1. Cell Biology
Download icon

A robust method for particulate detection of a genetic tag for 3D electron microscopy

  1. James Rae
  2. Charles Ferguson
  3. Nicholas Ariotti
  4. Richard I Webb
  5. Han-Hao Cheng
  6. James L Mead
  7. James D Riches
  8. Dominic JB Hunter
  9. Nick Martel
  10. Joanne Baltos
  11. Arthur Christopoulos
  12. Nicole S Bryce
  13. Maria Lastra Cagigas
  14. Sachini Fonseka
  15. Marcel E Sayre
  16. Edna C Hardeman
  17. Peter W Gunning
  18. Yann Gambin
  19. Thomas E Hall
  20. Robert G Parton  Is a corresponding author
  1. The University of Queensland, Institute for Molecular Bioscience, Australia
  2. Mark Wainwright Analytical Centre, University of New South Wales, Australia
  3. School of Medical Sciences, University of New South Wales, Australia
  4. The University of Queensland, Centre for Microscopy and Microanalysis, Australia
  5. Division Microrobotics and Control Engineering, Department of Computing Science, University of Oldenburg, Germany
  6. Queensland University of Technology, Australia
  7. EMBL Australia Node for Single Molecule Sciences, University of New South Wales, Australia
  8. Monash Institute of Pharmaceutical Sciences, Monash University, Australia
Tools and Resources
Cite this article as: eLife 2021;10:e64630 doi: 10.7554/eLife.64630
2 figures, 1 table and 1 additional file

Figures

Figure 1 with 5 supplements
APEX-Gold particulate labelling of genetically-tagged proteins of interest.

(A) Schematic of the APEX-Gold method. Cells were transfected with Cavin4-APEX2 (B,D,E) (control light microscopy experiments are described in Figure 1—figure supplement 5) or LifeAct-APEX2 (C,F), fixed, treated with diaminobenzidine (DAB), and then incubated with Ag/Au reagents in the presence of gum arabic. (B,D,E) Low (B) and higher (D,E, inset in B) magnification views of caveolae labelling. (C) Labelled actin filaments. (F) Optical slice projection through tomogram of LifeAct-APEX2 expressing cells. APEX-Gold particulate reaction product can be observed tightly associated with and throughout the actin bundles in three dimensions. Note the uniform gold label, the lack of background, and high signal to noise. PM, plasma membrane; CCP, clathrin-coated pit. Bars, B, 2 µm (inset 500 nm); C, 1 µm; D, 500 nm; E, 1 µm; F, 500 nm.

Figure 1—figure supplement 1
Cavin-4 and LifeAct APEX-Gold labelling.

(A,B) Low and higher magnification views respectively of Cavin4-APEX2 labelling using the APEX-Gold method without gum arabic. Arrows, caveolae labelled with gold. (C,D) Low and higher magnification examples respectively of labelling on actin filaments with LifeAct-APEX2 with APEX-Gold enhancement. N, nucleus; PM, plasma membrane. Bars, A, 1 µm; B, 1 µm (inset, 200 nm); C, 10 µm; D, 2 µm.

Figure 1—figure supplement 2
APEX-Gold produces an easy to identify signal with little background, high specificity and broad applicability.

(A) An example of a Cavin4-APEX2 transfected cell immediately adjacent to a untransfected cell (UT, highlighted by dashed line). Sections were poststained with uranyl acetate and Reynold’s lead citrate. Note the absence of particulate reaction product within the untransfected cell. (B) Micrograph of Cavin4-APEX2 labelling enhanced with APEX-Gold. Linescans (FIJI) across caveolae were used to measure the distance from centre of gold particles to the caveolar membrane. (C) The distribution of particle label resolution. (D) A1AR-APEX2 stably expressing CHO cells, processed with APEX-Gold enhancement without gum arabic showing labelling at specific areas of plasma membrane. UT, untransfected cell. Bars, A, 2 µm; D, 500 nm.

Figure 1—figure supplement 3
Cryo-sectioning and SEM array tomography of APEX-Gold-labelled cells.

(A,B) Cryosectioned cells showing LifeAct-APEX2 labelling. (C,C’) Cryosectioned cells showing Cavin4-APEX2 labelling. (D–E) Scanning electron microscopic (SEM) analysis of sections of BHK cells expressing Cavin4-APEX2 (Raith eLine Plus). UT, untransfected; N, nucleus; PM, plasma membrane. Bars, A, 1 µm; B, 500 nm; C, 2 µm; C’, 1 µm; D, 50 µm; D’, 10 µm; E, 100 nm.

Figure 1—figure supplement 4
APEX-Gold is compatible with serial block-face SEM, FIB-SEM, image segmentation analysis and pre-embedding labelling techniques.

(A) Serial micrographs of Cavin4-APEX2 labelling obtained using serial block-face imaging scanning electron microscope (SEM). Arrows indicate areas of APEX-Gold labelling. (B–B’) Focussed ion beam (FIB) analysis of same experiment followed by supervised segmentation. (C) Actin filaments labelled with LifeAct-APEX2 followed by APEX-Gold enhancement. (C’) Segmentation of the diaminobenzidine (DAB) product and the gold labelling using FIJI/Weka automated segmentation of the image shown in C. (D,E) Fast-frozen and freeze-substituted cells embedded in lowicryl showing Cavin4-APEX2 labelling. Bars, A, 5 µm; B,B’, 200 nm; C,C’, 1 µm; D, 1 µm; E, 500 nm.

Figure 1—figure supplement 5
Brightfield images of BHK cells with various treatments.

(A) Untransfected BHK cell treated with diaminobenzidine (DAB), Ag/Au, and gum arabic. (B) BHK cell transfected with Cavin4-APEX2 treated with DAB. (C) BHK cell transfected with Cavin4-APEX2 treated with DAB, Ag, and gum arabic. (D) BHK cell transfected with Cavin4-APEX2 treated with DAB and Ag/Au. (E) BHK cell transfected with Cavin4-APEX2 treated with DAB, Ag/Au, and gum arabic. Bars, A-E, 50 µm.

Figure 2 with 3 supplements
APEX-fusion protein density determination using an internal standard and low level protein detection.

(A) Schematic explaining the cell-free caveolae-APEX2-Gold system. (B) A431 cells were incubated with in vitro synthesized CAV1-APEX2 cell-free caveolae for 5 min at 37°C before fixation and processing for APEX-Gold detection. Note the Ag/Au labelling of the surface-associated cell-free caveolae circled in red and low background label within cell. (C) Light microscopic detection of tropomyosin 3.1 (Tpm3.1)-APEX2 after APEX-Gold DAB/Ag/Au detection. (D) Low magnification electron microscopy (EM) showing a basal section of the same cell. (D’,F) Higher magnification views of gold labelled stress fibres from boxed region. (D’,E) Gold labelling follows individual actin filaments from boxed region. Bars, B, 2 µm (inset 200 nm); C,D, 50 µm; D’, 5 µm.

Figure 2—figure supplement 1
Cell free GFP-Cav1-Apex2 vesicle characterisation.

(A) Fluorescence correlation spectroscopic (FCS) analysis of cell-free synthesized GFP-CAV1-APEX2. (B) Dot blots comparing two concentrations of the indicated in vitro synthesized proteins (1; GFP-CAV1, 2; CAV1-APEX2, 3; GFP-CAV1-APEX2) or commercial horseradish peroxidase (4; HRP) treated with diaminobenzidine (DAB) or DAB and Ag/Au. (C) Expression of the indicated constructs followed by in-gel fluorescence detection using the GFP fluorescence or with fluorescently labelled lysine (BODIPY-lysine). (D) High magnification example micrograph of a single in vitro synthesized CAV1-APEX2 cell-free vesicle with APEX-Gold processing. (D’) Ag/Au particles circled in red. Bars, D,D’, 100 nm.

Figure 2—figure supplement 2
Low abundance Tpm3.1 labelling highlights APEX-Gold sensitivity and resolution.

(A) Genomic organization of the mouse line expressing tropomyosin 3.1 (Tpm3.1) C-terminally tagged with APEX2 (Meiring et al., 2019). (B) Western blot detection and (C) quantitation of endogenous and APEX2-tagged Tpm3.1. (D,D’) Tpm3.1-APEX2 labelling enhanced with APEX-Gold, also analysed with linescans to measure distance from particles centre to the actin bundle centre of mass. (E) Representative output from linescan showing edges of bundle highlighted in orange and the two peaks within indicative of APEX-Gold. (F) The distribution of Tpm3.1-APEX2 resolution, and half the average width of bundles highlighted in orange. Bars, D, 50 nm.

Figure 2—figure supplement 3
Tpm3.1 APEX-Gold labelling.

Arrows, particle labelling following individual actin filaments. Bars, A, 2 µm; B, 1 µm; C-I, 2 µm.

Tables

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Leishmania tarentolae)LEXSY host P10Jena BiosciencesLT-101
Genetic reagent (Mus musculus)Tpm3.1-APEX2 ± heterozygousPMID:31331962
Cell line (Mesocricetus auratus)BHK-21ATCCCCL-10
Cell line (Homo sapiens)A-431ATCCCRL-1555
Cell line (Cricetulus griseus)Flp-In-CHOInvitrogenR75807
Transfected construct (synthetic)LifeAct-APEX2This studyRRID:170523
Transfected construct (Mus musculus)Cavin4-APEXThis studyRRID:170524
Transfected construct (synthetic)pCSDEST2PMID:17948311RRID:22424
Transfected construct (synthetic)p3E-APEX2PMID:29621251RRID:108894
Transfected construct (synthetic)p3E-APEX2-P2A-mKate2PMID:26585296RRID:61671
Transfected construct (Mus musculus)pME-CAV1This studyRRID:170527
Transfected construct (synthetic)pME-LifeActPMID:32709891RRID:109545
Transfected construct (Mus musculus)pME-Cavin4This studyRRID:170528
Transfected construct (Homo sapiens)A1AR-APEX2This studyRRID:170529
AntibodyAnti-tropomyosinthree mouse monoclonalSigma-AldrichMABT1335(1:1000)
AntibodyAnti-alpha tubulin rabbit monoclonalAbcamAb52866(1:3000)
Recombinant DNA reagentGFP-CAV1-APEX (cell-free)This studyRRID:170525
Recombinant DNA reagentCAV1-APEX (cell-free)This studyRRID:170526
Recombinant DNA reagentpCellFree_G03PMID:25529348
Recombinant DNA reagentpCellFree_G03PMID:25529348
Sequence-based reagentAntisplice leader oligonucleotidePMID:19648909CAATAAAGTACAGAAACTGATACTTATATAGCGTT
Commercial assay or kitFluoroTect GreenLys in vitro Translation Labeling SystemPromegaL5001
Commercial assay or kitMycoAlert Mycoplasma Detection KitLonzaLT07-418
Chemical compound, drug25% EM grade glutaraldehydeElectron Microscopy Services16220
Chemical compound, drug16% EM grade paraformaldehydeElectron Microscopy Services15710
Chemical compound, drugUranyl acetateElectron Microscopy Services22400
Chemical compound, drugLead citrateProSciTechC073
Chemical compound, drugDABSigma-AldrichD5905
Chemical compound, drugHydrogen peroxide solutionSigma-AldrichH1009
Chemical compound, drugOsmium tetroxideProSciTechC010
Chemical compound, drugLX 112 Embedding KitLadd Research Industries21210
Chemical compound, drugHorseradish peroxidase – 25 mg Type VI-ASigma-AldrichP6782
Chemical compound, drugSilver nitrateSigma-Aldrich209139
Chemical compound, drugGum arabicElectron Microscopy Services25574
Chemical compound, drugGold chlorideElectron Microscopy Services16583
Chemical compound, drugHexamethylenetetramineSigma-Aldrich398160
Chemical compound, drugSodium tetraborate decahydrate (borax)Sigma-AldrichB9876
Chemical compound, drugSodium thiosulphateSigma-Aldrich72049
Chemical compound, drugBactotryptoneBeckton Dickinson211699
Chemical compound, drugHemin chlorideMP Biomedicals0219402505
Chemical compound, drugATPChem-Impex00015
Chemical compound, drugGTPChem-Impex00348
Chemical compound, drugSpermidineSigma-Aldrich85558–5G
Chemical compound, drugDTTSigma-AldrichD0632-10G
Chemical compound, drugCr phosphateChem-Impex00072
Chemical compound, drugPEG 3350Hampton ResearchHR2-527
Chemical compound, drugProt Inhib CRoche Diagnostics11 873 580 001
Chemical compound, drugCTPChem-Impex00095
Chemical compound, drugUTPChem-Impex00311
Chemical compound, drugT7 polymeraseIn-house purificationN/A
Chemical compound, drugCr phosphokinaseSigma-AldrichC3755-35KU
Chemical compound, drugAlanineSigma-AldrichA7627
Chemical compound, drugArginineSigma-AldrichA5006
Chemical compound, drugAsparagineSigma-AldrichA0884
Chemical compound, drugAspartic acidSigma-AldrichA9256
Chemical compound, drugCysteineSigma-AldrichC7352
Chemical compound, drugGlutamic acidSigma-Aldrich49449
Chemical compound, drugGlutamineSigma-AldrichG3126
Chemical compound, drugGlycineSigma-AldrichG7126
Chemical compound, drugHistidineSigma-AldrichH8000
Chemical compound, drugIsoleucineSigma-AldrichI2752
Chemical compound, drugLeucineSigma-AldrichL8912
Chemical compound, drugLysineSigma-AldrichL5626
Chemical compound, drugMethionineSigma-AldrichM9625
Chemical compound, drugPhenylalanineSigma-AldrichP2126
Chemical compound, drugProlineSigma-AldrichP0380
Chemical compound, drugSerineSigma-AldrichS4500
Chemical compound, drugThreonineSigma-AldrichT8625
Chemical compound, drugTryptophanSigma-AldrichT0524
Chemical compound, drugTyrosineSigma-AldrichT8566
Chemical compound, drugValineSigma-AldrichV0500
Chemical compound, drugPenicillin-streptomycinLife Technologies15070–063
Chemical compound, drugPotassium acetateSigma-AldrichP1190
Chemical compound, drugMagnesium acetateAmresco0131–1 KG
Chemical compound, drugLR clonase II PlusInvitrogen12538120
Chemical compound, drugHygromycin-BThermo Fisher/Invitrogen10687010
Chemical compound, drugDMEMLife Technologies11995065
Chemical compound, drugL-glutamineLife Technologies25030081
Chemical compound, drugFetal bovine serumSigma-AldrichF9423
Software, algorithmImageJ/FIJIPMID:22743772https://imagej.nih.gov/ij/
Software, algorithmImageJ/FIJI Weka PluginImageJ developershttps://imagej.net/Trainable_Segmentation
Software, algorithmiTEMOlympushttps://www.emsis.eu/home/
Software, algorithmAttoBright: LabView and GUI for data acquisition, Matlab code and GUI for data analysisPMID:31827096https://gambinsiereckilab.github.io/AttoBright/
Software, algorithmMAPsThermo Fisherhttps://www.fei.com/software/maps/#gsc.tab=0

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)