Figures and data in Propensity for somatic expansion increases over the course of life in Huntington disease

Figures
Tables
Additional files

6 figures, 6 tables and 1 additional file

Figures

Figure 1 with 1 supplement

Download asset Open asset

Somatic instability is negligible during gestation but increases with age.

(A) Left panel: Changes in expansion index (EI) for each Huntington disease (HD) individual, across two or sometimes three visits over multiple years (see Table 5). Different colors indicate different reference (CAG)n at diagnosis (main peak on PCR profile as shown in Figure 1—figure supplement 1). For each value, the disease status is indicated with an empty triangle (premanifest) or filled triangle (manifest; score >5 on the Unified HD Rating Scale total motor score [UHDRS-TMS]). Note that the measurement of the inherited allele remained stable across visits except for patient 44 (Table 2), who went from 54 to 55 (CAG)n at the second sampling, which was taken into account for the EI. Right panel: A closer look at the values clustered at the bottom of the axis in A ((CAG)n 39–46). The EI increases with progression to manifest state even for individuals with relatively small reference repeats. (B) Scatter plot and regression lines show the linear relation between EI and (CAG)n as observed in adult blood from the longitudinal cohort (left panel, n = 50 patients with at least two samples each; of these, 12 had a third sample; yellow: first sample, orange: second sample, and red triangles: third sample) and cortical tissue (right panel, n = 7 fetal brains, green triangles, and n = 15 adult brains, blue triangles). Pearson’s correlation coefficients and estimated regression slopes with p-values, indicated in the upper portion of each graph, reveal a positive linear relation between EI and reference CAG repeat length. (C) EI values from seven fetal samples according to the reference CAG repeat, ranging from 40 to 46 (at 13 weeks gestation). The instability indices of the cortical samples (green) overlap with those of the trophoblast samples (yellow); indices from carrier parents’ blood are in orange (ages 25 to 34 years). Two of the fetuses had the same (CAG)n of 46 and thus overlap on the graph. Left panel: Comparison of brain tissue instability from HD carrier fetuses at 13 weeks (green), to the corresponding trophoblasts sampled for prenatal testing (yellow) and the premanifest carrier parents’ blood (orange). Right panel: The percentage of mutant alleles bearing the different somatic expansions ascertained from the peak heights. Four graphs were plotted for the reference CAGs (40, 42, 45, and 46) determined on the fetal tissues. The parental blood samples show significant somatic expansions, whereas the trophoblast and the developing cortex show very little.

Figure 1—figure supplement 1

Download asset Open asset

PCR profile and analysis of the CAG repeat length and instability.

(A) PCR profile of a post-mortem brain (from a 74-year-old Huntington disease [HD] individual) with a non-expanded allele of 17 CAG and an expanded allele of 40 CAG. The non-expanded allele consists of one main peak (with a bit of PCR stutter to the left), whereas the expanded allele shows several small peaks to the right of the main peak. The highest peak determines the reference CAG size; the additional peaks correspond to larger expansions and reflect CAG somatic mosaicism. The y axis registers the level of fluorescence for each fragment. (B) Method for calculating the expansion index (EI) and the percentage of mutant alleles. In this study, we considered peaks to represent somatic expansions only if they reached a threshold of at least 3% of the height of the main peak. (C) PCR profile of a HD post-mortem brain from a 8-year-old child carrying an expanded allele of 128 CAG and a non-expanded allele of 30 CAG. Top: Complete PCR profile with the normal allele peak. Bottom: Zoom on the expanded allele.

Figure 2

Download asset Open asset

Somatic mosaicism increases in blood and post-mortem cortex over time.

Comparison of mosaicism in cortical tissue from Huntington disease (HD) carrier fetuses at 13 weeks (green), blood samples over time (gold, orange, and red for t1, t2, and t3, respectively) and adult post-mortem cortices (blue). We ascertained the ‘% mutant alleles’ (as in Figure 1C) from the peak heights from PCR profiles obtained on GeneMapper. Three reference CAG lengths (41, 43, or 45 CAG) were chosen from our cohort to illustrate the evolution of instability, and each graph represents one individual patient (from top to bottom): for the fetal samples, patients 2, 4, and 5 (Table 1); for the blood samples, the repeated measures from patients 4, 19, and 34 (Table 2); for the post-mortem samples, patients 2, 5, 10 (Table 3).

Figure 3 with 1 supplement

Download asset Open asset

Somatic expansion correlates with reference CAG repeat length, with age at onset (AO) and age at death (AD).

Scatter plots showing (A) reference CAG repeat length, (B) expansion index (EI) estimated at age at onset (EI-AO) and (C) expansion rate (ER) with respect to AO (left panels) and AD (right panels). p-Values of the slopes and adjusted R-squared for the linear regressions of log(AO) and log(AD) are in the upper right corner of the plots. Red curves denote locally estimated scatterplot smoothing (LOESS) of the data with 95% confidence intervals shaded in gray. (A) Left panel: The reference CAG repeat length explains roughly half the variability in AO (R²_adj = 47.6%, p=1.8e-8). HD individuals were classified as having onset earlier than expected (green), as expected (grey), or later than expected (red) according to their distance from the linear predictions given by the CAG repeat (see 'Materials and methods'). Right panel: The reference CAG repeat length explains 68% of the variability in AD (p=1.7e-04). (B) EI-AO explains 20.7% of the variability in AO (p=6.0e-04, left panel) and 49.7% of the variability in AD (p=2.9e-03, right panel). (C) ER explains 33% of the variability in AO (p=9.3e-06, left panel) and does not explain the variability in AD (R²_adj < 0, p=0.348, right panel).

Figure 3—figure supplement 1

Download asset Open asset

Pearson’s correlation analysis.

Correlations between age at onset (AO), age at death (AD) and reference CAG repeat length (CAG) with expansion rate (ER) and expansion index (EI) estimated at age at onset (EI-AO). On the lower left, plots show the relation between the different variables, with a regression line for each scatter plot. On the top right are Pearson’s correlation coefficients with p-values.

Figure 4 with 1 supplement

Download asset Open asset

Residual expansion index (EI) and expansion rate (ER) correlate with disease status.

(A) Boxplots showing the distribution of the EI estimated at age at onset and ER, between the patients’ groups classified in Figure 3A as having earlier-than-expected, expected, or later-than-expected onset. p-Values for the Kruskal-Wallis test are at the top of each plot; thick horizontal lines indicate the median, diamonds indicate the mean. Earlier and later onset patients had similar ERs compared to the as-expected group (p=0.810 and 0.181). (B) Boxplots showing the distribution of the residual EI at the first visit and residual ER, between the patients’ groups classified as premanifest and manifest. p-Values for the Wilcoxon test are at the top of each plot.

Figure 4—figure supplement 1

Download asset Open asset

Comparison of the relation between age at death, CAG repeat length, and expansion index (EI) as measured in blood samples from deceased longitudinal patients and in post-mortem HD brains.

(A) For the 14 patients from the longitudinal cohort who died during the course of the study, we calculated age at death (AD) relative to CAG repeat length (left) and expansion rate (ER) (right). Data shown with a LOESS curve in red and 95% confidence interval shaded in gray. p-Value of the slope and adjusted R-squared for the linear regressions of log(AD) on CAG repeat length, and residual AD on ER are provided inside the plots. Colors represent different CAG repeat lengths, as indicated by the legend. (B) For the 14 post-mortem brain sample subjects we compared reference (CAG)n to AD, and EI as measured in the frontal cortex to residual age at death. Data are shown with a LOESS curve in red and 95% confidence interval shaded in gray. p-Value of the slope and adjusted R-squared for the linear regressions of log(AD) on CAG repeat length and residual AD on EI are inside the plots. Colors represent different CAG repeat lengths, as indicated.

Figure 5

Download asset Open asset

Evolution of somatic expansions in HD patient blood is a function of age, CAG repeat length, and the interaction between age and repeat length.

A linear mixed model was fitted to the longitudinal data using all blood samples collected. The fitted lines show that the predicted somatic expansion increases with age for all reference repeat sizes, most notably at greater reference repeat lengths. The sex of the patients is indicated by solid and dashed lines (male and female respectively). Each curve covers the same age interval observed in our cohort for a given repeat length.

Author response image 1

Download asset Open asset

Tables

Table 1

Descriptive data on fetal tissues.

	Fetal brain (GW13)		Trophoblast (GW11)		Parent blood
N°	CAG	Expansion index	CAG	Expansion index	CAG	Expansion index
1	40	0.0441	40	0.0407	40	0.1255
2	41	0.0494	41	0.0495	40	0.1073
3	42	0.0434	42	0.0473	42	0.2383
4	43	0.0489	43	0.0482	45	0.3434
5	45	0.0533	45	0.0516	45	0.3692
6	46	0.0523	46	0.0571	45	0.3692
7	46	0.0599	46	0.0589	45	0.2390
Summary	43.3 ± 2.4	0.0502 ± 0.006	43.3 ± 2.4	0.0505 ± 0.006	42.8 ± 2.5	0.2560 ± 0.1103

GW13: gestational week 13. GW11: gestational week 11.

Pearson's correlation between EI and (CAG)n for fetal brain: R = 0.8244, R² = 0.6796, p=0.023.

Table 2

Data on the 50 patients in the longitudinal study, arranged according to reference CAG repeat length.

			First sample				Second sample				Third sample
N°	CAG	Motoronset	Age	Status	UHDRS	EI	Age	Status	UHDRS	EI	Age	Status	UHDRS	EI	ER	EI-AO	AO Group	AD
1	39	49	39	P	0	0.1187	50	M	7	0.1369					0.00166	0.1355	Earlier
2	40	58	40	P	0	0.1591	58	M	17	0.1910					0.00177	0.1908	Later
3	40	80	76	M	0	0.2048	87	M	36	0.2499					0.00409	0.2210	Later	91
4	41	44	46	M	0	0.2120	65	M	34	0.3970	69	M	75	0.4265	0.00946	0.1941	Earlier	77
5	41	37	28	M	0	0.2929	42	M	27	0.3806	45	M	42	0.4274	0.0074	0.2905	Earlier
6	42	39	32	P	0	0.1688	46	M	28	0.2173	53	M	18	0.3446	0.00767	0.2079	Earlier
7	42	42	32	P	0	0.1968	39	P	0	0.2917	51	M	25	0.3596	0.00826	0.2939	Earlier
8	42	43	34	P	0	0.1991	47	M	31	0.3387					0.01074	0.2959	As expected
9	42	45	39	P	0	0.2145	52	M	22	0.2380					0.00181	0.2255	As expected
10	42	48	50	M	21	0.2982	59	M	76	0.3596	61	M	76	0.3264	0.00386	0.2943	As expected	66
11	42	50	51	M	18	0.1943	59	M	39	0.2606					0.00829	0.1859	As expected
12	42	50	50	P	4	0.4070	61	M	40	0.4239					0.00154	0.4072	As expected
13	42	60	62	M	45	0.3774	73	M	78	0,4249					0.00432	0.3685	Later	74
14	42	57	56	M	0	0.3981	70	M	70	0.4905					0.0066	0.3980	Later
15	42	56	60	M	20	0.4311	68	M	45	0.4581					0.00338	0.4176	Later	75
16	42	61	63	M	36	0.4569	65	M	53	0.4563					−0.0003	0.4576	Later
17	43	37	29	P	0	0.1806	53	M	31	0.3641					0.00765	0.2418	Earlier
18	43	45	43	P	0	0.3159	59	M	40	0.4275					0.00698	0.3299	As expected
19	43	45	37	P	0	0.2879	52	M	38	0.4628	54	M	43	0.5088	0.01249	0.3865	As expected
20	43	47	46	P	0	0.3255	56	M	32	0.4228					0.00973	0.3351	As expected	64
21	43	47	50	M	18	0.4430	58	M	57	0.5164					0.00917	0.4153	As expected
22	44	48	21	P	0	0.1731	29	P	0	0.2063	47	M	18	0.2866	0.00438	0.2862	Later
23	44	56	39	P	0	0.2002	62	M	38	0.4136					0.00928	0.3581	Later
24	44	44	32	P	0	0.2176	35	P	0	0.2214					0.00127	0.2327	As expected	56
25	44	44	25	P	0	0.2162	42	M	12	0.5379					0.01892	0.5377	As expected
26	44	37	31	P	0	0.3739	44	M	32	0.5477					0.01337	0.4541	Earlier	49
27	44	44	37	P	0	0.3635	50	P	0	0.4687					0.00809	0.4201	As expected	57
28	44	37	28	P	0	0.3751	43	M	35	0.5175					0.00949	0.4604	Earlier
29	44	50	42	P	0	0.4229	54	M	38	0.5162					0.00778	0.4851	Later
30	44	26	26	M	11	0.4279	36	M	22	0.5113					0.00834	0.4279	Earlier
31	44	46	49	M	NA	0.4550	60	M	86	0.5854					0.01185	0.4193	As expected	61
32	44	30	36	P	0	0.4272	50	M	49	0.5667					0.00997	0.3674	Earlier	54
33	45	37	20	P	0	0.3551	38	M	7	0.5407					0.01031	0.5303	As expected
34	45	40	35	P	0	0.4522	49	M	52	0.6794	51	M	55	0.7050	0.01596	0.5325	As expected
35	45	40	46	M	NA	0.7408	58	M	NA	1.0457					0.02541	0.5884	As expected
36	46	40	27	P	0	0.2948	48	M	43	0.6126					0.01514	0.4917	As expected
37	46	36	26	P	0	0.5122	39	M	58	0.7044					0.01478	0.6599	As expected
38	46	35	35	P	0	0.6031	45	M	91	0.7675					0.01645	0.6031	As expected	49
39	46	45	47	M	18	0.7701	55	M	59	0.9431					0.02163	0.7270	Later
40	47	36	46	M	45	1.5687	57	M	92	2.6750					0.10057	0.5629	As expected	64
41	48	30	21	P	0	0.7800	38	M	57	1.6341					0.05024	1.2321	Earlier	39
42	48	32	33	M	8	0.9630	43	M	84	1.2162	53	M	92	1.8055	0.04213	0.8650	As expected
43	49	39	29	P	0	1.2709	42	M	84	1.7097	42			1.7208	0.03419	1.6129	Later
44	49	27	20	P	0	0.8439	27	M	63	1.3535					0.0728	1.3534	Earlier
45	49	33	41	M	43	1.6512	43	M	53	1.9788	51	M	70	2.6855	0.09912	0.9159	As expected
46	50	25	31	M	NA	2.7278	41	M	NA	3.6178					0.089	2.1936	Earlier
47	52	25	20	P	0	0.8479	33	M	32	1.7060	39	M	69	2.0014	0.06156	1.1696	Earlier
48	52	27	36	M	NA	3.1542	36	M	49	3.3273					NA	NA	As expected
49	53	26	26	M	15	1.9819	34	M	22	3.0756					0.13672	1.982	As expected
50	54	36	20	P	0	1.9449	36	M	13	3.8745					0.1206	3.8745	Later
	44.6 ± 3.5	42.2± 10.8	37.8± 12.6	19 M/ 31P	6.6± 12.9	0.620± 0.655	49.7 ± 12.3	46 M/ 4P	41.1± 25.1	0.881± 0.929	51.3± 8.1	12M/0P	53± 25.6	0.967 ± 0.841	0.0236± 0.0332	0.625± 0.649		62.9± 13.6

UHDRS: United Huntington's Disease Rating Scale/124; P: premanifest; M: manifest; ER : expansion rate; EI: expansion index; AD: age at death; AO: age at onset.

Table 3

Descriptive data on post-mortem brain donors.

N°	Sex	CAG	Expansion index	Age at death
1	F	40	1.4506	74
2	F	41	1.3197	84
3	F	42	3.2444	75
4	M	43	1.6834	55
5	M	43	2.6007	68
6	F	44	1.2883	NA
7	M	44	3.2551	41
8	F	44	3.0440	59
9	F	44	3.7083	55
10	F	45	2.9722	59
11	F	46	1.5191	43
12	F	47	9.0942	43
13	M	48	2.8506	41
14	F	50	3.7961	58
15	F	50	8.5912	45
Summary	11F/5M	44.7 ± 3.0	3.3612 ± 2.3900	57.4 ± 13.9

Table 4

Descriptive data on the Linear mixed model analyzing the longitudinal data.

Linear mixed model fit by REML. t-tests use Satterthwaite's method ['lmerModLmerTest']. Formula: log(ei)~age + cag+age:cag +sex + (1 | id).

Outcome	Fixed effects							Random effects
		Estimate	Std. Error	df	t value	Pr(>\|t\|)	Signif	Groups	Name	Variance	Std.Dev.
log(ei)	(Intercept)	−0.603	0.048	48.31	−12.5	1.03e-16	***	id	(Intercept)	0.067	0.258
	age	0.028	0.001	70.39	22.8	3.40–34	***	Residual		0.009	0.095
	cag	0.276	0.012	54.21	24.0	1.63e-30	***	Number of obs: 112, groups: id, 50
	sexMale	0.028	0.078	47.03	0.36	0.719	ns
	age:cag	0.002	3.8e-4	77.22	5.69	2.21e-07	***

Signif: ***p<0.001, ^nsp >0.05.

Table 5

Descriptive data on longitudinal cohort.

	t1	t2		t3
n	50	50		12
Sex, F/M (%F)	31/19 (62%)	31/19 (62%)		7/5 (58.3%)
CAG	44.6 ± 3.5 (n = 50, r = 39–54)	NA		NA
Expansion index	0.620 ± 0.655 (n = 50, r = 0.119–3.154)	0.881 ± 0.929 (n = 50, r = 0.137–3.874)		0.967 ± 0.841 (n = 12, r = 0.287–2.686)
Age at sampling	37.8 ± 12.6 (n = 50, r = 20–76)	49.7 ± 12.3 (n = 50, r = 27–87)		51.3 ± 8.1 (n = 12, r = 39–69)
Status M/P (%M)	19/31 (38%)	46/4 (92%)		12/0 (100%)
Chorea onset yes/no (%yes)	20/30 (40%)	46/4 (92%)		11/1 (91.7%)
UHDRS	6.6 ± 12.9 (n = 46, r = 0–45)	41.1 ± 25.1 (n = 48, r = 0–92)		53 ± 25.6 (n = 11, r = 18–92)
	t2 - t1		t3 - t2
Delta age	12 ± 4.9 (n = 50, r = 0–24)		6.2 ± 5.2 (n = 12, r = 0–18)
Delta expansion	0.16 ± 0.22 (n = 50, r = –0.01–1.37)		0.11 ± 0.12 (n = 12, r = –0.03–0.37)
Rate (delta expansion/delta age)	0.0136 ± 0.016 (n = 49, r = –0.0036–0.0859)		0.0182 ± 0.0182 (n = 11, r = –0.0153–0.0461)
Expansion rate (ER)	0.0236 ± 0.0332 (n = 49, r = −0.0003–0.1367)
Expansion index at onset (EI-AO)	0.625 ± 0.649 (n = 49, r = 0.136–3.874)

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
gene (human)	Htt	NCBI	NG_009378.1
sequence-based reagent	HD-F2	This paper	PCR primers	GGGAGACCGCCATGGCGACCCTGGA
sequence-based reagent	HD-WR2-hex	https://doi.org/10.1006/mcpr.1993.1034	PCR primers	HEXGGCGGTGGCGGCTGTTGCTGCTGCT
sequence-based reagent	HD-WCAAM4-R-fam	This paper	PCR primers	[6FAM]GGCGGTGGCGGCTGTTGCTGTTGAT
commercial assay or kit	QIAamp Fast DNA Tissue Kit	Qiagen	51404
commercial assay or kit	Maxwell RSC Blood DNA kit	Promega	AS1400
commercial assay or kit	Taq DNA Polymerase	Qiagen	201205
chemical compound, drug	Genescan-400HD Rox dye size standard	Applied Biosystems	15829736
chemical compound, drug	Hi-Di Formamide	Applied Biosystems	15803570
software, algorithm	GeneMapper software v5.0	Applied Biosystems	RRID:SCR_014290
software, algorithm	R version 3.6.1	R Development Core Team	RRID:SCR_001905	https://www.R-project.org/

Additional files

Transparent reporting form: https://cdn.elifesciences.org/articles/64674/elife-64674-transrepform-v1.pdf
Download elife-64674-transrepform-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Radhia Kacher
François-Xavier Lejeune
Sandrine Noël
Cécile Cazeneuve
Alexis Brice
Sandrine Humbert
Alexandra Durr

(2021)

Propensity for somatic expansion increases over the course of life in Huntington disease

eLife 10:e64674.

https://doi.org/10.7554/eLife.64674

Share this article

Cite this article

Somatic instability is negligible during gestation but increases with age.

PCR profile and analysis of the CAG repeat length and instability.

Somatic mosaicism increases in blood and post-mortem cortex over time.

Somatic expansion correlates with reference CAG repeat length, with age at onset (AO) and age at death (AD).

Pearson’s correlation analysis.

Residual expansion index (EI) and expansion rate (ER) correlate with disease status.

Comparison of the relation between age at death, CAG repeat length, and expansion index (EI) as measured in blood samples from deceased longitudinal patients and in post-mortem HD brains.

Evolution of somatic expansions in HD patient blood is a function of age, CAG repeat length, and the interaction between age and repeat length.

Descriptive data on fetal tissues.

Data on the 50 patients in the longitudinal study, arranged according to reference CAG repeat length.

Descriptive data on post-mortem brain donors.

Descriptive data on the Linear mixed model analyzing the longitudinal data.

Descriptive data on longitudinal cohort.

Transparent reporting form

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)