Inducible mechanisms of disease tolerance provide an alternative strategy of acquired immunity to malaria
- Institute of Immunology and Infection Research, University of Edinburgh, United Kingdom
- Centre for Immunity, Infection and Evolution, University of Edinburgh, United Kingdom
Figures
Figure 1 with 2 supplements
Malaria triggers emergency myelopoiesis and obliterates tissue-resident macrophages.
(A) C57Bl/6 mice were infected with Plasmodium chabaudi AJ or AS sporozoites; the blood-stage of infection started 2 days later after the release of merozoites from the liver. Mice were chronically …
Figure 1—figure supplement 1
P. chabaudi AJ causes severe disease without sequestering in host tissues.
(A–C) C57Bl/6 mice were infected with P. chabaudi AJ sporozoites; the blood-stage of infection started 2 days later after the release of merozoites from the liver. We refer to the emergence of …
Figure 1—figure supplement 2
Malaria causes major disturbances in tissue structure and integrity.
(A and B) Neutrophils (A) and total leukocytes (B) from uninfected mice (0 days p.i.), AJ-infected mice (5, 7, 11, and 40 days p.i.) and once-infected mice (memory, 70 days p.i.) were analysed by …
Figure 2 with 3 supplements
Monocytes differentiate into inflammatory macrophages in naive hosts but become quiescent in chronic infection.
(A) RNA sequencing of spleen monocytes flow-sorted from AJ-infected mice (7 and 40 days p.i.for acute and chronic, respectively) and once-infected mice (memory, 70 days p.i.). At each time point, …
Figure 2—figure supplement 1
Monocytes upregulate glycolysis and oxidative phosphorylation as they differentiate into inflammatory macrophages.
(A and B) RNA sequencing of spleen monocytes flow-sorted from AJ-infected mice (7 and 40 days p.i.for acute and chronic, respectively) and once-infected mice (memory, 70 days p.i.). Shown is the …
Figure 2—figure supplement 2
Parasite genotype does not influence the emergency myeloid response to malaria.
(A–C) Inflammatory and patrolling monocytes, neutrophils, progenitors, and tissue-resident macrophages (Mɸ) from uninfected mice (n = 10), AJ-infected mice (n = 5), and AS-infected mice (n = 5) were …
Figure 2—figure supplement 3
Quiescent monocytes can differentiate into inflammatory macrophages when removed from the spleen.
(A) Spleen monocytes were flow-sorted from uninfected mice (n = 4) or mice chronically infected with P. chabaudi AJ (40 days p.i., n = 5). Sorted cells were then prepared immediately for RNA …
Figure 3 with 1 supplement
Tolerance persists to protect host tissues during reinfection.
(A) Malaria reinfection model: C57Bl/6 mice were first infected with P. chabaudi AS sporozoites. Chronic infection was confirmed by qPCR at 40 days p.i. and drug-treated with the antimalarial drug …
Figure 3—figure supplement 1
Tissue architecture is preserved and key homeostatic processes are maintained in tolerised hosts.
(A) Paraffin-embedded femur sections were H&E stained during the acute phase of first or second infection (11 days p.i.). (B) Neutrophils from mice experiencing their first (n = 5 per time point) or …
Figure 4 with 1 supplement
Monocytes minimise inflammation in tolerised hosts.
(A) RNA sequencing of spleen monocytes flow-sorted during the acute phase of first or second infection (7 days p.i.). In each case, the number of differentially expressed genes (DEG, padj <0.01, >1.5…
Figure 4—figure supplement 1
Monocytes minimise inflammation in tolerised hosts.
(A–C) RNA sequencing of spleen monocytes flow-sorted from mice experiencing their first or second infection (acute, 7 days p.i.). Shown is the log2 fold change (FC) of (A) pattern recognition …
Figure 5
Disease tolerance is established after one malaria episode.
(A and B) ClueGO network of DEG in spleen monocytes during the acute phase of second infection. Each node represents a significantly enriched gene ontology (GO) term and node size is determined by pa…
Figure 6 with 1 supplement
Malaria does not induce epigenetic reprogramming of bone marrow monocytes.
(A) Chromatin immunoprecipitation (ChIP)seq of bone marrow monocytes flow-sorted from once-infected mice (AJ, memory, 70 days p.i.) and uninfected controls. Shown are the Integrative Genomics Viewer …
Figure 6—figure supplement 1
Malaria does not induce epigenetic reprogramming of bone marrow monocytes.
Chromatin immunoprecipitation (ChIP)seq of bone marrow monocytes flow-sorted from once-infected mice (AJ, memory, 70 days p.i.) and uninfected controls. Shown are the Integrative Genomics Viewer …
Figure 7 with 1 supplement
Monocytes are transcriptionally reprogrammed in the remodelled spleen.
(A) RNA sequencing of spleen monocytes flow-sorted from AJ-infected mice (7 and 40 days p.i. for acute and chronic, respectively), once-infected mice (memory, 70 days p.i.), and reinfected mice …
Figure 7—figure supplement 1
Tissue printing shapes the transcriptional programme of recruited monocytes to meet the needs of the niche.
(A and B) Microarray of red pulp macrophages (Mɸ) flow-sorted from the spleens of once-infected mice (memory, 100 days p.i.) and age-matched uninfected controls. Data are displayed as the RMA …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus C57Bl/6J female) | C57Bl/6 | The Jackson Laboratory | RRID:IMSR_JAX:000664 | Bred and housed in individually ventilated cages (SPF conditions) at the University of Edinburgh |
| Strain, strain background (Plasmodium chabaudi chabaudi AS) | P. chabaudi AS | The European malaria reagent repository http://www.malariaresearch.eu | Clone 28AS11 | |
| Strain, strain background (Plasmodium chabaudi chabaudi AJ) | P. chabaudi AJ | Clone 96AJ15 | ||
| Strain, strain background (Anopheles stephensi SD500) | Mosquitoes | Reared in-house at the University of Edinburgh | ||
| Antibody | Anti-mouse B220 (rat monoclonal) | Clone RA3-6B2 eBioscience - sold by ThermoFisher | RRID:AB_10717389 | (0.2 μl) per test = 2 million cells in 100 μl volume |
| Antibody | Anti-mouse CD3ε (Armenian hamster monoclonal) | Clone 145–2 C11 BioLegend | RRID:AB_312676 | (0.3 μl) per test |
| Antibody | Anti-mouse CD4 (rat monoclonal) | Clone RM4-5 BioLegend | RRID:AB_312718 | (0.3 μl) per test |
| Antibody | Anti-mouse CD8a (rat monoclonal) | Clone 53–6.7 BioLegend | RRID:AB_312750 | (0.3 μl) per test |
| Antibody | Anti-mouse CD11b (rat monoclonal) | Clone M1/70 BioLegend | RRID:AB_312798 | (0.1 μl) per test |
| Antibody | Anti-mouse CD11c (Armenian hamster monoclonal) | Clone N418 BioLegend | RRID:AB_313776 | (0.15 μl) per test |
| Antibody | Anti-mouse CD16/32 (rat monoclonal) | Clone 93 eBioscience - sold by ThermoFisher | RRID:AB_469598 | (0.5 μl) per test |
| Antibody | TruStain FcX anti-mouse CD16/32 (rat monoclonal) | Clone 93 BioLegend | RRID:AB_1574973 | (2 μl) per test blocks FcɣR II/III prior to antibody staining |
| Antibody | Anti-mouse CD19 (rat monoclonal) | Clone 6D5 BioLegend | RRID:AB_313646 | (0.1 μl) per test |
| Antibody | Anti-mouse CD27 (Armenian hamster monoclonal) | Clone LG.7F9 eBioscience - sold by ThermoFisher | RRID:AB_465614 | (0.3 μl) per test |
| Antibody | Anti-mouse CD34 (rat monoclonal) | Clone RAM34 eBioscience - sold by ThermoFisher | RRID:AB_465021 | (0.4 μl) per test |
| Antibody | Anti-mouse CD71 (rat monoclonal) | Clone RI7217 BioLegend | RRID:AB_10899739 | (0.3 μl) per test |
| Antibody | Anti-mouse CD115/Csf1r (rat monoclonal) | Clone AFS98 BioLegend | RRID:AB_2562760 | (0.3 μl) per test |
| Antibody | Anti-mouse CD135/Flt3 (rat monoclonal) | Clone A2F10 eBioscience - sold by ThermoFisher | RRID:AB_465859 | (2.5 μl) per test |
| Antibody | Anti-mouse CD169 (rat monoclonal) | Clone 3D6.112 BioLegend | RRID:AB_2563910 | (1 μl) per test |
| Antibody | Anti-mouse cKit/CD117 (rat monoclonal) | Clone 2B8 eBioscience - sold by ThermoFisher | RRID:AB_1834421 | (0.3 μl) per test |
| Antibody | Anti-mouse CX3CR1 (mouse monoclonal) | Clone SA011F11 BioLegend | RRID:AB_2564493 | (0.3 μl) per test |
| Antibody | Anti-mouse F4/80 (rat monoclonal) | Clone BM8 BioLegend | RRID:AB_10901171 | (0.8 μl) per test |
| Antibody | Anti-mouse IAb (mouse monoclonal) | Clone AF6-120.1 BioLegend | RRID:AB_313724 | (0.5 μl) per test |
| Antibody | Anti-mouse Ly6C (rat monoclonal) | Clone HK1.4 BioLegend | RRID:AB_2562177 | (0.1 μl) per test |
| Antibody | Anti-mouse Ly6G (rat monoclonal) | Clone 1A8-Ly6g eBioscience - sold by ThermoFisher | RRID:AB_2573893 | (0.2 μl) per test |
| Antibody | Anti-mouse NK1.1 (mouse monoclonal) | Clone PK136 BioLegend | RRID:AB_313396 | (0.3 μl) per test |
| Antibody | Anti-mouse Nr4a1/Nur77 (mouse monoclonal) | Clone 12.14 eBioscience - sold by ThermoFisher | RRID:AB_1257209 | (0.3 μl) per test intracellular stain |
| Antibody | Anti-mouse Sca1/Ly6a (rat monoclonal) | Clone D7 BioLegend | RRID:AB_2562275 | (2 μl) per test |
| Antibody | Anti-mouse Ter119 (rat monoclonal) | Clone Ter119 BioLegend | RRID:AB_313712 | (0.3 μl) per test |
| Antibody | Anti-mouse VCAM-1 (rat monoclonal) | Clone 429 BioLegend | RRID:AB_1595594 | (0.5 μl) per test |
| Antibody | Anti-H3K27ac ChIPseq grade (rabbit polyclonal) | Diagenode #C15410196 see our optimised ChIPseq protocol dx.doi.org/10.17504/protocols.io.bja3kign | RRID:AB_2637079 | (2 μg) per ChIP |
| Antibody | Anti-H3K4me1 ChIPseq grade (rabbit polyclonal) | Diagenode #C15410037 see our optimised ChIPseq protocol dx.doi.org/10.17504/protocols.io.bja3kign | RRID:AB_2561054 | (5 μg) per ChIP |
| Antibody | Anti-H3K9me3 ChIPseq grade (rabbit polyclonal) | Diagenode #C15410193 see our optimised ChIPseq protocol dx.doi.org/10.17504/protocols.io.bja3kign | RRID:AB_2616044 | (1 μg) per ChIP |
| Sequence-based reagent | Forward primer | 5-GCGAGAAAGTTAAAAGAATTGA-3 | For measuring P. chabaudi blood-stage parasitaemia by quantitative PCR | |
| Sequence-based reagent | Reverse primer | 5-CTAGTGAGTTTCCCCGTGTT-3 | ||
| Sequence-based reagent | Probe | [6FAM] - AAATTAAGCCGCAAGCTCCACG - [TAM] | ||
| Commercial assay or kit | Quick DNA Universal Microprep Kit | Zymo Research | D4074 | |
| Commercial assay or kit | IFNɣ mouse ELISA kit, extra sensitive | Invitrogen - sold by ThermoFisher | BMS609 | |
| Commercial assay or kit | IP-10 (CXCL10) mouse ELISA kit | Invitrogen - sold by ThermoFisher | BMS6018 | |
| Commercial assay or kit | Mouse/rat Angiopoietin-2 quantine ELISA kit | R&D Systems | MANG20 | |
| Commercial assay or kit | Foxp3 / Transcription Factor Staining Buffer Set | eBioscience - sold by ThermoFisher | 00-5523-00 | |
| Commercial assay or kit | SMART-Seq v4 Ultra Low Input RNA Kit | Takara Bio | 634891 | |
| Commercial assay or kit | Nextera XT DNA Library Preparation Kit | Illumina | FC-131-1024 | |
| Commercial assay or kit | True MicroChIP kit | Diagenode | C01010130 | |
| Commercial assay or kit | MicroPlex Library Preparation Kit v2 | Diagenode | C05010012 | |
| Commercial assay or kit | RNA Clean and Concentrator-5 Kit | Zymo Research | R1013 | |
| Commercial assay or kit | GeneChip WT Pico Kit | Affymetrix - sold by ThermoFisher | 902622 | |
| Commercial assay or kit | GeneChip Mouse Gene 1.0 ST Array | Affymetrix - sold by ThermoFisher | 901168 | |
| Chemical compound, drug | 4-Aminobenzoic acid | Sigma-Aldrich | A9878 | |
| Chemical compound, drug | Chloroquine diphosphate salt | Sigma-Aldrich | C6628 | Dissolve in water, dosage: 100 mg/kg by oral gavage |
| Chemical compound, drug | Lipopolysaccharide from Escherichia coli 0111:B4 | Sigma-Aldrich | L4391 | |
| Software, algorithm | bowtie2 v2.2.7 | (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | RRID:SCR_016368 | |
| Software, algorithm | DESeq2 | (Love et al., 2014) https://bioconductor.org/packages/release/bioc/html/DESeq2.html | RRID:SCR_015687 | |
| Software, algorithm | Cytoscape v3.8.0 | (Shannon et al., 2003) https://cytoscape.org/ | RRID:SCR_003032 | |
| Software, algorithm | clueGO v2.5.4 | (Bindea et al., 2009; Mlecnik et al., 2014) http://apps.cytoscape.org/apps/cluego | RRID:SCR_005748 | |
| Software, algorithm | HOMER v4.10 | (Heinz et al., 2010) http://homer.ucsd.edu/ | RRID:SCR_010881 | |
| Software, algorithm | Integrative genomics viewer (IGV) | (Thorvaldsdóttir et al., 2013) http://www.broadinstitute.org/igv/ | RRID:SCR_011793 |
Additional files
-
Supplementary file 1
Gating strategies for flow cytometry and cell sorting.
Flow cytometry was performed using the listed antibodies and panels. We gated myeloid cells and their progenitors in bone marrow, blood, and spleen using FlowJo v9; flow profiles of uninfected mice are displayed alongside the acute phase of a first malaria episode (P. chabaudi AJ). In every case, gating was performed identically between uninfected and infected mice with one exception (marked with an asterisk); to identify myeloid and erythroid progenitors in the bone marrow of infected mice we had to adjust our first gate (on lineage negative live singlets) due to the well-known upregulation of Sca-1 during acute infection (Belyaev et al., 2010). Note that CD115 (Csf1r) was replaced with CD11c when sorting monocytes as engagement of the Csf1 receptor has been shown to induce transcriptional changes (Jung et al., 2000).
- https://cdn.elifesciences.org/articles/63838/elife-63838-supp1-v1.pdf
-
Supplementary file 2
Quantitative changes in the histone modification profiles of once-infected mice.
Bone marrow monocytes were flow-sorted from once-infected mice (AJ, memory, 70 days p.i.) and uninfected controls for chromatin immunoprecipitation (ChIP)seq; differences in their histone modification profiles were then quantified by calling differentially modified regions (DMR, annotated to the nearest gene). Shown is a list of all tolerised/specialised genes annotated with a DMR, ordered by peak score.
- https://cdn.elifesciences.org/articles/63838/elife-63838-supp2-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/63838/elife-63838-transrepform-v1.docx
