Telomeric double-strand DNA-binding proteins DTN-1 and DTN-2 ensure germline immortality in Caenorhabditis elegans
- Department of Chemistry and Molecular Biology, University of Gothenburg, Sweden
- Proteomics Core Facility, Sahlgrenska Academy, University of Gothenburg, Sweden
Figures
Figure 1 with 3 supplements
DTN-1 and DTN-2 form complexes with POT-1 and POT-2.
(A) Genes identified in the POT-1 Y2H screening with the number of identified clones. (B) Schematic of the DTN-1 and DTN-2 protein sequences highlighting the MYB domains, acidic domains, and …
Figure 1—figure supplement 1
Results of the POT-1 Y2H screening blue bars indicate the individual peptides identified in the Y2H screening.
POT-1-binding region (PBR) is identified as the highly conserved region within the C-terminus regions of DTN-1 and DTN-2, which are commonly identified in the Y2H screening.
Figure 1—figure supplement 2
Structural modeling and domain conformation of DTN-1 and DTN-2.
(A) The Phyre two program (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) identified two MYB domains (MYB1 and MYB2) in DTN-1 and one MYB domain (MYB3) in DTN-2 by the structural …
Figure 1—figure supplement 3
Validation of in vivo interactions between DTN-1/2, POT-1, and POT-2 immunoprecipitates with the GFP antibody from wild type (N2) and knock-in worms (gfp::flag::pot-1 and pot-2::gfp).
Input and immunoprecipitates (GFP-IP) were immunoblotted with the indicated antibodies. Note that the inputs blotted with anti-DTN-1 and anti-DTN-2 were less intense compared to the GFP-IPs blotted …
Figure 2 with 1 supplement
DTN-1 and DTN-2 bind to telomeric dsDNA.
(A) Sequence alignment of the MYB domains from budding yeast Rap1 (scRap1-MYB1 and MYB2), mouse and human TRF1 and TRF2 (mTRF1, mTRF2, hTRF1, and hTRF2), rice RTBP1, and C. elegans DTN-1 and DTN-2. …
-
Figure 2—source data 1
Quantifications of the EMSA from three independent experiments.
- https://cdn.elifesciences.org/articles/64104/elife-64104-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
EMSA assay with short telomeric repeats EMSA assay with increasing amounts of MBP-DTN-1 (twofold steps up to 8.8 μM) and MBP-DTN-2 (twofold steps up to 3.2 μM).
The labeled DNA probes are 0.2 nM of ligated oligonucleotides containing one, two, and three telomere repeats.
Figure 3 with 1 supplement
The constitutive telomeric localization of DTN-1 and DTN-2.
(A) Embryos or germlines from knock-in worms (dtn-1::flag::gfp and dtn-2::flag::gfp) fixed and stained with DAPI. The graph shows the number of GFP foci per nucleus. The mean value ± SD is shown. n …
-
Figure 3—source data 1
Quantifications of the number of GFP foci per nucleus.
- https://cdn.elifesciences.org/articles/64104/elife-64104-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Constitutive telomeric localization of DTN-1-GFP and DTN-2-GFP.
Adult knock-in worms (dtn-1::flag::gfp and dtn-2::flag::gfp) were fixed and stained with DAPI. Scale bars, 5 μm and 1 μm (magnified panel).
Figure 4 with 1 supplement
DTN-1 and DTN-2 are required for germline immorality.
(A) Schematic of the dtn-1 and dtn-2 KO alleles. Exons are shown as gray rectangles with the start codon (ATG) and stop codon (STP). The deleted regions are marked by blue rectangles. Primer …
-
Figure 4—source data 1
The brood size quantifications.
- https://cdn.elifesciences.org/articles/64104/elife-64104-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Mutually independent telomeric localization of DTN-1 and DTN-2.
Embryos or germlines from the indicated genotypes were fixed and stained with DAPI.
Note, DTN-1-GFP signals are visible even in the dtn-2 mutant worms and vice versa. Scale bars, 5 μm and 1 μm (magnified panel).
Figure 5 with 2 supplements
DTN-1 and DTN-2 are required for telomere length homeostasis.
(A) The frequency of male worms among the progeny from the indicated genotypes. In total, 6551, 13270, 12317, and 1113 worms were analyzed from each genotype (dtn-1+⁄+; dtn-2+⁄+, dtn-1−⁄−; dtn-2+⁄+, …
-
Figure 5—source data 1
Analyses of dtn-1, dtn-2, and the double KO worms.
- https://cdn.elifesciences.org/articles/64104/elife-64104-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Quantification of telomeric FISH foci in epidermal cells.
The number of telomeric FISH foci per nucleus. The mean value is shown. n shows the analyzed number of nuclei pooled from five different worms. Analysis was with two-tailed t-tests. ns., not …
Figure 5—figure supplement 2
Quantification of Southern blot analysis.
The band intensities were quantified from the bottom to the top of the membrane. The allows show the peak positions, indicating that telomeric DNA from dtn-1 and dtn-2 show slower and faster …
Author response image 1
Author response image 2
Author response image 3
Author response image 4
(A) EMSA with increasing amounts of MBP-DTN-1 (twofold steps up to 8.8 μM) and MBP-DTN-2 (twofold steps up to 3.2 μM). The labeled DNA probes are 0.2 nM of ligated oligonucleotides containing random dsDNA sequences (5’-GCTGTACTGGTA-3’) followed by four telomere repeat dsDNA (ds), four telomere repeat dsDNA with two telomere repeat 3’ ssDNA overhang (3’ G-overhang), and four telomere repeat dsDNA with two telomere repeat 5’ssDNA overhang (5’ C-overhang). (B) Quantifications of the EMSA. Error bars are ± SD from three independent experiments. (C) Statistical analyses of (B) with two-tailed t-tests.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Caenorhabditis elegans) | R06A4.2 / dtn-1 | This paper | N/A | (cloned from a mix stage cDNA library) |
| Gene (Caenorhabditis elegans) | T12E12.3 / dtn-2 | This paper | N/A | (cloned from a mix stage cDNA library) |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | N2 (wild type) | Caenorhabditis Genetics Center (CGC); https://cbs.umn.edu/cgc/home | N2 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | dtn-1 | This paper | Aelle; syb1925 Strain: PHX1925 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | dtn-2 | This paper | Aelle; syb1886 Strain: PHX1886 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | dtn-1::flag::gfp | This paper | Aelle; syb2016 Strain: PHX2016 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | dtn-2::flag::gfp | This paper | Aelle; syb1995 Strain: PHX1995 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | dtn-1::flag::gfp; dtn-2 | This paper | Aelle; dtn-1::flag::gfp; dtn-2 Strain: HS001 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | dtn-1; dtn-2::flag::gfp | This paper | Aelle; dtn-1; dtn-2::flag::gfp Strain: HS002 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | nT1[qIs51]/dtn-2; dtn-1/dtn-1 | This paper | Aelle; nT1[qIs51]/syb1886; syb1925/syb1925 Strain: PHX2217 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | gfp::flag::pot-1 | This paper | Aelle; syb3002 Strain: PHX3002 | |
| Strain, strain background (Caenorhabditis elegans, hermaphrodite) | pot-2::gfp | This paper | Aelle; syb889 Strain: PHX889 | |
| Antibody | anti-GFP (Rabbit polyclonal) | Invitrogen | Cat#A11122, LOT#2015993 | IF (1:1000), WB (1:1000) |
| Antibody | anti-DTN-1 (Rabbit polyclonal) | This paper | N/A | WB (1:1000) |
| Antibody | anti-DTN-2 (Rabbit polyclonal) | This paper | N/A | WB (1:1000) |
| Antibody | anti-POT-1 (Rabbit polyclonal) | This paper | N/A | WB (1:1000) |
| Antibody | anti-POT-2 (Rabbit polyclonal) | This paper | N/A | WB (1:1000) |
| Antibody | anti-β-ACTIN (Mouse monoclonal) | Sigma | Cat#A2228-200UL, LOT#067M4856V | WB (1:1000) |
| Antibody | anti-GFP (Mouse monoclonal) | Roche | Cat#11814460001, LOT#42903200 | IP |
| Antibody | Donkey Anti-Rabbit Alexa 488 | Invitrogen | Cat#A21206, LOT#1834802 | 1:1000 |
| Antibody | Peroxidase Goat Anti-Mouse IgG | Bio Rad | Cat#170–6516 | 1:1000 |
| Antibody | Peroxidase Goat Anti-Rabbit IgG | Bio Rad | Cat#170–6515 | 1:1000 |
| Recombinant DNA reagent | pMAL-c5X-dtn-1 (plasmid) | This paper | N/A | |
| Recombinant DNA reagent | pMAL-c5X-dtn-2 (plasmid) | This paper | N/A | |
| Recombinant DNA reagent | pET28c+-dtn-1 (a.a. 441–837) | This paper | N/A | |
| Recombinant DNA reagent | pET28c+-dtn-2 (a.a. 434–818) | This paper | N/A | |
| Recombinant DNA reagent | pET28c+-pot-2 | This paper | N/A | |
| Recombinant DNA reagent | pGEX-6P-1-pot-1 (a.a. 100–300) | This paper | N/A | |
| Recombinant DNA reagent | pB27-pot-1 | Hybrigenics Services | N/A | |
| Recombinant DNA reagent | pP6-mix-staged C. elegans cDNA | Hybrigenics Services | N/A | |
| Recombinant DNA reagent | pGBKT-7-dtn-1 | This paper | N/A | |
| Recombinant DNA reagent | pGBKT-7-dtn-2 | This paper | N/A | |
| Recombinant DNA reagent | pGBKT-7-dtn-1ΔPBR(a.a. 1–736) | This paper | N/A | |
| Recombinant DNA reagent | pGBKT-7-dtn-2ΔPBR(a.a. 1–715) | This paper | N/A | |
| Recombinant DNA reagent | pGADT7-POT-1 | This paper | N/A | |
| Recombinant DNA reagent | pGADT7-POT-2 | This paper | N/A | |
| Sequence-based reagent | dtn-1 genotype Common-Forward | This paper | PCR primers | 5'- CGGCAATTTGGCACGATGTT −3' |
| Sequence-based reagent | dtn-1 genotype WT-Reverse | This paper | PCR primers | 5'- AATGACGGTCTTGACGGCTT −3' |
| Sequence-based reagent | dtn-1 genotype KO-Reverse | This paper | PCR primers | 5'- TGGCCCAAAATCAGCCTCAA −3' |
| Sequence-based reagent | dtn-2 genotype Common-Forward | This paper | PCR primers | 5'- TTGCGCTTTTGCTTCATCCG −3' |
| Sequence-based reagent | dtn-2 genotype WT-Reverse | This paper | PCR primers | 5'- CTCCGCCGTAAACACAGACT −3' |
| Sequence-based reagent | dtn-2 genotype KO-Reverse | This paper | PCR primers | 5'- GGGCACCAGAGGTAACTTCA −3' |
| Sequence-based reagent | dtn-1::flag::gfp genotype Common-Forward | This paper | PCR primers | 5'- GGCAACGTCGAGAACGAGAA −3' |
| Sequence-based reagent | dtn-1::flag::gfp genotype WT-Reverse | This paper | PCR primers | 5'- ATGACTAGGGCGAGGGGTAA −3' |
| Sequence-based reagent | dtn-1::flag::gfp genotype mutant-Reverse | This paper | PCR primers | 5'- CACCCTCTCCACTGACAGAAAA −3' |
| Sequence-based reagent | dtn-2::flag::gfp genotype Common-Forward | This paper | PCR primers | 5'- GCACAGAAGCCATCCGAAAA −3' |
| Sequence-based reagent | dtn-2::flag::gfp genotype WT-Reverse | This paper | PCR primers | 5'- TAGGGCTGAGGCTAAAGAATGAA −3' |
| Sequence-based reagent | dtn-2::flag::gfp genotype mutant-Reverse | This paper | PCR primers | 5'- TCACCCTCTCCACTGACAGA −3' |
| Sequence-based reagent | gfp::flag::pot-1 genotype Common-Forward | This paper | PCR primers | 5'- TATGCAACGAACGAGGCTCC −3' |
| Sequence-based reagent | gfp::flag::pot-1 genotype WT-Reverse | This paper | PCR primers | 5'- GACCCGGTACCAAATCCTGA −3' |
| Sequence-based reagent | gfp::flag::pot-1 genotype mutant-Reverse | This paper | PCR primers | 5'- ATGTTGCATCACCTTCACCCT −3' |
| Sequence-based reagent | pot-2::gfp genotype Common-Forward | This paper | PCR primers | 5'- CGAAAACATTCGCTGAGGCT −3' |
| Sequence-based reagent | pot-2::gfp genotype WT-Reverse | This paper | PCR primers | 5'- GCTAGCGCCACAACCAAAC −3' |
| Sequence-based reagent | pot-2::gfp genotype mutant-Reverse | This paper | PCR primers | 5'- TGTTGCATCACCTTCACCCT −3' |
| Software, algorithm | SoftWoRx | GE healthcare life science | http://www.gelifesciences.com/webapp/wcs/stores/servlet/productById/en/GELifeSciences-se/29065728 | |
| Software, algorithm | CLUSTALW | https://www.genome.jp/tools-bin/clustalw | ||
| Software, algorithm | Phyre2 | http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index | ||
| Software, algorithm | Jpred 4 | http://www.compbio.dundee.ac.uk/jpred/ |
Additional files
-
Supplementary file 1
Full list of peptides identified in control IP, DTN-1-FLAG-GFP IP, and DTN-2-FLAG-GFP IP.
- https://cdn.elifesciences.org/articles/64104/elife-64104-supp1-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64104/elife-64104-transrepform-v2.docx
