Stem cell transplantation rescued a primary open-angle glaucoma mouse model
- Department of Ophthalmology, University of Pittsburgh, United States
- Eye Center of Xiangya Hospital, Central South University, China
- Hunan Key Laboratory of Ophthalmology, China
- Research Institute of Ophthalmology, Egypt
- Department of Developmental Biology, University of Pittsburgh, United States
- McGowan Institute for Regenerative Medicine, University of Pittsburgh, United States
Figures
Figure 1 with 2 supplements
Transplanted TMSCs reduce the IOP and increase the outflow facility of Tg-MyocY437H mice.
(A) Day-time IOP was measured in the wildtype mice (WT, n=26), Tg-MyocY437H mice (Tg, n=26), Tg mice treated with basal medium (Tg-Sham, n=26) and Tg mice with TMSC transplantation (Tg-TMSC, n=26). …
-
Figure 1—source data 1
Raw day-time IOP data for Figure 1A; Raw night IOP data for Figure 1B; Individual outflow facility for Figure 1C; Individual central corneal thickness for Figure 1E.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Genotyping of transgenic Myoc Y437H mice by polymerase chain reaction (PCR).
Tg-Myoc Y437H mice (+) displayed with PCR products of 249 bp (MyocY437H) and weak band at 610 bp (mouse DNA). The mice with only 610 bp band were transgenic negative mice (-). M: DNA markers.
Figure 1—figure supplement 2
Representative perfusion outflow data from each mouse group.
X-axis: perfusion pressure (mmHg), Y-axis: flow rate (μL/min), y is the slope indicating outflow facility (μL/min/mmHg).
Figure 2 with 1 supplement
TMSCs preserve the RGC function and prevent RGC loss in Tg-MyocY437H mice.
The function of RGCs in the mice was evaluated by pattern electroretinogram (PERG). (A) Representative examples of PERG from different groups at 2 months after transplantation. (B) Bar graphs of …
-
Figure 2—source data 1
Individual P1 amplitude in pattern electroretinogram for Figure 2B; Individual retinal ganglion cell count of each section for Figure 2C.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Transplanted TMSCs rescue RGCs and prevent neurodegeneration in Tg-MyocY437H mice.
Eye sections stained hematoxylin and eosin show the RGC layer in the eyes. The black INSET boxes in the left picture show the areas from which RGCs were captured so that the RGCs in the whole retina …
Figure 3
TMSCs increase the TM cellularity in the Tg-MyocY437H mice.
(A) Evaluation of the cellular density in the mouse TM region. Sections of the anterior segment were immunostained with collagen IV (red) and DAPI (blue). The TM region was determined by …
-
Figure 3—source data 1
Individual TM cell count of each section for Figure 3B.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig3-data1-v2.xlsx
Figure 4
Transplanted TMSCs differentiate into TM cells and viable up to 2 months post-transplantation.
(A) AQP1/CHI3L1 immunofluorescent staining shows integration of transplanted TMSCs (DiO+, green) into the TM and differentiation of TMSCs into TM cells with expression of AQP1 (red) and CHI3L1 …
-
Figure 4—source data 1
Individual TUNEL-positive cells per TM region per section for Figure 4D.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig4-data1-v2.xlsx
Figure 5
TMSCs reduce the Myoc retention in the TM tissue, promote the Myoc secretion into the aqueous humor, and reverse the ECM expression in the Tg-MyocY437H mice.
(A) Immunofluorescent staining shows accumulated Myoc in the TM, iris, and ciliary body of the Tg and Tg-sham mice. TMSC transplantation alleviated the aggregation of Myoc in the TM, similar to the …
-
Figure 5—source data 1
Relative myocilin protein levels in the corneal limbus for Figure 5B.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig5-data1-v2.xlsx
Figure 6
The effect of TMSCs on ER stress and ultrastructure of the TM in the Tg-Myoc Y437H mice.
(A): Western blotting results show the representative bands of CHOP and GRP78 expression in the mouse limbal tissue and the relative protein levels with β-actin as internal control (n = 6). (B) TEM …
-
Figure 6—source data 1
Relative ER stress protein levels in the corneal limbus for Figure 6A; Relative ER sizes of the TM cells for Figure 6C.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig6-data1-v2.xlsx
Figure 7 with 1 supplement
TMSCs could not reverse ER stress and stimulate proliferation of Myoc mutant TM cells in vitro.
(A) The TM cells were transduced with recombinant lentivirus encoding GFP and Myoc Y437H mutation. The transduced GFP+ cells were sorted by Flow cytometry and the cultured sorted TM cells were …
-
Figure 7—source data 1
Percentage of BrdU positive TM cells in different culture conditions for Figure 7D.
Relative protein levels by WB in the TM cells with different culture conditions for Figure 7F.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Structure of lentiviral packaging plasmid: pLentiCMV-Y437H-IRES-GFP.
Figure 8
TMSCs differentiate into TM cells in vitro under ER stress environment.
(A) Schematic illustration shows co-culturing of TMSCs with TM cells for detection of TMSC changes. (B) The expression of TM cell marker CHI3L1 was upregulated in the TMSCs after 10 days of …
-
Figure 8—source data 1
Relative CHI3L1 protein levels by WB in TMSC with different culture conditions for Figure 8B.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig8-data1-v2.xlsx
Figure 9
Transcriptome analysis of TM regeneration and neuroprotection genes among TMSC and fibroblasts.
(A) Heatmap shows gene expression profile of TMSCs as compared to fibroblasts for genes involved in maintenance of TM extracellular matrix (ECM), TM integrity and motility, (false discover rate …
-
Figure 9—source data 1
Related gene expression increase (p<0.05) in three individual TMSCs as compared to fibroblasts for Figure 9A.
Related neuroprotection related gene expression increase (p<0.05) in three individual TMSCs as compared to fibroblasts for Figure 9B.
- https://cdn.elifesciences.org/articles/63677/elife-63677-fig9-data1-v2.xlsx
Figure 10
Graphical abstract.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Transgenic Myoc Y437H mice | Courtesy of Dr. Gulab Zode Zode et al., 2011 | North Texas Eye Research Institute | |
| Cell line (Homo sapiens) | Trabecular Meshwork Stem Cells (TMSCs) | This paper | Cells isolated from both male and female donors, characterized, and maintained in Du lab | |
| Cell line (Homo sapiens) | Trabecular Meshwork Cells (TM cells) | This paper | ||
| Cell line (Homo sapiens) | Corneal fibroblasts | This paper | ||
| Commercial assay or kit | Mycoplasma contamination detection kit | InvivoGen | Cat# rep-pt1 | |
| Antibody | Anti-Collagen IV (Rabbit polyclonal) | Sigma-Aldrich | Cat# SAB4500369 RRID:AB_10743858 | IF(1:100) WB(1:1000) |
| Antibody | Anti-AQP1 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc25287 RRID:AB_626694 | IF (1:100) |
| Antibody | Anti-human CHI3L1 (Goat polyclonal) | R and D Systems | Cat# AF2599, RRID:AB_2291883 | IF(1:50), WB (1:250) |
| Antibody | Anti-Ki67 (Rabbit polyclonal) | Abcam | Cat# ab15580 RRID:AB_443209 | IF(1:500) |
| Antibody | Anti-myocilin (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat# Sc137233 RRID:AB_2148737 | IF(1:100) |
| Antibody | Anti-myocilin (Mouse monoclonal) | R and D Systems | Cat# MAB3446 RRID:AB_2148649 | WB(1:500) |
| Antibody | Anti-fibronectin (Rabbit polyclonal) | Abcam | Cat# b23750 RRID:AB_447655 | WB(1:1000) |
| Antibody | anti-elastin (Mouse monoclonal) | Millipore | Cat#: MAB2503 RRID:AB_2099602 | WB(1:500) |
| Antibody | CHOP (Mouse monoclonal) | Cell Signaling Technology | Cat#: 2895 RRID:AB_2089254 | WB(1:500) |
| Antibody | GRP78 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-376768 RRID:AB_2819145 | WB(1:1000) |
| Antibody | β-actin (Mouse monoclonal) | Thermo Fisher | Cat# MA5-15739 RRID:AB_10979409 | WB(1:5000) |
| Recombinant DNA reagent | pLentiCMV-GFP (plasmid) | AddGene | Cat# 17448 | Lentiviral construct |
| Recombinant DNA reagent | pCAGIG2 (plasmid) | AddGene | Cat# 111159 | IRES-EGFP cassette |
| Recombinant DNA reagent | pcDNA3 Myoc Y437H | Courtesy of Dr. John Hulleman Zadoo et al., 2016 | UT Southwestern | |
| Sequence-based reagent | Mouse DNA_F | Thermo Fisher | PCR primers | GACTAAGGCAAGAAAATGAGAATC |
| Sequence-based reagent | Mouse DNA _R | Thermo Fisher | PCR primers | CCTCTCCACTCCTGAGATAGC |
| Sequence-based reagent | Mutant Myoc_F | Thermo Fisher | PCR primers | ACAAAGGCAGGGTCGAGAAGACAGG |
| Sequence-based reagent | Mutant Myoc_R | Thermo Fisher | PCR primers | TTCCCACCTCTCTCTCCCCATGAGA |
| Commercial assay or kit | In Situ Cell Death Detection Kit | Sigma-Aldrich | Cat# 12156792910 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat# 74106 | |
| Commercial assay or kit | cDNA Reverse Transcription Kit | Life Technologies | Cat# 4368813 | |
| Commercial assay or kit | Power SYBR Green PCR Master Mix | Life Technologies | Cat# 4368708 | |
| Chemical compound | opsonized Alexa 546-conjugated S. aureus bioparticles | Thermo Fisher | Cat# A10010 | |
| Software, algorithm | String V11 | https://string-db.org/ | RRID:SCR_005223 | |
| Software, algorithm | FlowJo version 10 | https://www.flowjo.com/ | RRID:SCR_008520 | |
| Software, algorithm | ImageJ | https://fiji.sc/ | RRID:SCR_002285 | |
| Software, algorithm | Graphpad Prism 8 | https://www.graphpad.com/scientific-software/prism/ | RRID:SCR_002798 | |
| Software, algorithm | Espion version 6 | http://diagnosysllc.com | ||
| Other | DAPI | Sigma-Aldrich | Cat# D9542 | Stain: 1 µg/ml |
Additional files
-
Supplementary file 1
Related gene expression increase (p<0.05) in genes related to TM ECM interaction.
Related to Figure 9.
- https://cdn.elifesciences.org/articles/63677/elife-63677-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/63677/elife-63677-transrepform-v2.docx
