysis of Tor1B(E178Q)-GFP levels after LAP1 or LULL1 depletion.

Videos

Video 1
Time-lapse imaging of a LAP1B-GFP expressing cell progressing through mitosis.

Expression of LAP1B-GFP was induced 24 hr prior to imaging. DNA was visualized by SirHoechst. The movie starts 68 min before anaphase onset. Note that nuclear envelope (NE) aberrations manifest upon NE reformation after mitosis and persist.

Video 2
Time-lapse imaging of a LAP2β-GFP expressing cell progressing through mitosis.

Expression of LAP2β-GFP was induced 24 hr prior to imaging. DNA was visualized by SirHoechst. The movie starts 68 min before anaphase onset. Note that the nuclear envelope (NE) rapidly adopts a smooth topology soon after NE reformation.

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP2β-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1C-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(1-359)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(E482A)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(R563G)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(1-359, S108E, T124E)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx Tor1B-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx Tor1B(E178Q)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx(Hafner et al., 2014)
DOI:10.1038/ncomms5397
Obtained from T. Maier (University Konstanz).
Cell line (Homo sapiens)HeLa KyotootherRRID:CVCL_1922Obtained from D. Gerlich (IMBA, Vienna).
Cell line (Homo sapiens)HeLa Gromeier
LMN A/C KO
This paperSee Materials and methods, Cell lines, antibodies, and reagents antibodies, and reagents
Cell line (Homo sapiens)HCT116otherRRID:CVCL_0291
Obtained from B. Vogelstein (Johns Hopkins, Baltimore, USA)
Cell line (Homo sapiens)HepG2otherRRID:CVCL_0027
Obtained from S. Werner (Institute of Molecular Health Science, Zurich)
Transfected construct (human)si-ControlQiagenCat# 1027281Allstars siRNA
Transfected construct (human)si-lamin A/CMicrosynth (Hasan et al., 2006) DOI: 10.1016/j.febslet.2006.01.0395’- CUGGACUUCCAGAAGAACA -3’
Transfected construct (human)si-lamin B1Sigma (Hasan et al., 2006) DOI: 10.1016/j.febslet.2006.01.0395’- UUCCGCCUCAGCCACUGGAAAU -3’
Transfected construct (human)si-lamin B2Microsynth5’- ACAACUCGGACAAGGAUC -3’
Transfected construct (human)si-LAP1Qiagen/Microsynth5’- CUCACUAAGUUUCCUGAGUUA- 3’
Transfected construct (human)si-LULL1Qiagen/Microsynth5’- CTGGTCCTGACTGTTCTGCTA -3’
Transfected construct (human)si-Tor1AQiagen/Microsynth5’- CACCAAGTTAGATTATTACTA-3’
Transfected construct (human)si-Tor1BQiagen/Microsynth5’- CTGTCGGAGTCTTCAATAATA-3’
Antibodyanti-β-actin
(mouse monoclonal)
SigmaCat# A1978
RRID:AB_476692
WB(1:40’000)
Antibodyanti-emerin
(rabbit polyclonal)
AbcamCat# ab40688
RRID:AB_2100059
WB(1:1000)
Antibodyanti-HA
(mouse monoclonal)
CovanceCat# MMS-101P
RRID:AB_2314672
IF(1:3000)
WB(1:3000)
Antibodyanti-lamin A/C
(mouse monoclonal)
ImmuQuestCat# IQ332
RRID:AB_10660272
IF(1:200)
WB (1:200)
Antibodyanti-lamin A/C (rabbit polyclonal)Proteintech
Cat# 10298-1-AP
RRID:AB_2296961
IF(1:500)
Antibodyanti-lamin B1
(rabbit polyclonal)
AbcamCat# ab16048
RRID:AB_443298
IF(1:2000)
WB(1:1000)
Antibodyanti-lamin B2
(rabbit monoclonal)
AbcamCat# ab151735
RRID:AB_2827514
IF (1:1000)
WB(1:1000)
Antibodyanti-LAP1
(rabbit polyclonal)
AbcamCat# ab86307
RRID:AB_2206124
IF(1:500)
WB(1:300)
Antibodyanti-LBR
(rabbit polyclonal)
AbnovaCat# PAB15583
RRID:AB_10696691
IF(1:1000)
Antibodyanti-mAB414 (mouse monoclonal)AbcamCat# ab 24609
RRID:AB_448181
IF(1:20000)
Antibodyanti-H3
(rabbit polyclonal)
AbcamCat# ab1791
RRID:AB_302613
WB(1:5000)
Antibodyanti-Tor1A
(rabbit polyclonal)
AbexxaCat# abx001683
WB(1:500)
Antibodyanti-Tor1B
(rabbit polyclonal)
antibodies-onlineCat# ABIN1860834
WB(1:500)
Antibodyanti-α-tubulin (mouse monoclonal)SigmaCat# T5168
RRID:AB_477579
WB(1:20000) IF(1:20000)
Antibodyanti-GAPDH (mouse monoclonal)AbcamCat# ab8245
RRID:AB_2107448
WB(1:10000)
Antibodyanti-LULL1
(rabbit polyclonal)
This paperIF (1:500)
See Materials and methods, Cell lines, antibodies, and reagents
Antibodyanti-SUN1
(rabbit polyclonal)
(Sosa et al., 2012) DOI: 10.1083/jcb.200904048IF(1:1000)
Antibodyanti-SUN2
(rabbit polyclonal)
(Turgay et al., 2010) DOI: 10.1261/rna.2325911IF(1:2000)
Antibodyanti-GFP
(rabbit polyclonal)
(Turgay et al., 2010) DOI: 10.1261/rna.2325911IF(1:1000)
WB(1:1000)
Recombinant DNA reagentpcDNA5/FRT/TO/LAP1B-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/LAP1C-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(1-72)-GST-EGFP
This paperLAP1: aa 1-72
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(1-183)-GST-EGFP
This paperLAP1: aa 1-183
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(98-136)-GST-EGFP
This paperLAP1: aa 98-136
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(184-337)-GST-EGFP
This paperLAP1: aa 184-337
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1B(Δ98-136)-EGFP
This paperLAP1: aa Δ98-136
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ LAP1B(1-359)-2E-EGFPThis paperLAP1: aa 1-359, S108E, T124E
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ LAP1B(1-359)-EGFPThis paperLAP1: aa 1-359, See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1A-cTAPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1A-cTAPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1B-cTAP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1B(E178Q)-cTAPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ LAP1B(R563G)-EGFPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/LAP1B-E482A-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
Tor1B-mRFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
Tor1B(E178Q)-mRFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
Tor1B-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
Tor1B(E178Q)-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1B(S108E,T124E)-EGFP
This paperS108E, T124E
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1B(S108E, T124E, R563G)-EGFP
This paperS108E, T124E, R563G
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7-GST-GFP(Ungricht et al., 2015a) DOI: 10.1007/978-1-4939-3530-7_28See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
NLS-GST-EGFP
(Erkmann et al., 2005) DOI: 10.1091/mbc.e04-11-1023See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(1-121)-GST-EGFP
This paperLAP1: aa 1-121,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(73-183)-GST-EGFP
This paperLAP1: aa 73-183,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(122-183)-GST-EGFP-NLS
This paperLAP1: aa 122-183,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(73-337)-GST-EGFP
This paperLAP1: aa 73-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(122-337)-GST-EGFP
This paperLAP1: aa 122-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1B(1-337)-GST-EGFP
This paperLAP1: aa 1-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(1-72) GST-EGFP-NLS
This paperLAP1: aa 1-72,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(122-183)-GST-EGFP-NLS
This paperLAP1: aa 122-183,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(73-337) GST-EGFP-NLS
This paperLAP1: aa 73-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(184-337) GST-EGFP-NLS
This paperLAP1: aa 184-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP1B -EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
EMD-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP2β-EGFP
(Ungricht et al., 2015a) DOI: 10.1007/978-1-4939-3530-7_28See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LEM2-EGFP
This paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
SUN1-EGFP
(Turgay et al., 2010) DOI: 10.1261/rna.2325911See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
SUN2-EGFP
(Turgay et al., 2010) DOI: 10.1261/rna.2325911See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3-SPAG4-GFP(Turgay et al., 2010) DOI: 10.1261/rna.2325911See Materials and Methods, Molecular cloning
Recombinant DNA reagentLAP1(98-136)-SPAG4-EGFPThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentLAP1(98-136_2E)-SPAG4-EGFPThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentLAP1(98-136_3E)-SPAG4-EGFPThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentLULL1-HAStThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpCMV/ER/myc EGFP-KDEL(Ungricht et al., 2015a) DOI: 10.1007/978-1-4939-3530-7_28 See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP1B(72-end)-EGFP
This paperLAP1: aa 72-583,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP1B(184-end)-EGFP
This paperLAP1: aa 184-583,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP1C(Δ122-136) EGFP
This paperLAP1: aa Δ122-136,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1C(T124E)-EGFP
This paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1B(184-end R563G)-EGFP
This paperLAP1: aa 184-583,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP1(R563G)-EGFP
This paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(1-97)-GST-GFP
This paperLAP1: aa 1-97,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(137-337)-GST-GFP
This paperLAP1: aa 137-337,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpQE60zz-His6(Sosa et al., 2012)
DOI: 10.1016/j.cell.2012.03.046
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpQE60zz-LAP1B(98-136)-His6This paperLAP1: aa 98-136,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpQE60zz-His6
zz-LAP1B(98-136)-2E His6
This paperLAP1: aa 98-136,
S108E, T124E
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpC2P(Welte et al., 2019) DOI: 10.1101/gad.328492.119
Recombinant DNA reagentpC2P-gLMNA/CThis paperProtospacer: 5’- CACCGGGTGGCGCGCCGCTGGGACG -3’
See Materials and Methods, Generation of LMN A/C knockout cells
Chemical compound, drugSIR-HoechstSpirochromeCat# SC007
Chemical compound, drugHoechstInvitrogenCat# 63493
Chemical compound, drugDTTApplichemCat# A1101
Chemical compound, drugnocodazoleSigma-AldrichCat# M1404
Chemical compound, drugthymidineSigma-AldrichCat #T1895
Chemical compound, drugtetracyclineInvitrogenCat# 550205

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)