Dyshomeostatic modulation of Ca2+-activated K+ channels in a human neuronal model of KCNQ2 encephalopathy
- The Ken & Ruth Davee Department of Neurology, Feinberg School of Medicine, Northwestern University, United States
- Department of Pharmacology, Feinberg School of Medicine, Northwestern University, United States
- Department of Physiology, Feinberg School of Medicine, Northwestern University, United States
- Center for Autism and Neurodevelopment, Feinberg School of Medicine, Northwestern University, United States
- Epilepsy Center and Division of Neurology, Departments of Pediatrics and Neurology, Ann & Robert H. Lurie Children's Hospital of Chicago, Feinberg School of Medicine, Northwestern University, United States
Figures
Figure 1 with 4 supplements
Generation of KCNQ2-DEE patient-specific iPSC-derived neurons.
(A) Illustration of proposed structure of KCNQ2 channel subunit containing the mutation R581Q at the C-terminus (red) and other variants associated with KCNQ2-epileptic encephalopathy reported in …
-
Figure 1—source data 1
Quantification of RT-qPCR expression ΔΔCt values of KCNQ2 splice variants for Figure 1H.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Whole-cell voltage-clamp analysis of KCNQ2 R581Q.
Whole-cell currents were recorded using automated patch clamp from KCNQ3-stably expressing CHO-K1 cells transiently transfected with either. (A–C) wild-type KCNQ2 or R581Q in the homozygous KCNQ2 …
Figure 1—figure supplement 2
Quality control studies of iPSC lines.
(A–B) Analysis of KCNQ2 targeted region after CRISPR/Cas9 gene correction. To validate the absence of large indels or mosaicism, a 0.99 Kb DNA fragment of genomic DNA around the targeted site was …
Figure 1—figure supplement 3
CRISPR off-target and whole genome sequencing analysis of iPSC lines.
(A) Analysis of potential CRISPR off-target sites. The top ten genomic regions of homology with the CRISPR/Cas9 targeted region (Supplementary file 1) were analyzed by a T7 endonuclease assay (Supple…
Figure 1—figure supplement 4
Quality control studies of iPSC-derived neurons.
(A) Top: Design of lentiviral vectors for Ngn2-mediated conversion of iPSCs to cortical excitatory neurons through tetracycline-inducible expression of exogenous proteins driven by a …
Figure 2 with 1 supplement
KCNQ2-DEE neurons exhibit enhanced spontaneous phasic bursting.
(A) Representative images at ×4 magnification of GFP-fluorescing KCNQ2-DEE and isogenic control neurons plated on MEA wells on day 24 in culture. Scale bar: 400 µm (B) Representative spike raster …
-
Figure 2—source data 1
Quantification of DIV 15–31 MEA data parameters for Figure 2 and Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
MEA quality control and bursting measurements.
(A) Left: Early MEA recordings from days 10 to 13. Q2-04R581Q/+ neurons exhibit a greater number of active electrodes compared to isoQ2-04+/+ early on (repeated measures ANOVA for genotype: F(1,195) …
-
Figure 2—figure supplement 1—source data 1
Quantification of DIV 10–13 MEA data parameters for Figure 2—figure supplement 1A and B.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
KCNQ2-DEE neurons exhibit progressive enhancement of AP repolarization and post-burst AHP.
(A) Experimental time line. (B) Representative images of GFP-fluorescing isogenic control neurons during weeks 3, 4, and 5. Scale bar: 400 µm. (C) Representative whole-cell current-clamp traces …
-
Figure 3—source data 1
Quantification of passive and active current-clamp parameters for Figure 3 and Figure 3—figure supplement 1A and B.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Intrinsic excitability passive and active properties and effects of acute XE991 application.
(A) Passive membrane properties measured during weeks 3, 4, and 5. Time course of resting membrane potential (RMP) and input resistance (IR, measured at RMP) for iPSC-derived neurons in culture. As …
Figure 4 with 1 supplement
Enhanced expression of Ca2+-activated K+ channel genes in KCNQ2-DEE neurons.
(A) qPCR gene expression pattern of K+ channels and major β subunits involved in AP repolarization and post-burst AHP on week 3. KCNMA1 and KCNN4 expression was significantly higher in Q2-04R581Q/+ …
-
Figure 4—source data 1
Quantification of RT-qPCR expression ΔΔCt values for Figure 4 and Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Expression of ion channel genes in KCNQ2-DEE neurons.
(A) qPCR gene expression pattern of ion channels at week 3. KCNA4 expression was significantly higher in Q2-04R581Q/+ neurons (t test: *p=0.0216). (B) At week 5, expression of KCNA1 and KCNA2 was …
Figure 5
KCNQ2-DEE neurons exhibit a dyshomeostatic increase in SK and BK channel function.
(A) Experimental protocol. Baseline measures were made after establishing the whole-cell configuration in current-clamp mode. After exactly 10 min of continuous perfusion of 500 nM apamin in aCSF, …
-
Figure 5—source data 1
Quantification of current-clamp parameters before and after acute apamin treatment for Figure 5A–C.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig5-data1-v1.xlsx
-
Figure 5—source data 2
Quantification of MEA data parameters before and after acute apamin and paxilline treatment for Figure 5D and Figure 6—figure supplement 3.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig5-data2-v1.xlsx
Figure 6 with 4 supplements
Chronic inhibition of M-current in control neurons phenocopies KCNQ2-DEE.
(A) Experimental time line. (B) Representative AP traces from Q2-04R581Q/+, untreated isoQ2-04+/+ and isoQ2-04+/+ neurons chronically treated with 1 µM XE991 (isoQ2-04+/+ChrXE991). (C) Chronic XE991 …
-
Figure 6—source data 1
Quantification of passive and active current-clamp parameters with chronic XE991 treatment for Figure 6A–E and Figure 6—figure supplement 1A and B.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig6-data1-v1.xlsx
-
Figure 6—source data 2
Quantification of DIV 15–31 MEA data parameters with chronic XE991 treatment for Figure 6F and Figure 6—figure supplement 1C and D.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig6-data2-v1.xlsx
-
Figure 6—source data 3
Quantification of RT-qPCR expression ΔΔCt values for Figure 6G and Figure 6—figure supplement 1E.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig6-data3-v1.xlsx
Figure 6—figure supplement 1
Intrinsic membrane properties and MEA recordings in chronically XE991-treated control neurons.
(A) Passive membrane properties. RMP was more hyperpolarized and input resistance was significantly reduced with chronic XE991 treatment (isoQ2-04+/+ ChrXE991) in isogenic control neurons as …
Figure 6—figure supplement 2
Early effects of chronic XE991 treatment on control neurons.
(A) Early MEA recordings from days 10 to 15 in culture. Q2-04R581Q/+ neurons exhibit a greater number of electrodes that became active (≥1 spike/min) earlier on in differentiation compared to …
-
Figure 6—figure supplement 2—source data 1
Quantification of DIV 10–13 MEA data parameters for Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/64434/elife-64434-fig6-figsupp2-data1-v1.xlsx
Figure 6—figure supplement 3
Effects of acute paxilline/apamin treatment on chronically XE991-treated control neurons.
(A) Experimental protocol. On day 32, apamin (500 nM) and paxilline (20 µM) were added to MEAs after 5 min of baseline spontaneous recordings. The effect of drugs was measured after 10 min of …
Figure 6—figure supplement 4
Diagram of proposed temporal homeostatic consequences of loss of M-current.
Developmental time course of differences in Q2-04R581Q/+ patient-specific iPSC-derived neurons as compared to mutation corrected isogenic controls isoQ2-04+/+. Top: Days 15 and 31 MEA raster plots …
Author response image 1
Synchrony metrics assessed by MEA experiments.
Tables
Table 1
Developmental timeline of intrinsic membrane properties of patient-derived and isogenic control neurons.
| Weeks: | Week 3 | Week 4 | Week 5 | |||
|---|---|---|---|---|---|---|
| Genotype: | isoQ2-04+/+ | Q2-04R581Q/+ | isoQ2-04+/+ | Q2-04R581Q/+ | isoQ2-04+/+ | Q2-04R581Q/+ |
| Resting Potential (mV) | −53.5 ± 0.7 (74) | −51.3 ± 0.6 * (72) | −54.1 ± 0.5 (143) | −55.2 ± 0.6 (137) | −55.8 ± 0.6 (71) | −56.7 ± 0.7 (73) |
| Input Resistance RN at RMP (MΩ) | 900.6 ± 47 | 1079.9 ± 46.5 * | 845.2 ± 27.9 | 850.3 ± 25.7 | 871.5 ± 29.4 | 816.3 ± 27.9 |
| Series Resistance RS RMP (MΩ) | 14.5 ± 0.29 | 15 ± 0.3 | 14.4 ± 0.3 | 14.1 ± 0.3 | 15.6 ± 0.3 | 15.5 ± 0.4 |
| AP Amplitude from Baseline (mV) | 88 ± 0.7 (47) | 87.6 ± 1 (33) | 91.1 ± 0.6 (107) | 92.6 ± 0.6 (89) | 90.6 ± 0.8 (66) | 92 ± 0.9 (64) |
| AP Threshold (mV) | −33 ± 0.5 | −33.3 ± 0.7 | −38.8 ± 0.4 | −38.6 ± 0.5 | −39.1 ± 0.5 | −40.4 ± 0.5 |
| AP Half-Width (ms) | 3.8 ± 0.3 | 4.6 ± 0.3 * | 2.5 ± 0.1 | 2.5 ± 0.1 | 2.7 ± 0.2 | 2.2 ± 0.1 * |
| fAHP (mV) | −56.1 ± 0.6 | −54.5 ± 0.7 | −58.2 ± 0.5 | −59.8 ± 0.5* | −58.8 ± 0.6 | −60.6 ± 0.5 * |
| mAHP (mV) | −5.3 ± 0.4 (59) | −5.9 ± 0.4 (55) | −4.1 ± 0.2 (114) | −6 ± 0.3 *** (95) | −4.3 ± 0.3 (60) | −5.2 ± 0.3 * (58) |
| sAHP (mV) | −3 ± 0.3 | −3.4 ± 0.4 | −1.9 ± 0.1 | −3 ± 0.2 *** | −1.9 ± 0.2 | −3 ± 0.3 ** |
-
*p< 0.05, **p<0.005, ***p<0.0005: posthoc Fisher PLSD test comparing Q2-04R581Q/+ neurons to isoQ2-04+/+ isogenic controls during each week. Values displayed are Mean ± SEM. Number of neurons is indicated in ().
RMP - resting membrane potential; AP - Action potential; AHP - afterhyperpolarization; fAHP - fast AHP; mAHP - medium AHP; sAHP – slow post-burst AHP.
Table 2
Intrinsic membrane properties of week 4 isogenic control neurons chronically treated with XE991.
| isoQ2-04+/+chronic XE991 week 4 | |
|---|---|
| Resting potential (mV) | −57.4 ± 1 (54) ** |
| Input resistance RN at RMP (MΩ) | 644 ± 32.1 *** |
| Series resistance RS RMP (MΩ) | 11.3 ± 0.3 ** |
| AP amplitude from baseline (mV) | 93.1 ± 1 (46) |
| AP threshold (mV) | −39.3 ± 0.5 |
| AP half-width (ms) | 1.5 ± 0.1 *** |
| fAHP (mV) | −61.6 ± 0.7 * |
| mAHP (mV) | −6.9 ± 0.4 (47) *** |
| sAHP (mV) | −3.2 ± 0.3 *** |
-
*p < 0.05, **p<0.005, ***p<0.0005: posthoc Fisher PLSD test comparing untreated isoQ2-04+/+ neurons at week 4 (see Table 1) with chronically XE991-treated isoQ2-04+/+ neurons recorded on week 4. Number of neurons is indicated in (). RMP - resting membrane potential; AP - Action potential; AHP - afterhyperpolarization; fAHP - fast AHP; mAHP - medium AHP; sAHP - slow post-burst AHP.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-GFP (Chicken polyclonal) | Abcam | Cat# ab13970, RRID: AB_300798 | ICC (1:10,000) |
| Antibody | Anti-Nanog (Goat polyclonal) | R and D Systems | Cat# AF1997, RRID:AB_355097 | ICC (1:500) |
| Antibody | Anti-hSSEA4 (Mouse monoclonal) | DSHB | Cat# MC-813–70, RRID:AB_528477 | ICC (3 µg/ml) |
| Antibody | Anti-MAP2 (Mouse monoclonal) | Millipore | Cat# MAB3418, RRID: AB_94856 | ICC (1:1000) |
| Antibody | Anti-vGLUT1 (Rabbit polyclonal) | Synaptic Systems | Cat# 135 302, RRID:AB_887877 | ICC (1:200) |
| Antibody | Anti-chicken secondary Alexa Fluor 488 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A-11039, RRID:AB_142924 | ICC (1:1000) |
| Antibody | Anti-mouse secondary Alexa Fluor 568 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A-11031, RRID:AB_144696 | ICC (1:1000) |
| Antibody | Anti-rabbit secondary Alexa Fluor 647 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A-21245, RRID:AB_141775 | ICC (1:1000) |
| Antibody | Anti-goat secondary Alexa Fluor 568 (Donkey polyclonal) | Thermo Fisher Scientific | Cat# A-11031, RRID:AB_144696 | ICC (1:500) |
| Antibody | Anti-mouse secondary Alexa Fluor 488 (Donkey polyclonal) | Thermo Fisher Scientific | Cat# A-21202, RRID:AB_141607 | ICC (1:500) |
| Chemical Compound, Drug | XE991 | Abcam | Cat# ab120089 | |
| Chemical Compound, Drug | XE991 | TOCRIS | Cat# 2000 | |
| Chemical Compound, Drug | Ara-C | Sigma-Aldrich | Cat# C1768 | |
| Chemical Compound, Drug | TRIzol | Invitrogen | Cat# 15596026 | |
| Chemical Compound, Drug | ProLong Gold Antifade Mountant | Thermo Fisher Scientific | RRID:SCR_015961 | |
| Chemical Compound, Drug | Poly-d-Lysine | Sigma-Aldrich | Cat# P6407-5MG | |
| Chemical Compound, Drug | Laminin | Thermo Fisher Scientific | Cat# 23017–015 | |
| Chemical Compound, Drug | LDN-193189 | DNSK International | Cat# 1062368-24-4 | |
| Chemical Compound, Drug | SB431542 | DNSK International | Cat# 301836-41-9 | |
| Chemical Compound, Drug | XAV939 | DNSK International | Cat# 384028-89-3 | |
| Chemical Compound, Drug | Doxycycline | Sigma-Aldrich | Cat# D9891-5G | |
| Chemical Compound, Drug | Puromycin | Sigma-Aldrich | Cat# P8833 | |
| Chemical Compound, Drug | BDNF | R and D Systems | Cat# 248-BD | |
| Chemical Compound, Drug | Heparin Sulfate | Sigma-Aldrich | Cat# H3149 | |
| Chemical Compound, Drug | Knockout DMEM | Thermo Fisher Scientific | Cat# 10829–018 | |
| Chemical Compound, Drug | Knockout Replacement Serum | Thermo Fisher Scientific | Cat# 10828–010 | |
| Chemical Compound, Drug | MEM non-essential amino acids | Thermo Fisher Scientific | Cat# 11140–076 | |
| Chemical Compound, Drug | Glutamax | Thermo Fisher Scientific | Cat# 35050–061 | |
| Chemical Compound, Drug | 2-Mercaptoethanol | Thermo Fisher Scientific | Cat# 21985–023 | |
| Chemical Compound, Drug | DMEM/F12 + L-glutamine | Thermo Fisher Scientific | Cat# 11320–082 | |
| Chemical Compound, Drug | 45% glucose solution | Sigma-Aldrich | Cat# G8769-100ML | |
| Chemical Compound, Drug | N2 supplement | Thermo Fisher Scientific | Cat# 17502–048 | |
| Chemical Compound, Drug | B27 supplement | Thermo Fisher Scientific | Cat# 17504–044 | |
| Chemical Compound, Drug | Neurobasal + L-glutamine | Thermo Fisher Scientific | Cat# 21103–049 | |
| Chemical Compound, Drug | MEM | Thermo Fisher Scientific | Cat# 10370–021 | |
| Chemical Compound, Drug | Horse Serum | Thermo Fisher Scientific | Cat# 26050–070 | |
| Chemical Compound, Drug | Hyclone FBS | VWR | Cat# 16777–006 | |
| Chemical Compound, Drug | DNase I, Amplification Grade | Life Technologies | Cat# 18-068-015 | |
| Chemical Compound, Drug | DNase | Worthington Biochemical Corp. | Cat# LK003172 | |
| Chemical Compound, Drug | Paxilline | Alomone Labs | Cat# P-450 | |
| Chemical Compound, Drug | Apamin | Alomone Labs | Cat# STA-200 | |
| Commercial Assay, Kit | Invitrogen CytoTune - iPS 2.0 Sendai reprogramming kit | Life Technologies | Cat# A16517 | |
| Commercial Assay, Kit | Wizard SV Gel and PCR Clean-Up System | Promega | Cat# A9281 | |
| Commercial Assay, Kit | DNeasy Blood and Tissue Kit | Qiagen | Cat# 69504 | |
| Commercial Assay, Kit | MycoAlert PLUS Detection Kit | Lonza | Cat# LT07-710 | |
| Commercial Assay, Kit | MycoAlert Assay Control Set | Lonza | Cat# LT07-518 | |
| Commercial Assay, Kit | Invitrogen SuperScript IV First-Strand Synthesis System | Thermo Fisher Scientific | Cat# 18-091-050 | |
| Commercial Assay, Kit | Genecopoeia T7 Endonuclease I Kit | Genecopoeia | Cat# IC005 | |
| Commercial Assay, Kit | QuikChange II XL Site-Directed Mutagenesis Kit | Agilent technologies | Cat# 200522 | |
| Commercial Assay, Kit | iTaq Universal SYBR Green Supermix | Bio-Rad | Cat# 1725124 | |
| Commercial Assay, Kit | Pooled human fetal brain total RNA | TakaRa Bio | #636526, Lot #1612396A | |
| Commercial Assay, Kit | Pooled adult cortex total RNA | TakaRa Bio | #636561, Lot #2007106 | |
| Cell Line (Homo-sapiens) | Human: KCNQ2-DEE and mutation corrected isogenic patient-derived iPSCs | This paper | N/A | See Materials and methods |
| Cell Line (Homo-sapiens) | Human: 11a | Harvard University; Boston; USA | RRID: CVCL_8987 | (Control 1) |
| Cell Line (Homo-sapiens) | Human: NCRM-5 | NIH Center for Regenerative Medicine – Bethesda | RRID: CVCL_1E75 | (Control 2) |
| Cell Line (Homo-sapiens) | Human: 18a | Harvard University; Boston; USA | RRID:CVCL_8993 | (Control 3) |
| Cell Line (M. musculus) | Primary culture (CD-1 IGS) Mouse Glia | Charles River | See Materials and methods | |
| Cell Line (C. griseus) | KCNQ3 stable CHO cells | American Type Culture Collection; This paper | ATCC Cat# CRL-9618, RRID:CVCL_0214 | Stable expression of KCNQ3 (See Materials and methods) |
| Recombinant DNA Reagent | pCS2_KCNQ2 _IRES2_EGFP | This paper | See Materials and methods | |
| Recombinant DNA Reagent | pcDNA5/FRT_KCNQ3 | This paper | See Materials and methods | |
| Recombinant DNA Reagent | pTet-O-Ngn2-puro | Addgene | RRID:Addgene_52047 | |
| Recombinant DNA Reagent | Tet-O-FUW-EGFP | Addgene | RRID:Addgene_30130 | |
| Recombinant DNA Reagent | FUW-M2rtTA | Addgene | RRID:Addgene_20342 | |
| Sequence-based reagent | All qPCR and sequencing primer sequences | This paper | See Supplementary files 2 and 4 | |
| Sequence-based reagent | R581Q mutagenesis F | This paper | PCR primers | TCCCAAATTAAGAGCCTGCAGTCCAGAGTGGAC |
| Sequence-based reagent | R581Q mutagenesis R | This paper | PCR primers | AGGCTCTTAATTTGGGACAGCATGTCCAGGTGGC |
| Software, Algorithm | Fiji (ImageJ) | Max Planck Institute | RRID:SCR_002285 | |
| Software, Algorithm | Prism 5.0 | GraphPad | RRID:SCR_002798 | |
| Software, Algorithm | NIS-Elements | Nikon | RRID:SCR_002776 | |
| Software, Algorithm | Image Lab | Bio-Rad | RRID:SCR_014210 | |
| Software, Algorithm | Metamorph | Molecular Devices | RRID:SCR_002368 | |
| Software, Algorithm | AxIS | Axion biosystems | RRID:SCR_016308 | |
| Software, Algorithm | Neural Metrics Tool: Neural Module | Axion biosystems | RRID:SCR_019270 | |
| Software, Algorithm | AxIS Metric Plotting Tool | Axion biosystems | RRID:SCR_016308 | |
| Software, Algorithm | Pclamp/ Clampfit | Molecular Devices | RRID:SCR_011323 | |
| Software, Algorithm | MATLAB | MATLAB mathworks | RRID:SCR_001622 | |
| Software, Algorithm | Statview 5.0 | SAS Institute Inc | RRID:SCR_017411 | |
| Software, Algorithm | Snapgene | Snapgene | RRID:SCR_015052 | |
| Software, Algorithm | CFX Manager | Bio-Rad | RRID:SCR_017251 | |
| Software, Algorithm | FASTQC | Braham Institute | RRID:SCR_014583 | |
| Software, Algorithm | BWA | Wellcome Trust Sanger Institute | RRID:SCR_010910 | |
| Software, Algorithm | GATK | Broad Institute | RRID:SCR_001876 | |
| Software, Algorithm | VCFTools | 1000 Genomes Project Analysis Group | RRID:SCR_001235 | |
| Software, Algorithm | PLINK | cog-genomics/Broad Institute | RRID:SCR_001757 | |
| Software, Algorithm | Circos | Michael Smith Genome Sciences Centre | RRID:SCR_011798 | |
| Software, Algorithm | CADD | University of Washington | RRID:SCR_018393 | Database |
| Software, Algorithm | gnomAD | Broad Institute | RRID:SCR_014964 | Database |
Additional files
-
Supplementary file 1
Single guide RNA and donor ssODN sequences for isoQ2-04+/+, related to Figure 1 and Figure 1—figure supplements 2 and 3.
- https://cdn.elifesciences.org/articles/64434/elife-64434-supp1-v1.xlsx
-
Supplementary file 2
CRISPR off-targets primers for isoQ2-04+/+, related to Figure 1 and Figure 1—figure supplements 2 and 3.
- https://cdn.elifesciences.org/articles/64434/elife-64434-supp2-v1.xlsx
-
Supplementary file 3
Whole genome sequencing comparison of Q2-04R581Q/+ and isoQ2-04+/+ variants.
- https://cdn.elifesciences.org/articles/64434/elife-64434-supp3-v1.xlsx
-
Supplementary file 4
Human-specific RT-qPCR primers with splice isoform specificity, related to Figures 1, 4 and 6.
- https://cdn.elifesciences.org/articles/64434/elife-64434-supp4-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64434/elife-64434-transrepform-v1.docx
