Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1

  1. Naemi Luithle
  2. Jelmi uit de Bos
  3. Ruud Hovius
  4. Daria Maslennikova
  5. Renard TM Lewis
  6. Rosemarie Ungricht
  7. Beat Fierz
  8. Ulrike Kutay  Is a corresponding author
  1. Institute of Biochemistry, Department of Biology, ETH Zurich, Switzerland
  2. Molecular Life Sciences Ph.D. Program, Switzerland
  3. Institute of Chemical Sciences and Engineering - ISIC, EPFL, Switzerland


The inner nuclear membrane is functionalized by diverse transmembrane proteins that associate with nuclear lamins and/or chromatin. When cells enter mitosis, membrane-chromatin contacts must be broken to allow for proper chromosome segregation; yet how this occurs remains ill-understood. Unexpectedly, we observed that an imbalance in the levels of the lamina-associated polypeptide 1 (LAP1), an activator of ER-resident Torsin AAA+-ATPases, causes a failure in membrane removal from mitotic chromatin, accompanied by chromosome segregation errors and changes in post-mitotic nuclear morphology. These defects are dependent on a hitherto unknown chromatin-binding region of LAP1 that we have delineated. LAP1-induced NE abnormalities are efficiently suppressed by expression of wild-type but not ATPase-deficient Torsins. Furthermore, a dominant-negative Torsin induces chromosome segregation defects in a LAP1-dependent manner. These results indicate that association of LAP1 with chromatin in the nucleus can be modulated by Torsins in the perinuclear space, shedding new light on the LAP1-Torsin interplay.


In all eukaryotes, a double membrane barrier termed nuclear envelope (NE) serves as the boundary of the nuclear compartment that safeguards the genetic information. The NE is built by a large chromatin-attached membrane sheet of the endoplasmic reticulum (ER). Despite the connectivity of the NE-ER membrane network, the inner nuclear membrane (INM) contains a unique set of transmembrane proteins (Holmer and Worman, 2001; Ungricht and Kutay, 2015b). In general, enrichment of these membrane proteins from the peripheral ER at the nuclear face of the NE relies on several domains or short linear motifs in their extralumenal domains that together ensure retention on nuclear partners such as nuclear lamins, chromatin-associated factors or DNA (Boni et al., 2015; Powell and Burke, 1990; Ungricht et al., 2015a). While the interaction of INM proteins with the nuclear lamina is restricted to lamin-expressing metazoan cells and certain protists, chromatin is the principal binding partner of INM proteins in all eukaryotes. The association of INM proteins with chromatin is functionally important, being it for the formation of gametes, for development or differentiation, exemplified by the NE-based pairing of homologous chromosomes during meiosis, or the progressive enrichment of transcriptionally repressed chromatin domains at the nuclear periphery of differentiating metazoan cells (Ungricht and Kutay, 2017).

How INM proteins associate with chromatin is best understood for cases in which folded domains are used for chromatin binding. The lamin B receptor (LBR), for example, contains an N-terminal tudor domain for interaction with the epigenetically marked tail of histone H4 as well as structurally less-defined regions for association with DNA and HP1 (Hirano et al., 2012). Some INM proteins contain short bihelical motifs for chromatin interaction such as the LEM (LAP2-emerin-MAN1) domain, which binds the chromatin factor BAF, or related motifs that bind DNA directly (Barton et al., 2015; Brachner and Foisner, 2011). The interaction of other mammalian INM proteins with chromatin is less understood. Biochemical experiments suggest that many INM proteins might even interact with DNA directly (Ulbert et al., 2006).

In cells undergoing open mitosis, the entire nuclear compartment is disintegrated by NE breakdown (NEBD), which liberates chromosomes from confinement by the nuclear membrane (Champion et al., 2017). In the course of prophase, the multifaceted interactions between INM proteins, chromatin, and nuclear lamins are broken, allowing for the separation of membranes from chromatin and the partitioning of INM proteins into the mitotic ER network (Ellenberg et al., 1997; Yang et al., 1997). Exploiting a synthetic membrane–chromatin tethering system, we recently demonstrated that failed removal of membranes from chromatin impairs mitotic chromatin organization, chromosome segregation and cytokinesis, and perturbs post-mitotic nuclear morphology (Champion et al., 2019). Notably, also in yeasts with closed mitosis, the detachment of chromosomes from the NE is required for faithful chromosome segregation (Titos et al., 2014). It is generally assumed that changes in posttranslational modifications of INM proteins and chromatin-associated factors, especially protein phosphorylation, induce membrane dissociation from chromatin during mitotic entry. In strong support of this view, many mammalian INM proteins are phosphorylated in their nucleoplasmic domains by CDK1 or other abundant mitotic kinases during mitotic entry (Güttinger et al., 2009). Also chromatin-associated interaction partners of INM proteins such as BAF are released from chromatin by mitotic phosphorylation (Samwer et al., 2017). After prophase, multiple mechanisms ensure that the ER does not re-associate with chromatin prematurely, before NE reformation starts in late anaphase (Champion et al., 2019).

When studying the release of membrane proteins from chromatin during mitotic entry in cultured human somatic cells, we observed that an increased cellular level of one specific INM protein, the lamina-associated polypeptide 1 (LAP1), caused a failure in membrane removal from chromatin in mitosis. This observation not only indicated that LAP1 is a novel chromatin-binding INM protein but also suggested that some cellular factor(s) might have become limiting for breaking mitotic LAP1-chromatin contacts. LAP1 is an INM-localized activator of Torsins; the only known AAA+ ATPases residing in the lumen of the ER and the continuous perinuclear space (Brown et al., 2014; Goodchild and Dauer, 2005; Laudermilch and Schlieker, 2016; Sosa et al., 2014). Although neither the precise biological role nor the substrates of Torsins are known, loss of Torsin functionality causes changes in NE morphology (Goodchild et al., 2005), pointing toward a role at the NE. Mutations in TOR1A, the predominant Torsin isoform expressed in the brain (Jungwirth et al., 2010), lead to a severe movement disorder termed early-onset dystonia (DYT1) (Ozelius et al., 1997). Notably, also mutations in the LAP1 gene, which is ubiquitously expressed in the human body, have been linked to primary dystonia as well as to cardiomyopathy, cerebellar atrophy, and cancer (Dorboz et al., 2014; Fichtman et al., 2019; Kayman-Kurekci et al., 2014; Rebelo et al., 2015).

In our experiments, persistence of LAP1 on mitotic chromatin was accompanied by changes in post-mitotic NE morphology and cell division errors, reminiscent of defects that we had previously reported for a synthetic membrane–chromatin tether, which prevents mitotic chromatin release. Strikingly, overexpression of wild-type but not of ATPase-deficient Torsins efficiently suppressed LAP1-induced NE abnormalities. Furthermore, a dominant-negative Torsin induced chromosome segregation defects in a LAP1-dependent manner, suggesting that LAP1 association with chromatin is modulated by Torsin ATPases residing in the perinuclear space and ER lumen. Collectively, our results underscore the importance of dissolving INM protein-chromatin interactions for mitotic fidelity and suggest that LAP1 may not merely be important for Torsin ATPase activation but itself subject to Torsin regulation across the INM.


Increased levels of LAP1 impair the dissolution of LAP1–chromatin contacts during mitosis

Although it is generally assumed that changes in posttranslational modifications of INM proteins and chromatin-associated factors, especially protein phosphorylation, induce membrane dissociation from chromatin during mitotic entry, direct evidence in support of this hypothesis in living cells is lacking and our molecular understanding of the process is limited. Here, we set out to gain new insights into the mechanisms required for dissociation of INM proteins from chromatin. In a first step, we tested whether it is possible to impair the release of the NE membranes from mitotic chromatin if any cellular factor involved in dissolving INM protein-chromatin contacts would become limiting by a disturbed ratio between INM proteins and the potential release factor(s). Thus, we overexpressed several abundant INM proteins, including emerin, SUN1, SUN2, LAP2β, LEM2, and LAP1 in HeLa cells by transiently transfecting the respective expression vectors. Remarkably, overexpression of LAP1B, the longest human isoform of LAP1, led to severe NE aberrations, while overexpression of other INM proteins did not cause similar defects (Figure 1A). Interestingly, the LAP1-induced NE aberrations were observed in the vast majority of cells when analyzed after 48 hr, whereas most cells still displayed a normal nuclear morphology after 24 hr, perhaps because more cells had progressed through mitosis in presence of LAP1 at the later time point. Changes in NE morphology upon LAP1B expression were also evident in other cell types such as HCT116 or HepG2 cells (Figure 1—figure supplement 1A). The LAP1B-induced NE aberrations were reminiscent of those that we had previously observed using a synthetic membrane–chromatin tethering system that prevents the release of the NE/ER network from chromatin during mitosis (Champion et al., 2019).

Figure 1 with 2 supplements see all
Overexpression of LAP1B and LAP1C causes post-mitotic nuclear envelope (NE) aberrations.

(A) Vectors encoding the indicated inner nuclear membrane (INM) proteins were transfected into HeLa cells. Cells were fixed after 24 or 48 hr and analyzed by confocal microscopy. Scale bar, 10 μm. (B) Time-lapse images of LAP1B-GFP or LAP2β-GFP expressing HeLa cells progressing through mitosis. Expression of the constructs was induced 24 hr prior to imaging. DNA was visualized by SirHoechst and used to define anaphase onset (t = 00:00 hr:min). Scale bar, 5 μm. (C) Scheme depicting the two human LAP1 isoforms, LAP1B and LAP1C. (D) Representative images of stable HeLa cells lines expressing LAP1B-GFP and LAP1C-GFP after induction with different tetracycline (tet) concentrations for 48 hr. Please note that we observed some ‘twin’ nuclei upon overexpression of LAP1B (white arrow), which can be a sign of binucleation, as further analyzed in Figure 5. Scale bar, 10 μm. (E) LAP1 levels at the NE of cells from the experiment shown in panel D were analyzed by quantification of the integrated GFP density (IntDen GFP) per nucleus. (F) LAP1 levels in cell lysates derived from the experiment shown in panel D were analyzed by immunoblotting. Note that the LAP1B-GFP cell line expressed LAP1C-GFP independent of tetracycline addition, due to an alternative transcriptional start site used for the production of the shorter LAP1 isoform (Santos et al., 2014). (G) Left: Maximum intensity z-projections (5 × 0.63 μm) of confocal images from fixed metaphase HeLa cells expressing LAP1B-GFP or LAP1C-GFP after 48 hr of induction. Scale bar, 5 μm. Right: Confocal images of fixed HeLa cells in interphase. Scale bar, 10 μm.

To analyze whether these NE aberrations indeed originated from failed release of LAP1B and thereby membranes from chromatin during mitosis, we performed time-lapse imaging of cells expressing similar levels of either LAP1B-GFP or LAP2β-GFP (Figure 1B, Figure 1—figure supplement 1B). Before mitotic entry, nuclei of LAP1B-GFP expressing cells exhibited a normal round shape (Figure 1B, Video 1). Strikingly, throughout mitosis, LAP1B-GFP remained associated with chromatin, and after NE reassembly, both daughter cells exhibited severe nuclear deformations. In contrast, LAP2β-GFP was faithfully released into the mitotic ER, and post-mitotic nuclei of LAP2β-GFP-expressing cells possessed a round unperturbed morphology (Figure 1B, Video 2).

Video 1
Time-lapse imaging of a LAP1B-GFP expressing cell progressing through mitosis.

Expression of LAP1B-GFP was induced 24 hr prior to imaging. DNA was visualized by SirHoechst. The movie starts 68 min before anaphase onset. Note that nuclear envelope (NE) aberrations manifest upon NE reformation after mitosis and persist.

Video 2
Time-lapse imaging of a LAP2β-GFP expressing cell progressing through mitosis.

Expression of LAP2β-GFP was induced 24 hr prior to imaging. DNA was visualized by SirHoechst. The movie starts 68 min before anaphase onset. Note that the nuclear envelope (NE) rapidly adopts a smooth topology soon after NE reformation.

To address how the observed phenotype relates to increasing expression levels of LAP1, we used tetracycline-inducible HeLa cells to tune the amount of LAP1B-GFP. In these experiments, we also included LAP1C, the second isoform of human LAP1 (Figure 1C). LAP1C is produced from a shorter transcript and starts at an alternative translational start site (Met 122), leading to an isoform that is N-terminally truncated by 121 amino residues (Figure 1C; Santos et al., 2014). Cells were analyzed by confocal microscopy 48 hr after tetracycline induction (Figure 1D), and expression levels were examined by quantification of GFP intensity (Figure 1E) and immunoblotting (Figure 1F). The severity of the NE aberrations indeed increased with rising expression levels for both LAP1B-GFP and LAP1C-GFP (Figure 1D, E, F); however, they were more pronounced for LAP1B when comparing cells with a similar expression level of both isoforms. We also inspected fixed cells for an association of membranes with chromatin during metaphase (Figure 1G). Both GFP-tagged LAP1 isoforms were enriched at mitotic chromatin; however, the enrichment of LAP1B-GFP was more prominent, indicating a stronger retention of the longer isoform on mitotic chromatin.

To exclude that persistent LAP1–chromatin contacts affect the mitotic localization of endogenous NE proteins, we fixed uninduced and induced LAP1B-GFP cells, and immunostained for nuclear lamins and multiple INM proteins (Figure 1—figure supplement 1C). Analysis of metaphase cells revealed that of the tested INM proteins only LAP1B-GFP was strongly enriched at mitotic chromatin. Taken together, overexpression of both human LAP1 isoforms results in their failed removal from mitotic chromatin and cells display an aberrant post-mitotic nuclear morphology, whereas overexpression of other INM proteins at comparable expression levels does not cause similar phenotypes.

The molecular architecture of the nucleoplasmic domain of LAP1

LAP1 has originally been identified as an INM protein that interacts with nuclear lamins (Foisner and Gerace, 1993; Senior and Gerace, 1988), yet the molecular architecture of its nucleoplasmic domain remains poorly characterized. Fluorescence recovery after photobleaching (FRAP) experiments previously revealed an extremely low diffusional mobility of LAP1B at the INM (Zuleger et al., 2011), but how it is so strongly immobilized at the INM remained to be determined. As overexpressed LAP1B-GFP was associated with chromatin during mitosis, we reasoned that interaction with both chromatin and nuclear lamins may anchor LAP1B at the INM. Our FRAP experiments confirmed that LAP1B-GFP is a highly immobile INM protein (Figure 1—figure supplement 2A). In contrast, LAP1C-GFP was more mobile, showing a recovery curve similar to LAP2β-GFP.

To elucidate which lamins contribute to the retention of LAP1 at the NE, we examined the diffusional mobility of LAP1B-GFP and LAP1C-GFP after RNAi-mediated depletion of lamin A/C, lamin B1, or lamin B2 by FRAP (Figure 1—figure supplement 2B, C). Downregulation of lamin A/C and lamin B1, but not of lamin B2, led to an increase in the diffusional mobility of LAP1B at the NE. The combined depletion of lamin A/C and lamin B1 had an even stronger effect, indicating that both A- and B-type lamins contribute to retention of LAP1B at the INM. For LAP1C, only the loss of lamin A/C had a prominent effect on its mobility, suggesting that A-type lamins play a major role in retention of the shorter isoform at the INM.

The extraluminal domain of LAP1B is predicted to be largely intrinsically disordered (Figure 2—figure supplement 1A), and we set out to delineate its chromatin and lamina-binding regions. By truncation analysis, we loosely delineated two regions in LAP1B that are sufficient for lamina association; an N-terminal fragment of 72 amino acids and a second region comprising residues 184–337 (Figure 2—figure supplement 1B, C, D, E, F). To define which part of LAP1 interacts with chromatin, we analyzed the mitotic localization of soluble LAP1B fragments fused to GST-GFP (Figure 2A, B, Figure 2—figure supplement 1A, B). Whereas the N-terminal part (aa 1–183) of LAP1B localized to the metaphase plate, LAP1B(184-337)-GST-GFP was distributed throughout the mitotic cytoplasm. By testing further truncations, we mapped the chromatin-binding region (CBR) of LAP1B to residues 98–136 (Figure 2B). This protein fragment was very efficiently enriched on chromatin throughout mitosis (Figure 2C) and is sufficient for chromatin interaction. Importantly, deletion of the CBR from full-length, membrane-bound LAP1B-GFP abolished its association with chromatin during mitosis (Figure 2D).

Figure 2 with 3 supplements see all
The nucleoplasmic domain of LAP1 contains a central chromatin-binding region (CBR) that can confer chromatin association during mitosis.

(A) Scheme depicting the generated fragments of the nucleoplasmic domain of LAP1B. (B) Metaphase localization of the depicted LAP1 fragments, transiently expressed in synchronized HeLa cells. Maximum intensity z-projections (3 × 1 μm). Scale bar, 5 μm. (C) Localization of LAP1(CBR)-GST-GFP during mitosis in HeLa cells. Scale bar, 5 μm. (D) LAP1B-GFP and LAP1B(ΔCBR)-GFP localization during metaphase. Scale bar, 5 μm. (E) Localization of wild-type SPAG4-GFP and (F) LAP1B(98-136)-SPAG4-GFP derivatives in interphase and prometaphase cells (arrested with nocodazole for 3 hr) 48 hr after transfection. Scale bars, 10 μm (upper panels) and 5 μm (lower panels). (G) Alignment of sequences of the CBR of LAP1B from the indicated mammalian species. The three mutated residues are boxed in red. (H) Left: Interphase HeLa cells expressing LAP1B-GFP or LAP1B(ΔCBR)-GFP for 48 hr. Scale bar, 10 μm. Middle and right: Percentage of nuclei with nuclear envelope (NE) aberrations, quantified as in Figure 3, in cells expressing LAP1B-GFP or LAP1B(ΔCBR)-GFP at similar levels, based on the integrated GFP density (IntDen GFP) (N = 3, n > 264, mean +/- SEM).

Next, we examined whether the CBR contributes to NE localization of LAP1B during interphase. To do so, we chose a domain transfer approach, fusing the CBR of LAP1B to the ER-localized protein SPAG4, as we did before when delineating NE targeting motifs of other INM proteins (Turgay et al., 2010). Consistent with our assumption that chromatin-binding contributes to the retention of LAP1B at the INM, the CBR was sufficient to target the CBR-SPAG4-GFP fusion protein to the NE (Figure 2E). Finally, we tested whether the CBR can interact with chromatin directly by performing electrophoretic mobility shifts assays (EMSAs), revealing that the purified recombinant CBR can interact with reconstituted nucleosomes and even naked DNA (Figure 2—figure supplement 2C, D).

Collectively, our mapping experiments delineated three regions within the disordered nucleoplasmic domain of LAP1B that confer interaction with nuclear components: two regions that confer association with the nuclear lamina (aa 1–72 and 184–337) and a central region that is sufficient for chromatin interaction (CBR, aa 98–138; Figure 2G). The multiple regions of LAP1 used for interaction with nuclear partners can very well explain the strong retention of LAP1B at the INM by binding avidity.

The CBR is required for induction of LAP1-induced NE aberrations

To test whether chromatin interaction of the CBR is required for the post-mitotic NE aberrations induced by LAP1B expression, we analyzed the nuclear shape of cells upon expression of either LAP1B-GFP or LAP1B(ΔCBR)-GFP 48 hr after transfection of the respective constructs. Strikingly, deletion of the CBR abolished the occurrence of NE aberrations (Figure 2H).

To pinpoint residues within the CBR that contribute to mitotic chromatin association, we mutated conserved Ser and Thr residues within the CBR (Figure 2G). With this approach, we identified two residues (S108 and T124) that if mutated to glutamate affected NE localization of the LAP1(98–136)-SPAG4-GFP fusion protein during interphase (Figure 2E), abolished its binding to chromatin in metaphase (Figure 2E) and reduced its affinity for DNA and mononucleosomes in vitro (Figure 2—figure supplement 2C, D). Although these Ser and Thr residues could in principle be subject to mitotic phosphorylation, we have so far been unable to confirm mitotic phosphorylation of these sites. Comparison of the diffusional mobility of full-length LAP1B-GFP with LAP1B(ΔCBR)-GFP and LAP1B-2E(S108E,T124E)-GFP demonstrated that both mutant constructs exhibited a higher mobility at the NE, highlighting the contribution of the CBR and the identified residues to the retention of LAP1B at the INM (Figure 2—figure supplement 3A, B). Importantly, when we introduced both mutations into the membrane-bound, nucleoplasmic domain of LAP1B in the construct LAP1(1-359-2E)-GFP, binding to mitotic chromatin and post-mitotic NE aberrations were fully abolished (Figure 2F). Taken together, this data shows that chromatin-binding contributes to the retention of LAP1 at the NE and identifies two residues (S108 and T124) that are essential for chromatin binding of LAP1B during mitosis. Importantly, this establishes a direct link between the CBR and post-mitotic NE aberrations.

LAP1B-induced NE aberrations can be rescued by Torsin co-expression

LAP1 is an established activator of Torsin AAA+ ATPase family members, that is of Torsin1A (Tor1A) and Torsin1B (Tor1B) (Brown et al., 2014; Sosa et al., 2014). The persistent chromatin association of overexpressed LAP1B during mitosis prompted us to examine whether restoring a normal LAP1B to Torsin ratio by co-overexpression of these proteins would rescue NE shape defects. We transiently expressed LAP1B-GFP alone or together with either Tor1A or Tor1B, both C-terminally tagged with an HA-Strep tag, and analyzed the percentage of cells containing NE aberrations two days after transfection. For quantification, we binned cells into a window of comparable fluorescence intensities to exclude an influence of varying LAP1B expression levels. Indeed, co-expression of either Torsin led to a striking decrease in NE aberrations (Figure 3A, B, C). In the following, we continued our work with Tor1B, since it had been previously demonstrated that its in vitro ATPase activity can be more potently stimulated by LAP1 than that of Tor1A (Zhao et al., 2013), indicating that Tor1B could be the more potent enzyme.

Figure 3 with 1 supplement see all
LAP1B-induced nuclear envelope (NE) aberrations can be rescued by co-expression of Torsins.

(A) HeLa cells were transiently transfected with constructs encoding for LAP1B-GFP or LAP1B(1-359), either alone or together with the depicted Torsin constructs. After 48 hr, cells were fixed, subjected to immunostaining of Torsins using an anti-HA antibody and analyzed by confocal microscopy. Scale bar, 10 μm. (B) Representative images of pre-defined classes of cell nuclei used for the classification of NE aberration phenotypes. Based on nuclear shape, cells were assigned into one of the five shown categories for the quantification in C. The two upper classes were regarded as normal (no; no NE aberration), and the three lower classes as aberrant (yes). Scale bar, 5 μm. (C) The percentage of cells with NE aberrations was quantified by assigning cells into one of five predefined phenotypic classes shown in B. (left; N = 3, n > 103, mean +/- SEM). Only cells with similar LAP1B-GFP expression levels, based on quantification of the integrated GFP density per cell (IntDen GFP, normalized to the LAP1B minus Torsin control; right) were considered. (D) Depiction of the mutant LAP1B constructs; R563G: Torsin activation deficient-mutant; E482A, disease-causing mutant. (E) HeLa cells were transiently transfected with constructs encoding for the indicated LAP1B-GFP derivatives, either alone or together with Tor1B-mRFP. After 48 hr, cells were fixed and analyzed by confocal microscopy. Scale bar, 10 μm. (F) The fraction of cells with NE aberrations was quantified as in C (N = 3, n > 114, mean +/- SEM).

To test whether the observed rescue depends on the ATPase activity of Tor1B, we utilized a well-characterized Glu to Gln mutation in the Walker B motif that prevents ATP hydrolysis but not ATP binding, and can be used to lock AAA+ ATPases on their substrates (Snider et al., 2008; Weibezahn et al., 2003). In the case of Torsins, the ATPase-deficient E to Q mutant traps Torsins on its activators LAP1 and LULL1 (an ER-resident LAP1 paralog), while substrates of Torsins have not been identified (Jungwirth et al., 2010; Rose et al., 2014; Zhao et al., 2013). In contrast to wild-type Torsins, Tor1B(E178Q)-HASt overexpression failed to rescue the NE aberrations caused by LAP1B-GFP, indicating that the enzymatic activity of Torsins is needed to prevent the LAP1B-induced phenotypes and not the LAP1B to Torsin ratio alone (Figure 3A, B, C). As expected, NE aberrations triggered by expression of LAP1B(1-359)-GFP, which lacks the luminal domain required for Torsin activation, were not rescued by Tor1B-HASt overexpression (Figure 3A, B, C). Similarly, Tor1B co-expression did not ameliorate NE aberrations caused by expression of LAP1B(R563G) (Figure 3E, F), a mutant inactivating the Arg-finger needed for stimulation of Torsin ATPase activity (Brown et al., 2014; Sosa et al., 2014). Another non-functional LAP1B mutant, E482A, known to cause severe dystonia, cerebellar atrophy and cardiomyopathy (Dorboz et al., 2014), also induced NE aberrations, which were not prevented by Torsin co-expression. Thus, Torsins can only act on LAP1 derivatives that are competent for the activation of its ATPase activity.

We also examined the influence of the ER-localized Torsin activator LULL1 as it had been suggested to regulate access of Torsins to the INM (Goodchild et al., 2015; Vander Heyden et al., 2009). However, expression of LULL1 did not improve the NE shape of LAP1B-GFP expressing cells (Figure 3—figure supplement 1). Taken together, the correct LAP1B to Torsin ratio and the functional interplay between LAP1B and Torsins ensure an unperturbed post-mitotic nuclear morphology.

Torsins influence the diffusional mobility of LAP1 at the NE

Given that Torsins are expressed in postmitotic, differentiated cells, we next set out to examine whether Torsins influence LAP1 dynamics at the NE during interphase.

Firstly, we compared the mobility of the Torsin activation-deficient mutant R563G and the disease-causing mutant E482A to wild-type LAP1B by FRAP. The E482A mutation has been suggested to impair folding of the luminal domain (Demircioglu et al., 2016). Since LAP1B is so strongly immobilized at the INM by binding to nuclear lamins and to chromatin, it was not surprising that no mobility changes were detected (Figure 4A). However, upon depletion of laminA/C and laminB1, it became apparent that both mutants were less mobile compared to the wild-type protein (Figure 4B). Secondly, to more directly test whether Torsins might influence the retention of LAP1 at the INM, we measured the mobility of LAP1B in Tor1B wild-type and Tor1B(E178Q)-expressing cells in the presence and absence of nuclear lamins (Figure 4C, D). The presence of the dominant-negative Torsin indeed significantly reduced the mobility of LAP1B-GFP in laminA/C and B1-depleted cells. Thirdly, to address how chromatin interaction by the CBR of LAP1B influences this behavior, we exploited the identified 2E mutant that reduces the affinity of the CBR for chromatin (Figure 2—figure supplement 2C, D). As expected, the LAP1-2E mutant was more mobile, and its mobility seemed less reduced by Tor1B(E178Q) expression.

Mobility of LAP1B at the nuclear envelope (NE) of interphase cells is influenced by Torsins.

(A) FRAP analysis of HeLa cells expressing either wildtype LAP1B-GFP or the indicated mutant variants and treated with a control siRNA (N = 5, n > 18, mean +/- SD). (B) FRAP analysis as in B after RNAi-mediated co-depletion lamin A/C and lamin B1 (N = 5, n > 21, mean +/- SD). Corresponding mobile fractions (mean +/- SEM, *p<0.05). (C) FRAP analysis of LAP1B-GFP and the chromatin-binding deficient variants in cells expressing either Tor1B wild-type or the dominant-negative Tor1B(E178Q) mutant both tagged with mRFP, and treated with a control siRNA (N = 4, n > 18, mean +/- SD). (D) FRAP analysis in lamin-depleted cells as in C (N = 4, n > 25, mean +/- SD). Corresponding mobile fractions (mean +/-, *p<0.05).

LAP1 mutants unable to activate Torsins cause binucleation that depends on LAP1–chromatin interaction

We have previously shown that persistent membrane–chromatin interactions during mitosis leads to severe post-mitotic NE morphology defects, and, in addition, to a significant increase in chromosome segregation defects, eventually resulting in cell division failure and an increase in the number of binucleated cells (Champion et al., 2019). To elucidate whether persistent LAP1–chromatin interactions would mimic these phenotypes, we examined binucleation upon expression of LAP1B-GFP and its derivatives deficient in Torsin activation. To quantify binucleated cells, we visualized the cytoplasmic contours by tubulin immunofluorescence and counterstained nuclei with Hoechst (Figure 5A, B, C). Compared to the parental HeLa cell line, expression of LAP1B-GFP induced a two-fold increase in binucleated cells. At a similar level, both LAP1B(1-359)-GFP and LAP1B(R563G)-GFP led to a twofold further rise in the number of binucleated cells compared to cells expressing LAP1B wild-type. This number was even higher for the disease-causing mutant LAP1B(E482A)-GFP. Thus, the E482A mutant seems to be a very potent dominant-negative if expressed.

LAP1B mutants deficient in Torsin activation lead to increased binucleation dependent on chromatin interaction of LAP1.

(A) Expression of LAP1B(1-359)-GFP was induced with 0.01 μg/ml tetracycline and expression of LAP1B-GFP wild-type, LAP1(R563G)-GFP and LAP1(E482A)-GFP with 1 μg/ml tetracycline for 48 hr. The parental HeLa cell line was used as a negative control. Then, cells were fixed, immunostained for tubulin and analyzed by confocal microscopy. Scale bar, 10 μm. White arrows denote binucleated cells. (B) Images representing the categories used for classification of binucleation. (C) Quantification of the fraction of binucleated cells (N = 3, n > 540, mean +/- SEM). (D) The integrated density (IntDen) of the GFP signal was measured and normalized to LAP1B-GFP. (E) Binucleation caused by LAP1B is prevented by point mutations that abolish chromatin-binding. Expression of LAP1B(1-359)-GFP or LAP1B(1-359-2E)-GFP was induced with tetracycline (0.01 μg/ml and 1 μg/ml, respectively) in stable HeLa cell lines for 48 hr. Cells were immunostained for tubulin and counterstained with Hoechst. Binucleated cells were quantified (N = 3, n > 300, mean +/- SEM; ****p<0.0001). Expression levels of LAP1B(1-359)-GFP and LAP1B(1-359-2E)-GFP were compared by immunoblotting. (F) LAP1B(1-359)-GFP expression was induced for 48 hr as in E in either mock-treated or in lamin A/C and lamin B1-co-depleted cells (RNAi for 72 hr, induction of LAP1B constructs for the last 48 hr). Cells fixed and analyzed as in E. The number of binucleated cells was quantified (N = 3, n > 383, mean +/- SEM). LAP1B(1-359)-GFP expression levels were determined based on the integrated GFP intensity (IntDen). Lamin RNAi was controlled by immunofluorescence. Scale bars, 10 μm.

Next, we addressed the contribution of chromatin interaction of LAP1 to the formation of binucleated cells by comparing HeLa cell lines expressing either LAP1B(1-359)-GFP or the chromatin-binding-deficient 2E (S108E, T124E) mutant, comparing cells at a high expression level by using an elevated tetracycline concentration for induction of the constructs. Whereas LAP1B(1-359)-GFP caused binucleation in nearly 40% of cells under these conditions, LAP1B(1-359-2E)-GFP did not (Figure 5E, F), confirming that binucleation is caused by the LAP1B-chromatin interaction. As LAP1B also interacts with lamin A/C and lamin B1, we further tested whether LAP1–lamina interactions contribute to binucleation. As RNAi-mediated depletion of lamin A/C and laminB1 in cells expressing LAP1B(1-359)-GFP did not reduce the number of binucleated cells (Figure 5G, H), we conclude that the cell division defects are independent of nuclear lamins, and thus solely related to the aberrant binding of LAP1 to chromatin during mitosis.

An ATPase-deficient Torsin impairs the removal of endogenous LAP1 from mitotic chromatin and increases binucleation

To date, five human Torsins have been identified. Because these five members of the Torsin family likely function, at least in part, in a redundant manner, it is challenging to reach a sufficient downregulation of these enzymes by conventional protein depletion experiments. As dominant-negative approaches have been decisive in elucidating the cellular function of ATPases, we therefore decided to investigate the consequences of expression of the dominant-negative Tor1B(E178Q) mutant. Strikingly, when we visualized endogenous LAP1 by immunofluorescence in cells expressing Tor1B(E178Q)-GFP, we observed LAP1-positive patches localizing to (pro)-metaphase chromatin, indicating an impaired release of LAP1 from chromatin during mitotic entry (Figure 6A). In comparison, cells expressing wild-type Tor1B-GFP showed GFP-positive membrane patches in the peripheral mitotic ER. These patches are reminiscent of previously described ER membrane foci in TorsinB-expressing interphase cells (Rose et al., 2014).

Figure 6 with 2 supplements see all
A dominant-negative, ATPase-deficient Torsin1B mutant increases binucleation in a LAP1-dependent manner.

(A) Endogenous LAP1 remains associated with chromatin in metaphase upon overexpression of Tor1B(E178Q)-GFP. Representative maximum intensity projections (5 × 0.63 μm) of confocal images of metaphase HeLa cells upon induction of either Tor1B-GFP and Tor1B(E178Q)-GFP expression with 1 μg/ μl tetracycline for 48 hr. Localization of endogenous LAP1 was analyzed by immunofluorescence staining. Scale bar, 5 μm. (B) Confocal images of Tor1B-GFP and Tor1B(E178Q)-GFP-expressing cells stained with Hoechst and immunostained for tubulin. Scale bar, 10 μm. Quantification of binucleated cells (N = 3, n > 835, mean +/- SD). (C) Expression of Tor1B(E178Q)-GFP was induced for 48 hr in LAP1-depleted or mock-treated cells. Binucleation was analyzed by confocal microscopy and quantified (N = 3, n > 1915, mean+/-SEM). Scale bar, 10 μm. (D) Quantification of chromosome segregation defects (DNA bridges and lagging chromosomes) in fixed GFP-KDEL, Tor1B-GFP, and Tor1B(E178Q)-GFP expressing anaphase cells after 24 hr of induction with tetracycline. Segregation errors were manually quantified (N = 3, n > 130, mean+/-SEM).

Next, we compared the formation of binucleated cells upon induction of Tor1B(E178Q)-GFP or wild-type Tor1B-GFP. Remarkably, Tor1B(E178Q)-GFP expression led to a twofold higher number of binucleated cells as compared to cells expressing Tor1B-GFP wild-type (Figure 6B). Notably, no severe post-mitotic NE aberrations were observed in Tor1B(E178Q) expressing cells, which might be explained by fewer, weaker and/or less persistent chromatin interactions of endogenous LAP1 in anaphase compared to overexpressed LAP1. We know from our previous work that late mitosis is indeed critical for the manifestation of this phenotype (Champion et al., 2019). As binucleation is indicative for failed cytokinesis and commonly caused by chromosome segregation defects, we quantified DNA bridges and lagging chromosomes. This analysis revealed a significant increase in chromosome segregation defects (Figure 6D). To elucidate whether the observed increase in binucleated cells can be attributed to the failed removal of LAP1 from mitotic chromatin, we performed RNAi-mediated depletion of LAP1 in Tor1B(E178Q)-GFP expressing cells. Importantly, the number of binucleated cells was significantly reduced in LAP1-depleted cells (Figure 6C). As judged by the GFP signal, the Tor1B(E178Q)-GFP expression seemed slightly reduced in LAP1-depleted cells as compared to cells treated with control siRNA (Figure 6C; Figure 6—figure supplement 1), and we wished to exclude that unequal Tor1B(E178Q) expression levels led to the reduction of binucleation in LAP1-depleted cells. Therefore, we induced Tor1B(E178Q) with a lower tetracycline concentration in control cells. Even though these cells now expressed two-fold less Tor1B-E178Q compared to LAP1-depleted cells, binucleation was still significantly reduced upon downregulation of LAP1 (Figure 6—figure supplement 1A, B, C). For comparison, we also depleted the ER-resident Torsin-activator LULL1 in Tor1B(E178Q)-GFP expressing cells, but could not observe a reduction in binucleated cells (Figure 6—figure supplement 2A, B, D). LULL1 depletion also did not prevent the localization of LAP1 to mitotic chromatin upon Tor1B(E178Q) expression (Figure 6—figure supplement 2C, D). Taken together, the dominant-negative Tor1B variant induces the persistence of LAP1-positive membrane patches on (pro)-metaphase chromatin, chromosome segregation defects and binucleation in a LAP1-dependent manner. Collectively, our findings indicate that Torsin function is important for mitotic fidelity by assuring normal LAP1 behavior during mitosis.


During NE breakdown, membrane proteins of the INM are released from chromatin and the nuclear lamina to allow for the spatial separation of membranes from chromatin. Our work uncovers that the abundant and ubiquitously expressed INM protein LAP1 is tightly anchored at the INM of interphase cells by association with both chromatin and the nuclear lamina. Unexpectedly, we found that LAP1 remains stuck on chromatin in mitosis if either the stoichiometry of LAP1 to Torsins is unbalanced or Torsin functionality is compromised. These findings are intriguing for two reasons. Firstly, they indicate that Torsins, residing in the perinuclear space, influence LAP1’s ability to bind chromatin at the other side of the membrane. Secondly, reminiscent of some of the phenotypes that we have previously observed using a synthetic membrane-chromatin tether (Champion et al., 2019), the failure in release of LAP1 from mitotic chromatin is associated with chromosome segregation defects, binucleation and postmitotic NE aberrations.

The Torsin-LAP1 interplay

Based on studies in human cells, mice and Drosophila diverse roles of Torsins have been suggested, including functions in ER homeostasis, secretion, lipid metabolism, NPC biogenesis, and nuclear export of large particles like mRNPs or HSV1 capsids by a vesicular transport process across the NE (Chen et al., 2010; Grillet et al., 2016; Jokhi et al., 2013; Maric et al., 2011; Nery et al., 2011; Pappas et al., 2018; Rampello et al., 2020; Rampello et al., 2020; Shin et al., 2019; Turner et al., 2015). However, while all these suggested functions are supported by the reported cellular phenotypes, biochemical and genetic data, it is currently unclear what are direct or indirect consequences of Torsin function since the molecular mechanism of Torsin action has remained elusive. All attempts to identify bona fide substrates of these unsual, ER-luminal AAA+ ATPases have so far been unsuccessful. It has therefore even been speculated that the established Torsin activators LAP1 and LULL1 could act simultaneously as activators and substrates of these mysterious ATPases (Cascalho et al., 2017; Rose et al., 2015), especially since LAP1 and LULL1 are highly enriched on the ATP-bound form of some Torsins, as expected for substrates of AAA+ ATPases.

So, how do our findings relate to the current understanding of the molecular function of Torsins? Our experiments suggest that the interaction of Torsins with the C-terminal, luminal domain of LAP1 in the ER lumen influences the chromatin-binding activity of LAP1’s nucleoplasmic domain on the other side of the membrane. This implies that LAP1 might not merely behave as an activator of Torsins, but could in turn itself be a downstream effector or ‘substrate’ influenced by the activity of the ATPases. Two observations indicate that this reverse crosstalk from Torsin to LAP1 is indeed linked to the enzymatic activity of the ATPase: Firstly, LAP1B-induced NE aberrations can be rescued by expression of Tor1B wild-type but not by an ATPase inactive mutant. Secondly, LAP1 derivatives that are deficient in Torsin ATPase activation execute a stronger dominant-negative effect on cell division than wild-type LAP1.

Clearly, even if considering LAP1 a ‘substrate’ of Torsins ATPases, their interplay must differ from the ‘classical’ enzyme-substrate mechanism typical of AAA+ ATPases that thread protein substrates through the central pore of a usually hexameric ATPase rings (Hanson and Whiteheart, 2005; Olivares et al., 2016). Although Torsins show sequence similarity to bacterial ClpX ATPases that serve as the paradigm of substrate-threading AAA+ ATPases (Olivares et al., 2016), they seem to lack the characteristic pore loops involved in substrate gripping during the translocation of an unfolded protein chain through the central opening of the ring (Demircioglu et al., 2016). Furthermore, the luminal domains of LAP1 and LULL1 are structural mimics of the ATPase fold. These domains bind laterally to the ATPase domain of Torsins to activate ATP hydrolysis through their arginine finger (Brown et al., 2014; Sosa et al., 2014), inconsistent with LAP1 being a substrate of a threading mechanism. Consistently, Torsins have not been found to unfold the luminal domains of LAP1 and LULL1 in vitro (Zhao et al., 2013). Thus, the interplay of Torsin and LAP1 must work differently.

From a conceptual point of view, we can envisage several scenarios as to how Torsin ATPase activity could influence chromatin interaction of LAP1. One possibility is that activation of Torsins transduces mechanical forces across the membranes, thereby weakening the interaction of LAP1 with chromatin, and thereby facilitating its removal from chromatin. This might entail a conformational rearrangement of the luminal domain of LAP1 relative to the ATPase domain of Torsins induced by ATP hydrolysis, and propagated to the other side of the membrane either in form of a Torsin-induced pulling on LAP1 or a rotational movement of LAP1 along its longitudinal axis in the plane of the membrane. Another plausible scenario is that Torsin ATPase activation leads to the disassembly of LAP1 dimers or higher order oligomers by affecting their lateral association, thereby influencing the avidity of the LAP1–chromatin interaction.

Based on structural studies that revealed an AAA+ fold mimicry of the luminal domains of LAP1 and LULL1, it has originally been assumed that they form mixed heterohexameric rings with Torsins, with support from in vitro assembly experiments (Brown et al., 2014; Sosa et al., 2014). Such a heterohexameric configuration with 3 LAP1 and 3 Torsin molecules per hexamer would readily explain how an ATPase-deficient Torsin mutant such as Tor1B(E178Q) could increase the affinity of LAP1 for chromatin due to avidity effects caused by the entrapment of LAP1 in these ATP-stabilized ring structures. However, it was subsequently noted that the surfaces of the luminal domains of LAP1 and LULL1 are only well conserved on their catalytic interface with Torsins but not on the potential non-catalytic interface, indicating the lack of evolutionary pressure to maintain this interface and shedding some doubt on the suggested hetero-hexameric organization (Chase et al., 2017; Demircioglu et al., 2016). In contrast, Torsins display surface conservation on both their catalytic and non-catalytic interfaces, consistent with the possibility that Torsins could form homo-oligomers. Indeed, Torsins can assemble into ATP-dependent, homo-oligomeric structures in vitro, adopting the configuration of a spiral or potentially a lock-washer (Chase et al., 2017; Demircioglu et al., 2016). Such configuration would provide only one accessible interface for binding of LAP1 or LULL1 to promote oligomer disassembly upon ATPase activation. It remains to be seen which higher order configuration of Torsins exist in living cells, also in light of the view that LAP1 and LULL1 are overstoichiometric to Torsins (Itzhak et al., 2016). Such knowledge will be key to inform rational models of how Torsins influence chromatin interaction of LAP1.

LAP1 interaction with chromatin and the nuclear lamina

LAP1B possesses an extremely low diffusional mobility in comparison to other INM proteins (Zuleger et al., 2011). Its intrinsically disordered nucleoplasmic domain engages in interaction with at least three binding partners that contribute to its strong retention at the INM, namely lamin A/C, lamin B1, and chromatin. This raises the question of whether the strong immobilization of LAP1 at the NE might bear an additional function beyond retaining the protein at the INM. Potential roles include the mechanical coupling of the INM to chromatin and the nuclear lamina or a function in chromatin positioning at the nuclear periphery, for example in heterochromatin organization. INM proteins together with nuclear lamins are known to serve as heterochromatin tethers that promote the positioning of transcriptionally silenced heterochromatin domains underneath the NE of differentiated cells (Guelen et al., 2008; Solovei et al., 2013). Considering the organization of its nucleoplasmic domain, LAP1 seems ideally suited to bridge lamina-chromatin interactions. Notably, LAP1 is developmentally essential as LAP1 knockout mice exhibit perinatal lethality (Kim et al., 2010). Recently, loss of LAP1 expression in human patients caused by a mutation leading to an in-frame termination codon in LAP1 has been associated with an early onset multisystemic nuclear envelopathy manifesting in severe neurological and developmental deficiencies, resulting in early lethality of the patients (Fichtman et al., 2019). These severe defects are most likely caused by a lack of Torsin activation at the NE by lack of LAP1. However, it might also be worth considering whether LAP1 might have a chromatin-associated function that is needed for proper development.

Our study primarily focused on the long isoform LAP1B. In comparison, LAP1C is predicted to possess a shortened CBR. When overexpressed, LAP1C is also capable of binding to chromatin during mitosis, albeit to a lesser extent than LAP1B. Interestingly, the relative expression of LAP1B and LAP1C differs between tissues and changes during development (Santos et al., 2014; Shin et al., 2014). While LAP1C is the predominant isoform in undifferentiated cells, the relative levels of LAP1B strongly increase during differentiation and, interestingly, upon induced cell cycle exit of cultured somatic cells (Santos et al., 2015). In light of our observation that LAP1B is more prone to stick to mitotic chromatin than LAP1C and induces mitotic errors when present at increased levels in rapidly dividing cells, the physiological upregulation of LAP1B in correlation with cell cycle exit seems ideally suited to prevent potentially fatal mitotic defects caused by LAP1B.

The gist of the matter – mitosis or interphase?

Although we present evidence that Torsins influence the interaction of LAP1 with chromatin, we do not necessarily assume that Torsins have evolved to liberate LAP1 from chromatin for open mitosis or that they possess a function dedicated to mitosis. Given that primary dystonia caused by mutations of Tor1A or LAP1 seems to arise through a dysfunction of post-mitotic neurons, the function of Torsins is probably essential for the homeostasis of interphase cells. We rather consider it likely that mitosis is perturbed as a consequence of a perturbed LAP1-Torsin interplay during interphase that manifests in the subsequent mitosis.

Both the expression of the Tor1B ATPase-deficient E178Q mutant or excess LAP1 impaired the full removal of LAP1 from chromatin in mitosis, and is associated with chromosome segregation errors, increased binucleation of cells and post-mitotic NE aberrations. When we weakened chromatin association of LAP1B by mutation of two residues in the CBR to phospho-mimetic residues, these phenotypes disappeared, suggesting that the prolonged chromatin association of LAP1 during mitosis is the underlying reason. Dissociation of membrane chromatin contacts is currently assumed to be primarily controlled by protein phosphorylation. While our own investigations of mitotic phosphorylation of these sites remained inconclusive, one of these residues, that is Ser135, has indeed been detected as mitotically phosphorylated in large scale phosphoproteomics (Dephoure et al., 2008). If chromatin interaction of LAP1 were normally controlled by (mitotic) kinases, then the perturbed Torsin-LAP1 interplay could also affect the access of kinases to the nucleoplasmic domain of LAP1, for example by a failure in dissolving interactions of LAP1 with either itself or other partners. Interestingly, the nucleoplasmic domain of LAP1 is known to interact with protein phosphatase 1, the persistent binding of which could counteract the action of (mitotic) kinases (Santos et al., 2013). Finally, mitotic changes in chromatin may also promote LAP1 dissociation during mitosis, and these changes might be affected by perturbation of the LAP1-Torsin axis.

Both binucleation and aneuploidy may contribute to or even drive tumorigenesis (Chow et al., 2012; Levine and Holland, 2018; Tanaka et al., 2018). Because Torsins likely function in a redundant manner, it is highly improbable that Torsin function can be completely abolished by mutations in most tissues. For LAP1, in contrast, mutations that specifically impair its Torsin binding or activation capability, present a risk of causing mitotic errors. Remarkably, mutation of LAP1’s arginine finger was identified as a somatic mutation in melanoma (Krauthammer et al., 2012) and colon cancer (The Cancer Genome Atlas Network, 2012). However, whether this mutation genuinely contributes to tumorigenesis remains to be clarified. Based on our findings, one could expect aneuploidy to develop over time if differentiated cells with high LAP1B expression levels were forced to reenter the cell cycle for instance by oncogenic driver mutations.

Materials and methods

A list of materials is provided in Appendix 1-Key resource table 1.

Molecular cloning

Request a detailed protocol

The LAP1B, LULL1, Tor1A, and Tor1B coding regions were amplified from HeLa cDNA and cloned into the vector pcDNA5.1-GFP FRT/TO (cytomegalovirus [CMV] promoter; Invitrogen) for generation of stable, tetracycline-inducible cell lines. The respective constructs for LAP1B (isoform 3) and Tor1B pcDNA5.1 FRT/TO served as PCR or mutagenesis templates, yielding the following derivatives: LAP1C, LAP1B(1-359), LAP1B(Δ98–136), LAP1B(73-end), LAP1B(184-end), LAP1B(R563E), LAP1B(E482A), LAP1B(S108E,T124E), LAP1B(1-359)(S108E,T124E), LAP1B(S108E,T124E, R563G), LAP1(98–136), LAP1(98–136)(S108E,T124E), and Tor1B(E178Q). Fragments of the nucleoplasmic domain of LAP1 were subcloned into the mammalian expression vector pK7-GST-GFP (Ungricht et al., 2015a) and/or pK7-GST-GFP-NLS(SV40) (Erkmann et al., 2005) or the bacterial expression vector pQE60-zz-6xhis (Kutay et al., 1997), encoding for two z domains derived from the immunoglobulin-binding domain of Staphylococcus aureus protein A. For the domain swap experiment with SPAG4, the chromatin binding region of LAP1 (aa 98–136) and mutants thereof were cloned into pEGFP-N3-SPAG4 (Turgay et al., 2010). The emerin and LEM2 coding regions were amplified from HeLa cells derived cDNA and cloned into pEGFP-N3 (Clontech). pEGFP-N3-derived plasmids encoding for LAP2β (Ungricht et al., 2015a), SUN1 and SUN2 (Turgay et al., 2010) have been described before. Point mutations were introduced by using QuikChange site-directed mutagenesis.


The following commercial antibodies were used in this study: anti-β-actin (mouse; Sigma, A1978; RRID:AB_476692), anti-emerin (rabbit, abcam Ab40688, RRID:AB_2100059), anti-HA (mouse, Covance, MMS-101P, RRID:AB_2314672), anti-lamin A/C (mouse, ImmuQuest (IQ332 RRID:AB_10660272)), anti-lamin B1 (rabbit, abcam ab16048, RRID:AB_443298), anti-lamin B2 (rabbit, abcam (ab151735) RRID:AB_2827514), anti-LAP1 (rabbit, abcam, ab86307 RRID:AB_2206124), anti-LBR (rabbit; Abnova, PAB15583; RRID:AB_10696691), mAB414 (mouse; Abcam, ab 24609; RRID:AB_448181), anti-H3 (rabbit, acam ab1791, RRID:AB_302613), anti-Tor1A (rabbit, Abexxa, abx001683), anti-Tor1B (rabbit, antibodies-online, ABIN1860834), anti-HSP60 (rabbit, abcam, ab45134, RRID:AB_733033), anti-α-tubulin (mouse, Sigma, T5168, RRID:AB_477579).

Antibodies were raised in rabbits against purified, recombinant human LULL1. Antibodies against human SUN1 (Sosa et al., 2012), human SUN2 (Turgay et al., 2010) and anti-GFP (Turgay et al., 2014) have been previously described.

Generation of LMN A/C knockout cells

Request a detailed protocol

LMNA/C KO cell lines were made using the CRISPR/Cas9 system. The guide RNA (gRNA) was designed using the CRISPR design web tools ( and targeted exon 1 of the LMNA/C gene. The annealed guide RNA-encoding DNA oligos (5’-CACCGGGTGGCGCGCCGCTGGGACG-3’ and 5’-AAACCGTCCCAGCGGCGCGCCACCC-3’) were ligated into the pC2P vector (Welte et al., 2019), which encodes for hCas9 and possesses a puromycin resistance cassette. Cells were transfected with the resulting pC2P-gLMNA/C vector and selected with puromycin for 3 days. Surviving clones were expanded and screened for mutations in the LMNA/C gene by immunoblotting and PCR. PCR products covering the edited genomic region were sequenced and analyzed for indel mutations using the tide web tool (Brinkman et al., 2014) and manual inspection of the sequencing chromatograms.

Cell culture and synchronization of cells

Request a detailed protocol

HeLa FRT/TetR, HeLa K, HCT116, and HepG2 were kind gifts from T. Mayer (Department of Biology, Konstanz), B. Vogelstein (Johns Hopkins, Baltimore), D. Gerlich (Institute of Molecular Biotechnology, Vienna), and S. Werner (Institute of Molecular Health Science, ETH Zurich). These cell lines were not further authenticated after obtaining them from the indicated sources. All cell lines were tested negative for mycoplasma using PCR-based testing. None of these cell lines was included in the list of commonly misidentified cell lines maintained by International Cell Line Authentication Committee. Cells were cultivated in DMEM containing 10% (v/v) FBS and 100 μg/ml penicillin/streptomycin at 37°C with 5% CO2 in a humidified incubator. Transient transfections were performed using X-tremeGene (Roche) and jetPRIME (PolyPlus) transfection reagent. Stable tetracycline-inducible HeLa cell lines were generated by integration of the respective constructs into HeLa FRT/TetR cells.

Expression of the LAP1B-GFP, LAP1C-GFP, LAP2β-GFP, LAP1B(R563G)-GFP, LAP1B(E482A)-GFP, LAP1B(ΔCBR)-GFP, LAP1B(1-359)-GFP, LAP1B(S108E,T124E), Tor1B-GFP and Tor1B(E178Q)-GFP was induced with tetracycline as described in the figure legends. To synchronize HeLa cells in mitosis, a thymidine block was performed by adding 3 mM thymidine (Sigma-Aldrich) for 16 hr, followed by release of the cells from G1/S arrest with fresh medium for 10 hr. To arrest cells in prometaphase, 100 ng/ml nocodazole (Sigma-Aldrich) was added 8 hr after thymidine release.

Plasmid and siRNA transfections siRNA transfections were performed using INTERFERin (Polyplus) as transfection reagent. Cells were treated with 20 nM siRNA for 48 hr or 72 hr. The following siRNAs were purchased: si-CTR (AllStars negative control, Qiagen), si-lamin A/C (CUGGACUUCCAGAAGAACA, Microsynth), si-lamin B1 (UUCCGCCUCAGCCACUGGAAAU, Sigma), si-lamin B2 (ACAACUCGGACAAGGAUC, Microsynth), si-LAP1 (CUCACUAAGUUUCCUGAGUUA, Microsynth), si-LULL1 (CTGGTCCTGACTGTTCTGCTA, Microsynth).

Immunofluorescence analysis

Request a detailed protocol

Cells grown on glass coverslips were washed with PBS and fixed for 10 min with either 4% PFA at RT or with methanol at - 20°C. After PFA fixation, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min. Then, cells were blocked with 2% (w/v) BSA in PBS for at least 20 min, incubated with primary antibody for at least 1 hr, washed three times with PBS and incubated with the respective secondary antibody for at least 45 min. Coverslips were washed again three times with PBS, incubated with 1 μg/ml Hoechst (Invitrogen) in PBS for 10 min and washed again. Coverslips were mounted on microscopic slides with Vectashield (Vector labs).

Protein purification

Request a detailed protocol

Recombinant zz-His6, zz-LAP1B(98-136)-His6 wild-type and the respective 2E mutant (S108E, T124E) for EMSAs were produced in E. coli XL1(pBS161) (Kutay et al., 2000). Cells were lysed in 50 mM Tris pH 7.5, 700 mM NaCl, 2 mM MgCl2, 35 mM Imidazole, 2 mM beta-mercaptoethanol, 1 mg/ml lysozyme, 10 μg/ml DNase I, the recombinant proteins retrieved by immobilized nickel affinity chromatography, and eluted with 50 mM Tris pH 7.5, 350 mM NaCl, 2 mM MgCl2, 400 mM Imidazole, 2 mM beta-mercaptoethanol. The protein was rebuffered to 10 mM Tris pH 7.5, 200 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, 10% sucrose.

Electrophoretic mobility shift assays (EMSAs) of DNA and mononucleosomes

Request a detailed protocol

DNA was produced as previously described (Hanson et al., 2004). In brief, a pUC19 plasmid carrying multiple copies of the Widom ‘601’ sequence, each flanked by EcoRV restriction sites, was purified from an 8 l culture of transformed E. coli DH5α cells (NEB). The ‘601’ fragments were released from the plasmid by digestion with EcoRV (NEB), isolated by incremental PEG precipitation, and further purified by ethanol-acetate precipitation and subsequent chloroform-phenol extraction. Histone octamers were prepared as described (Luger et al., 1999). We used wild-type histone proteins, except for H3.2 carrying a C110A mutation. Mononucleosomes were reconstituted through overnight logarithmic dialysis from high-salt (10 mM Tris pH 7.5, 1 mM EDTA 2 M KCl) into low-salt buffer (10 mM Tris pH 7.5, 1 mM EDTA, 10 mM KCl), yielding a 22.6 nM mononucleosome solution based on DNA absorbance.

EMSAs were performed with 10 nM mononucleosomes or 10 nM ‘601’ DNA, preincubated with LAP1 protein derivatives at the indicated concentrations in a total volume of 10 μl for 10 min at 37°C (final buffer concentration 10 mM Tris pH 7.5, 1 mM EDTA, 150 mM KCl). Samples were put on ice, mixed with 5 μl ice-cold sample buffer (25% (w/v) sucrose, 0.01% (w/v) bromophenol blue) and loaded on a 5% poly-acrylamide (29:1, BioRad) 0.5 x TBE gel, migrated for 1 hr at 90 V in ice-cold 0.5 x TBE. DNA was stained with GelRed (Biotium) and imaged with a ChemiDoc MP(BioRad). Band intensities were quantified with ImageLab (BioRad). The intensities were normalized to the bands in the absence of added protein, and the averaged values of the replicates were plotted ± standard deviation. The data were evaluated with a Hill equation Intensity=11(1+(Kd[ protein ])n) taking the standard deviation in account using IGOR (Wavemetrics).

Image acquisition and live cell imaging

Request a detailed protocol

Confocal fluorescence images were acquired with LSM 880, LSM 780 microscope (ZEISS) or a Leica SP2 AOBS microscope. For all microscopes, 63 × 1.4 NA, oil plan-apochromat objectives were used. For time-lapse microscopy, cells were seeded into μ-slide 4-well ibidi chambers and incubated with 0.1 μM SiR-Hoechst 1 hr prior to the experiment. Images were acquired at a Visitron spinning disk Nikon Eclipse T1 microscope, using a 60 × 1.4 oil lens, in a 5% CO2, 37°C chamber. 15 z-stacks were acquired every 5 min for 8 to 12 hr.

Image processing and quantification

Request a detailed protocol

For quantification of GFP intensity at the nuclear rim, the integrated GFP density (IntDen) at the NE was determined with ImageJ. Nuclear contours were manually detected by placing individual ROIs (Region of Interests) around the NE. To quantify the NE aberration phenotype (Figure 3A, B, C), only cells binned for a window of similar fluorescence intensities were included into the analysis as indicated. IntDen GFP was normalized relative to the average binned GFP IntDen of cells expressing LAP1B-GFP only.


Request a detailed protocol

Cells were seeded into NuncTM Lab-TekTMII chambers, and transfected or induced one day before the experiment. For FRAP, either an LSM 710-FCS, LSM 780-FCS or LSM 880 Carl Zeiss microscope was used. Cells were kept in a humified chamber at 5% CO2 at 37°C. Time-lapse movies were recorded with a 63 × 1.4 NA oil DIC plan-apochromat immersion lens, and images were taken with a 4 x zoom. Three pre-bleach values were acquired, and then a 3.3 × 0.66 (2.2 μm2) rectangle at the NE was bleached (with 100% 488 nm laser intensity, and a range of 80–200 scanning iterations to achieve 90% bleaching). The fluorescence recovery was measured every 4 s for 57 cycles. The acquired FRAP data was normalized and fitted by a double exponential using the easyFRAP Matlab tool (Rapsomaniki et al., 2012).

Statistical methods

Request a detailed protocol

Graphs were generated using Prism, which was further used to calculate the unpaired t-test and p values less than 0.001 are indicated by four asterisks (****p≤0.0001), three asterisks (***p≤0.001); p values less than 0.01 by two asterisks (**p≤0.01); p values less than 0.05 by one asterisk (*p≤0.05); and p values higher than 0.05 are marked as ‘not significant’ (ns).


Request a detailed protocol

Whole cell lysates were generated by resuspending cells in SDS sample buffer (75 mM Tris pH 6.8, 20% (v/v) glycerol, 4% (w/v) SDS, 50 mM DTT, 0.01% (w/v) bromophenole blue). Proteins were separated on 8–15% SDS gels and transferred to a nitrocellulose membrane (GE Healthcare) using the Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad). Membranes were incubated after blocking with 5% (w/v) dry milk in TBT with the primary antibody for at least 1 hr. As secondary antibodies, rabbit anti-mouse or goat anti-rabbit horseradish-peroxidase-conjugated antibodies (Sigma) were used. Signals were captured by exposure to film or detected using a Fusion (Vilber) or an Odyssey (LI-COR) imaging system.

Appendix 1

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP2β-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1C-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(1-359)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(E482A)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(R563G)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx LAP1B(1-359, S108E, T124E)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx Tor1B-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx Tor1B(E178Q)-EGFPThis paperSee Materials and methods, Cell lines, antibodies, and reagents
Cell line (Homo sapiens)HeLa FlpIn T-REx(Hafner et al., 2014)
Obtained from T. Maier (University Konstanz).
Cell line (Homo sapiens)HeLa KyotootherRRID:CVCL_1922Obtained from D. Gerlich (IMBA, Vienna).
Cell line (Homo sapiens)HeLa Gromeier
This paperSee Materials and methods, Cell lines, antibodies, and reagents antibodies, and reagents
Cell line (Homo sapiens)HCT116otherRRID:CVCL_0291
Obtained from B. Vogelstein (Johns Hopkins, Baltimore, USA)
Cell line (Homo sapiens)HepG2otherRRID:CVCL_0027
Obtained from S. Werner (Institute of Molecular Health Science, Zurich)
Transfected construct (human)si-ControlQiagenCat# 1027281Allstars siRNA
Transfected construct (human)si-lamin A/CMicrosynth (Hasan et al., 2006) DOI: 10.1016/j.febslet.2006.01.0395’- CUGGACUUCCAGAAGAACA -3’
Transfected construct (human)si-lamin B1Sigma (Hasan et al., 2006) DOI: 10.1016/j.febslet.2006.01.0395’- UUCCGCCUCAGCCACUGGAAAU -3’
Transfected construct (human)si-lamin B2Microsynth5’- ACAACUCGGACAAGGAUC -3’
Transfected construct (human)si-LAP1Qiagen/Microsynth5’- CUCACUAAGUUUCCUGAGUUA- 3’
Transfected construct (human)si-LULL1Qiagen/Microsynth5’- CTGGTCCTGACTGTTCTGCTA -3’
Transfected construct (human)si-Tor1AQiagen/Microsynth5’- CACCAAGTTAGATTATTACTA-3’
Transfected construct (human)si-Tor1BQiagen/Microsynth5’- CTGTCGGAGTCTTCAATAATA-3’
(mouse monoclonal)
SigmaCat# A1978
(rabbit polyclonal)
AbcamCat# ab40688
(mouse monoclonal)
CovanceCat# MMS-101P
Antibodyanti-lamin A/C
(mouse monoclonal)
ImmuQuestCat# IQ332
WB (1:200)
Antibodyanti-lamin A/C (rabbit polyclonal)Proteintech
Cat# 10298-1-AP
Antibodyanti-lamin B1
(rabbit polyclonal)
AbcamCat# ab16048
Antibodyanti-lamin B2
(rabbit monoclonal)
AbcamCat# ab151735
IF (1:1000)
(rabbit polyclonal)
AbcamCat# ab86307
(rabbit polyclonal)
AbnovaCat# PAB15583
Antibodyanti-mAB414 (mouse monoclonal)AbcamCat# ab 24609
(rabbit polyclonal)
AbcamCat# ab1791
(rabbit polyclonal)
AbexxaCat# abx001683
(rabbit polyclonal)
antibodies-onlineCat# ABIN1860834
Antibodyanti-α-tubulin (mouse monoclonal)SigmaCat# T5168
WB(1:20000) IF(1:20000)
Antibodyanti-GAPDH (mouse monoclonal)AbcamCat# ab8245
(rabbit polyclonal)
This paperIF (1:500)
See Materials and methods, Cell lines, antibodies, and reagents
(rabbit polyclonal)
(Sosa et al., 2012) DOI: 10.1083/jcb.200904048IF(1:1000)
(rabbit polyclonal)
(Turgay et al., 2010) DOI: 10.1261/rna.2325911IF(1:2000)
(rabbit polyclonal)
(Turgay et al., 2010) DOI: 10.1261/rna.2325911IF(1:1000)
Recombinant DNA reagentpcDNA5/FRT/TO/LAP1B-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/LAP1C-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 1-72
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 1-183
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 98-136
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 184-337
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperLAP1: aa Δ98-136
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ LAP1B(1-359)-2E-EGFPThis paperLAP1: aa 1-359, S108E, T124E
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ LAP1B(1-359)-EGFPThis paperLAP1: aa 1-359, See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1A-cTAPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1A-cTAPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1B-cTAP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ Tor1B(E178Q)-cTAPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/ LAP1B(R563G)-EGFPThis paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/LAP1B-E482A-EGFP
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperS108E, T124E
See Materials and methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1B(S108E, T124E, R563G)-EGFP
This paperS108E, T124E, R563G
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7-GST-GFP(Ungricht et al., 2015a) DOI: 10.1007/978-1-4939-3530-7_28See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
(Erkmann et al., 2005) DOI: 10.1091/mbc.e04-11-1023See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 1-121,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 73-183,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 122-183,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 73-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 122-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 1-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 1-72,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 122-183,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 73-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpK7
LAP1(184-337) GST-EGFP-NLS
This paperLAP1: aa 184-337,
See Materials and methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
This paperSee Materials and methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
(Ungricht et al., 2015a) DOI: 10.1007/978-1-4939-3530-7_28See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
This paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
(Turgay et al., 2010) DOI: 10.1261/rna.2325911See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
(Turgay et al., 2010) DOI: 10.1261/rna.2325911See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3-SPAG4-GFP(Turgay et al., 2010) DOI: 10.1261/rna.2325911See Materials and Methods, Molecular cloning
Recombinant DNA reagentLAP1(98-136)-SPAG4-EGFPThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentLAP1(98-136_2E)-SPAG4-EGFPThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentLAP1(98-136_3E)-SPAG4-EGFPThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentLULL1-HAStThis paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpCMV/ER/myc EGFP-KDEL(Ungricht et al., 2015a) DOI: 10.1007/978-1-4939-3530-7_28 See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
This paperLAP1: aa 72-583,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
This paperLAP1: aa 184-583,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
LAP1C(Δ122-136) EGFP
This paperLAP1: aa Δ122-136,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
This paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpcDNA5/FRT/TO/
LAP1B(184-end R563G)-EGFP
This paperLAP1: aa 184-583,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpEGFPN3
This paperSee Materials and Methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 1-97,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpK7
This paperLAP1: aa 137-337,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpQE60zz-His6(Sosa et al., 2012)
DOI: 10.1016/j.cell.2012.03.046
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpQE60zz-LAP1B(98-136)-His6This paperLAP1: aa 98-136,
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpQE60zz-His6
zz-LAP1B(98-136)-2E His6
This paperLAP1: aa 98-136,
S108E, T124E
See Materials and Methods, Molecular cloning
Recombinant DNA reagentpC2P(Welte et al., 2019) DOI: 10.1101/gad.328492.119
Recombinant DNA reagentpC2P-gLMNA/CThis paperProtospacer: 5’- CACCGGGTGGCGCGCCGCTGGGACG -3’
See Materials and Methods, Generation of LMN A/C knockout cells
Chemical compound, drugSIR-HoechstSpirochromeCat# SC007
Chemical compound, drugHoechstInvitrogenCat# 63493
Chemical compound, drugDTTApplichemCat# A1101
Chemical compound, drugnocodazoleSigma-AldrichCat# M1404
Chemical compound, drugthymidineSigma-AldrichCat #T1895
Chemical compound, drugtetracyclineInvitrogenCat# 550205

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.


Decision letter

  1. Megan C King
    Reviewing Editor; Yale School of Medicine, United States
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands
  3. Megan C King
    Reviewer; Yale School of Medicine, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

The integral inner nuclear membrane protein LAP1 is an established activator of the lumenal AAA ATPase Torsin. In this manuscript the authors uncover an unexpected mechanism in which Torsin influences the chromatin binding properties of LAP1 in a manner requiring its ATPase activity. These new findings support a key role for the LAP1-Torsin axis in regulating mitotic nuclear envelope remodeling.

Decision letter after peer review:

Thank you for submitting your article "Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Megan C King as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Anna Akhmanova as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 ( Specifically, we are asking editors to accept without delay manuscripts, like yours, that they judge can stand as eLife papers without additional data, even if they feel that they would make the manuscript stronger. Thus the revisions requested below only address clarity and presentation.


This manuscript presents an interesting novel idea: that the inner nuclear membrane (INM) protein LAP1, known as a regulator of Torsins, is itself regulated by Torsins. Luithle and colleagues describe a novel chromatin binding domain in the in the nucleoplasmic region of LAP1 that can directly bind DNA and functions at least in part to regulate LAP1's retention at the INM. The authors also identify two lamin interaction domains and show that these interactions further reinforce the anchorage of LAP1 at the INM. The authors tie the chromatin binding by LAP1 to its ability, when over-expressed, to induce altered nuclear morphology, defects in membrane removal during mitosis and features consistent with chromosome segregation defects. They discover that Torsin over-expression can modulate the phenotypes tied to LAP1 over-expression and therefore mimic the deletions/mutations that abrogate chromatin binding; this requires a functional Torsin-LAP1 interaction and TorsinB ATPase activity. Thus, for the first time, the authors describe a direct role for Torsins in promoting mitotic integrity via LAP1, suggesting that catalytically active Torsin, which is limiting, is required to release LAP1 from chromatin during mitosis.

All three reviewers were enthusiastic about the study, highlighting that it was well-written, presented data of consistently high quality, and would be of interest to a broad readership. The reviewers agreed that the manuscript reveals important new information on the mutual regulation of Torsins and LAP1 and provides a conceptual advance for our understanding of mitotic nuclear envelope breakdown via an unexpected mechanism operating across the inner nuclear membrane. The authors had some suggestions for a revised manuscript, most of which can be addressed with edits to the text.

Essential revisions:

1) The reviewers were somewhat troubled by the interpretation that "…no post mitotic NE aberrations were observed in Tor1B(E178Q) expressing cells…", as shown in Figure 6B, C. This is confusing and seemingly contradicts the working model saying that increased LAP1 levels relative to active Tor1 lead to NE aberrations, in turn generating binucleated cells. As there is a certain degree of functional redundancy between Torsins (Laudermilch et al., 2016 and Tanabe et al., 2016), could this be due to the presence of endogenous TorsinA/B? Arguably, the most definitive experiment to support their central conclusion would be to show that a TorA/B knockout, or their co-depletion, results in the same phenotype as LAP1 overexpression considering that only TorA/B (but none of the other Torsins) act on Lap1 (Zhao et al., 2013). Or is even a TorB KO alone sufficient to cause similar effects?

2) The analyses strongly rely on the quantification of nuclear defects, but in some figures differences in nuclear defect severity are not so clear in the immunofluorescence images. How was severity of nuclear morphology defects quantified? From the images alone correlation with expression level is not so clear. The way that nuclear aberrations were quantified should be explained carefully in the text and/or legends.

3) Please address if and how the expression level of INM proteins tested was controlled, as this seems to be relevant for the phenotype (see Figure 1D)? Particularly SUN1 seems to be weakly expressed.

4) How did authors make sure that the cells had no nuclear aberrations before time lapse imaging was started? Did these cells never go through mitosis in the presence of the GFP-LAP1 before? How long do the cells survive in the presence of overexpressed LAP1? Authors may consider to show some of the data presented in Figure 5 (e.g. bi-nucleated cells) already here, to address cell fate upon LAP1 overexpression.

5) One important aspect of the proposed model, not addressed in the study and not even discussed in the manuscript, is the fact that Torsin's activity on LAP1 has to be regulated during the cell cycle. LAP1 is tethered to the nuclear periphery to a great part by its interaction with chromatin in interphase cells, which contain active Torsin. In mitosis Torsin is required to release LAP1 from chromatin. Is Torsin regulated or do chromatin changes in mitosis contribute to the Torsin-mediated LAP1 release? The authors should at least address this point in the Discussion. Along these lines, although the authors have not been able to dissect the phosphorylation of the CBR in detail to this point, it is worth asking how the phosphodead/phosphomimetic mutations influence the chromatin association of the CBR alone. Similarly, one wonders if the "generic" phosphorylation status of LAP1B (as visualized on a PhosTag gel/blot, for example) is altered during mitosis and whether this is influenced by dominant-negative forms of Torsin.

6) Although not absolutely essential, evidence for their speculation that the (hetero)oligomeric state of the Torsin/cofactor system influences their findings would be important for the Torsin field. The authors could test one key aspect comparatively easily: would a back interface Torsin mutant (Chase et al., 2017) selectively perturbing the Torsin homo-oligomer, but not the LAP1 interaction, fail or succeed in reverting the Lap1 overexpression phenotype? The result could materially inform our mechanistic understanding of this novel transmembrane relay mechanism.

7) The relatively low level of LAP1B expression relative to LAP1C expression (and weaker association of LAP1C with chromatin) raises the possibility that LAP1C also competes with LAP1B for other binding partners, including Torsins. Although the authors note that LAP1C can also induce nuclear aberrations (albeit much more weakly than LAP1B) one wonders if a functional LAP1C-Torsin complex might serve a function that is disrupted by LAP1B over-expression. Is there any evidence for such crosstalk?

Author response

Essential revisions:

1) The reviewers were somewhat troubled by the interpretation that "…no post mitotic NE aberrations were observed in Tor1B(E178Q) expressing cells…", as shown in Figure 6B, C. This is confusing and seemingly contradicts the working model saying that increased LAP1 levels relative to active Tor1 lead to NE aberrations, in turn generating binucleated cells. As there is a certain degree of functional redundancy between Torsins (Laudermilch et al., 2016 and Tanabe et al., 2016), could this be due to the presence of endogenous TorsinA/B? Arguably, the most definitive experiment to support their central conclusion would be to show that a TorA/B knockout, or their co-depletion, results in the same phenotype as LAP1 overexpression considering that only TorA/B (but none of the other Torsins) act on Lap1 (Zhao et al., 2013). Or is even a TorB KO alone sufficient to cause similar effects?

We apologize that we have missed to provide a rational explanation for the above statement. We previously reported that post-mitotic NE aberrations are induced when membranes are artificially tethered to chromatin throughout mitosis (Champion et al., 2019). Notably, NE aberrations also arise when membranes are only tethered to chromatin from metaphase onwards, indicating that the precocious presence of membranes on chromatin during mitotic exit is the decisive parameter for this phenotype. In contrast, chromosome segregation errors and binucleation are caused by membrane chromatin contacts during pro-(meta)phase, and not observed if membranes are only tethered during metaphase, i.e. after chromosome alignment at the spindle equator.

While we always observed both NE aberrations and chromosome segregation errors/ binucleation when we induced LAP1B expression, Tor1B(E178Q) expression robustly induced chromosome segregation errors but failed to cause the prominent NE aberrations that we observed upon LAP1 overexpression, as highlighted by our note in the text. We don’t think that this contradicts our working model for two reasons. Firstly, when we overexpress LAP1B-GFP, GFP-positive membranes cover almost the entire mitotic chromatin mass in metaphase, while we observe fewer membrane patches at metaphase chromatin in presence of Tor1B(E178Q) at endogenous levels of LAP1. The latter seems sufficient to cause chromosome segregation defects but not NE aberrations. Secondly, it is possible that the membrane patches induced by Tor1B(E178Q) at endogenous levels of LAP1 are not as stably bound to chromatin due to their lower avidity, are more dynamically remodelled, or even eventually resolved, perhaps helped by the endogenous Torsins, as suggested by the reviewers. Notably, for chromosome segregation errors prometaphase is the decisive time window, while it is later mitosis (anaphase) for NE aberrations, providing a rationale as to why chromosome segregation errors are more likely to be consistent between both treatments.

We have now revised this section to read: “Notably, no severe post-mitotic NE aberrations were observed in Tor1B(E178Q) expressing cells, which might be explained by fewer, weaker and/or less persistent chromatin interactions of endogenous LAP1 in anaphase compared to overexpressed LAP1. We know from our previous work that late mitosis is indeed critical for the manifestation of this phenotype (Champion et al., 2019)”.

As suggested by the reviewers, we had tested whether depletion or knockout of Torsins induces a similar phenotype as Tor1B(E178Q) expression, however these data remained inconclusive. Firstly, we had generated TOR1A knock-out cells by CRSIPR/Cas9 and observed a high level of bi- and multinucleation in different clones generated with different guides as well as some nuclear shape abnormalities, consistent with our other observations. However, as binucleation is a phenotype that cannot be rescued, we performed a number of controls that then indicated that our CRISPR approach itself increased cell division defects when designed for unrelated targets, as long as the chosen guides found a genomic target. Thus, this data remained inconclusive. Similarly, we performed RNAi experiments to deplete Tor1A and Tor1B, the most abundant Torsins in HeLa cells. While we observed an increase in binucleation in the chosen HeLa cell line from 2% to about 6%, we feel that this data is too weak on its own, and we prefer to further investigate this issue in the future. However, we wish to emphasize that it is conceivable that the formation of Torsin-LAP1 oligomers might contribute to enhanced chromatin binding of LAP1, as already mentioned in the Discussion. In such a scenario, depletion of Torsins must not necessarily mimic the effect of Tor1B(E178Q) or LAP1B expression. Thus, this point remains to be addressed by other methods in the future.

2) The analyses strongly rely on the quantification of nuclear defects, but in some figures differences in nuclear defect severity are not so clear in the immunofluorescence images. How was severity of nuclear morphology defects quantified? From the images alone correlation with expression level is not so clear. The way that nuclear aberrations were quantified should be explained carefully in the text and/or legends.

In all figures, the intensity of the GFP signal allows for a direct comparison of expression levels since imaging of cells from the same experiment was performed at identical settings. At all indicated instances, we have additionally binned cells of similar expression levels for quantitative analyses. Nuclear shape aberrations were quantified in Figure 3, and the classification of assigned categories is shown in Figure 3B. As we did not use machine learning or another image analysis tool for quantification of NE aberrations, we have digitalized the 5 phenotypic classes into only two final bins, i.e. “yes” and “no” categories. We apologize that we had not described these aspects sufficiently. We have now added a section on quantification of GFP intensities and nuclear shape aberrations to Materials and methods (“Image processing and quantification”), and extended the corresponding figure legends.

3) Please address if and how the expression level of INM proteins tested was controlled, as this seems to be relevant for the phenotype (see Figure 1D)? Particularly SUN1 seems to be weakly expressed.

Please, see also above. In brief, the expression levels were quantified by integrating the NE GFP signal of individual nuclei in the fluorescent images. We think that there might have been some confusion on the quantification provided in former Figure 1E (the panel formerly at the right side of the immunoblots), which actually showed the quantification of the fluorescent images in Figure 1D. We have now rearranged the panels to hopefully address the point of the reviewers and revised the corresponding legend.

We agree that SUN1 was only weakly expressed in the cells presented in Figure 1A. We have repeated the experiment, now also taking images at 24 h, and replaced the panel. This demonstrates that even at higher expression levels SUN1 does not induce phenotypes similar to LAP1B. It also highlights that LAP1B-induced NE aberrations are only apparent in the vast majority of cells at 48 h after transient transfection (see also next point).

4) How did authors make sure that the cells had no nuclear aberrations before time lapse imaging was started? Did these cells never go through mitosis in the presence of the GFP-LAP1 before? How long do the cells survive in the presence of overexpressed LAP1? Authors may consider to show some of the data presented in Figure 5 (e.g. bi-nucleated cells) already here, to address cell fate upon LAP1 overexpression.

For these time-lapse experiments, we used tetracycline-inducible cell lines for which we can control the timing of LAP1B induction. As we had observed that the NE was smooth in most LAP1B-expressing cells 24 h after induction but aberrant after 48 h (see also new Figure 1A), we started the time-lapse imaging after 24 h. To address the point of the reviewers, we now better describe the experimental timeline in the corresponding figure legend. Notably, the time-lapse microscopy experiment shown in Figure 1B shows that the NE is smooth in LAP1B-expressing cells before mitosis but ruffled after mitosis, in contrast to LAP2b-GFP-expressing cells, demonstrating that the NE aberrations manifest during mitotic exit. We now also include corresponding video files.

We have not performed any cell survival assay but observed severe multinucleation and flower ball shaped giant nuclei after 72 h of LAP1B overexpression.

Without a marker for cellular contours, we cannot indicate binucleation in Figure 1. Taking up the suggestion of the reviewers, we now refer to a pair of closely juxtaposed nuclei in the legend to Figure 1D as a sign of potential binucleation and refer the reader to later parts of the manuscript.

5) One important aspect of the proposed model, not addressed in the study and not even discussed in the manuscript, is the fact that Torsin's activity on LAP1 has to be regulated during the cell cycle. LAP1 is tethered to the nuclear periphery to a great part by its interaction with chromatin in interphase cells, which contain active Torsin. In mitosis Torsin is required to release LAP1 from chromatin. Is Torsin regulated or do chromatin changes in mitosis contribute to the Torsin-mediated LAP1 release? The authors should at least address this point in the Discussion. Along these lines, although the authors have not been able to dissect the phosphorylation of the CBR in detail to this point, it is worth asking how the phosphodead/phosphomimetic mutations influence the chromatin association of the CBR alone. Similarly, one wonders if the "generic" phosphorylation status of LAP1B (as visualized on a PhosTag gel/blot, for example) is altered during mitosis and whether this is influenced by dominant-negative forms of Torsin.

It is currently unclear whether, and if so how, the activity of Torsins towards LAP1 is regulated during the cell cycle. As we already stated in the Discussion, “we do not necessarily assume that Torsins have evolved to liberate LAP1 from chromatin for open mitosis or that they possess a function dedicated to mitosis. […] We rather consider it likely that mitosis is perturbed as a consequence of a perturbed LAP1-Torsin interplay during interphase that manifests in the subsequent mitosis.” In light of this, we actually do not think that one must necessarily assume any cell cycle-specific regulation.

We really appreciate the reasoning of the reviewers on the chromatin changes and have introduced a sentence in our Discussion, to read: “Finally, mitotic changes in chromatin may also promote LAP1 dissociation during mitosis, and these changes might be affected by perturbation of the LAP1-Torsin axis.”

Regarding the effect of the phospho-mimetic mutants of the CBR, these were tested in altogether three settings: Firstly, in Figure 2E, for their contribution to NE targeting and mitotic chromatin association of the isolated CBR in the context of the CBR-SPAG4 fusion protein, in Figure 2F, for their effect on the ability of LAP1B(1-359) to induce NE aberrations and mitotic chromatin association of membranes, and thirdly, in FRAP experiments measuring LAP1 mobility at the INM (Figure 2—figure supplement 3 and Figure 5). We have not performed an in-depth analysis of a corresponding phospho-deficient mutant. And while we have observed mitotic phosphorylation of LAP1B in mitosis (visualized by changes in migration in normal SDS page and of some sites by mass spectrometry), we have not studied the influence of Tor1B(E178Q) expression. These are excellent suggestions for our future studies.

6) Although not absolutely essential, evidence for their speculation that the (hetero)oligomeric state of the Torsin/cofactor system influences their findings would be important for the Torsin field. The authors could test one key aspect comparatively easily: would a back interface Torsin mutant (Chase et al., 2017) selectively perturbing the Torsin homo-oligomer, but not the LAP1 interaction, fail or succeed in reverting the Lap1 overexpression phenotype? The result could materially inform our mechanistic understanding of this novel transmembrane relay mechanism.

We fully agree that this would be very informative, and we have indeed tried to exploit this mutant in the experimental setup used in Figure 3A. The corresponding Tor1B(G258D) mutant did not fully rescue LAP1B-induced NE aberrations in contrast to the wild-type enzyme (our unpublished observations). However, in comparison to the Tor1B(E178Q) mutant, the NE aberrations seemed less severe upon expression of Tor1B(G258D). Thus, this mutant behaves like a “hypomorph” in our assay and we thus find it hard to infer a mechanistic conclusion from the observed “intermediate” phenotype.

7) The relatively low level of LAP1B expression relative to LAP1C expression (and weaker association of LAP1C with chromatin) raises the possibility that LAP1C also competes with LAP1B for other binding partners, including Torsins. Although the authors note that LAP1C can also induce nuclear aberrations (albeit much more weakly than LAP1B) one wonders if a functional LAP1C-Torsin complex might serve a function that is disrupted by LAP1B over-expression. Is there any evidence for such crosstalk?

It is very likely that LAP1B and LAP1C share additional binding partners, one example being nuclear lamins. However, as LAP1B presents an N-terminal extension of LAP1C, we would expect that most of the functions of LAP1C should also be covered by the long isoform. Thus, rather than LAP1C having a function that is disturbed by LAP1B overexpression, we consider it more likely that LAP1B interacts with additional factors and may have additional functions. So far, we have not performed any differential proteomics of LAP1B and LAP1C.

Article and author information

Author details

  1. Naemi Luithle

    Institute of Biochemistry, Department of Biology, ETH Zurich, Zurich, Switzerland
    Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
  2. Jelmi uit de Bos

    1. Institute of Biochemistry, Department of Biology, ETH Zurich, Zurich, Switzerland
    2. Molecular Life Sciences Ph.D. Program, Zurich, Switzerland
    Formal analysis, Validation, Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8807-3284
  3. Ruud Hovius

    Institute of Chemical Sciences and Engineering - ISIC, EPFL, Lausanne, Switzerland
    Investigation, Visualization, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9258-6587
  4. Daria Maslennikova

    1. Institute of Biochemistry, Department of Biology, ETH Zurich, Zurich, Switzerland
    2. Molecular Life Sciences Ph.D. Program, Zurich, Switzerland
    Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  5. Renard TM Lewis

    1. Institute of Biochemistry, Department of Biology, ETH Zurich, Zurich, Switzerland
    2. Molecular Life Sciences Ph.D. Program, Zurich, Switzerland
    Resources, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  6. Rosemarie Ungricht

    Institute of Biochemistry, Department of Biology, ETH Zurich, Zurich, Switzerland
    Conceptualization, Investigation, Visualization, Methodology
    Competing interests
    No competing interests declared
  7. Beat Fierz

    Institute of Chemical Sciences and Engineering - ISIC, EPFL, Lausanne, Switzerland
    Conceptualization, Supervision, Writing - review and editing
    Competing interests
    No competing interests declared
  8. Ulrike Kutay

    Institute of Biochemistry, Department of Biology, ETH Zurich, Zurich, Switzerland
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8257-7465


Swiss National Science Foundation (310030_184801)

  • Ulrike Kutay


  • Beat Fierz

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Sumit Pawar, Annamaria Gamper, Jasmin van den Heuvel and Ivo Zemp for critical comments on the manuscript as well as the members of the Kutay lab for helpful discussions. Microscopy was performed on instruments of the ETHZ Microscopy Center Scope M. This work was funded by a grant of the Swiss National Science Foundation (SNSF) to U.K. (310030_184801), and by EPFL (BF).

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Megan C King, Yale School of Medicine, United States


  1. Megan C King, Yale School of Medicine, United States

Publication history

  1. Received: September 30, 2020
  2. Accepted: December 15, 2020
  3. Accepted Manuscript published: December 15, 2020 (version 1)
  4. Version of Record published: December 30, 2020 (version 2)


© 2020, Luithle et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,279
    Page views
  • 196
  • 6

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Naemi Luithle
  2. Jelmi uit de Bos
  3. Ruud Hovius
  4. Daria Maslennikova
  5. Renard TM Lewis
  6. Rosemarie Ungricht
  7. Beat Fierz
  8. Ulrike Kutay
Torsin ATPases influence chromatin interaction of the Torsin regulator LAP1
eLife 9:e63614.

Further reading

    1. Cell Biology
    Saskia-Larissa Jauch-Speer et al.
    Research Article Updated

    The proinflammatory alarmins S100A8 and S100A9 are among the most abundant proteins in neutrophils and monocytes but are completely silenced after differentiation to macrophages. The molecular mechanisms of the extraordinarily dynamic transcriptional regulation of S100a8 and S100a9 genes, however, are only barely understood. Using an unbiased genome-wide CRISPR/Cas9 knockout (KO)-based screening approach in immortalized murine monocytes, we identified the transcription factor C/EBPδ as a central regulator of S100a8 and S100a9 expression. We showed that S100A8/A9 expression and thereby neutrophil recruitment and cytokine release were decreased in C/EBPδ KO mice in a mouse model of acute lung inflammation. S100a8 and S100a9 expression was further controlled by the C/EBPδ antagonists ATF3 and FBXW7. We confirmed the clinical relevance of this regulatory network in subpopulations of human monocytes in a clinical cohort of cardiovascular patients. Moreover, we identified specific C/EBPδ-binding sites within S100a8 and S100a9 promoter regions, and demonstrated that C/EBPδ-dependent JMJD3-mediated demethylation of H3K27me3 is indispensable for their expression. Overall, our work uncovered C/EBPδ as a novel regulator of S100a8 and S100a9 expression. Therefore, C/EBPδ represents a promising target for modulation of inflammatory conditions that are characterized by S100a8 and S100a9 overexpression.

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Haikel Dridi et al.
    Research Article Updated

    Age-dependent loss of body wall muscle function and impaired locomotion occur within 2 weeks in Caenorhabditis elegans (C. elegans); however, the underlying mechanism has not been fully elucidated. In humans, age-dependent loss of muscle function occurs at about 80 years of age and has been linked to dysfunction of ryanodine receptor (RyR)/intracellular calcium (Ca2+) release channels on the sarcoplasmic reticulum (SR). Mammalian skeletal muscle RyR1 channels undergo age-related remodeling due to oxidative overload, leading to loss of the stabilizing subunit calstabin1 (FKBP12) from the channel macromolecular complex. This destabilizes the closed state of the channel resulting in intracellular Ca2+ leak, reduced muscle function, and impaired exercise capacity. We now show that the C. elegans RyR homolog, UNC-68, exhibits a remarkable degree of evolutionary conservation with mammalian RyR channels and similar age-dependent dysfunction. Like RyR1 in mammals, UNC-68 encodes a protein that comprises a macromolecular complex which includes the calstabin1 homolog FKB-2 and is immunoreactive with antibodies raised against the RyR1 complex. Furthermore, as in aged mammals, UNC-68 is oxidized and depleted of FKB-2 in an age-dependent manner, resulting in ‘leaky’ channels, depleted SR Ca2+ stores, reduced body wall muscle Ca2+ transients, and age-dependent muscle weakness. FKB-2 (ok3007)-deficient worms exhibit reduced exercise capacity. Pharmacologically induced oxidization of UNC-68 and depletion of FKB-2 from the channel independently caused reduced body wall muscle Ca2+ transients. Preventing FKB-2 depletion from the UNC-68 macromolecular complex using the Rycal drug S107 improved muscle Ca2+ transients and function. Taken together, these data suggest that UNC-68 oxidation plays a role in age-dependent loss of muscle function. Remarkably, this age-dependent loss of muscle function induced by oxidative overload, which takes ~2 years in mice and ~80 years in humans, occurs in less than 2–3 weeks in C. elegans, suggesting that reduced antioxidant capacity may contribute to the differences in lifespan among species.