Type 1 polyisoprenoid diphosphate phosphatase modulates geranylgeranyl-mediated control of HMG CoA reductase and UBIAD1
- Department of Molecular Genetics, University of Texas Southwestern Medical Center at Dallas, United States
Figures
Figure 1 with 1 supplement
Overexpression of PDP1 inhibits protein geranylgeranylation and GGOH-enhanced ERAD of HMG CoA reductase.
(A) SV-589/PDP1-Myc-FLAG cells were set up on day 0 at 2 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1, cells were refed identical medium in the absence or presence of …
Figure 1—figure supplement 1
Overexpression of catalytically inactive PDP1 (S212T) enhances ERAD of HMG CoA reductase.
SV-589/TR cells were set up on day 0 at 2.4 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1, cells were transfected with 1 µg/dish pCMV-HMGCR (TM1-8)-T7 in the absence or …
Figure 2 with 1 supplement
PDP1 overexpression blunts GGOH-induced, ER-to-Golgi transport of UBIAD1.
(A) SV-589/PDP1-Myc-FLAG cells were set up on day 0 at 8 × 104 cells per well of 6-well plates with coverslips in medium A supplemented with 5 % FCS. On day 1, cells were switched to medium A …
Figure 2—figure supplement 1
Overexpression of PDP1 (S212T) blocks compactin-induced relocation of UBIAD1 from Golgi to ER.
SV-589/TR cells were set up on day 0 at 8 × 104 cells per well of 6-well plates with coverslips in medium A supplemented with 5 % FCS. On day 1, cells were switched identical medium and transfected …
Figure 3 with 1 supplement
RNAi-mediated knockdown of PDP1 enhances GGpp-induced ERAD of HMG CoA reductase.
SV-589 cells were set up on day 0 at a density of 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1 cells were transfected in medium A containing 5 % FCS with siRNAs …
Figure 3—figure supplement 1
Knockdown of PDP1 enhances proteasome-mediated ERAD of HMG CoA reductase.
SV-589 cells were set up on day 0 at a density of 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1 cells were transfected in medium A containing 5 % FCS with siRNAs …
Figure 4
RNAi-mediated knockdown of PDP1 abolishes compactin-induced, Golgi-to-ER redistribution of UBIAD1 and stabilization of HMG CoA reductase.
(A) Proposed role of PDP1 in modulating levels of GGpp that stimulate transport of UBIAD1 from membranes of the ER to Golgi. (B) SV-589/pMyc-UBIAD1 cells were set up on day 0 at 7.5 × 104 cells per …
Figure 5
Depletion of GGpp and subsequent inhibition of geranylgeranylation blocks proteasomal degradation of the small GTPases RhoA and cdc42.
SV-589 cells were set up on day 0 at a density of 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 2, cells were washed and refed identical medium supplemented with 0–10 …
Figure 6
RNAi-mediated knockdown of PDP1 blunts compactin-induced stabilization of RhoA, enhances protein geranylgeranylation, and augments synthesis of menaquinone-4 (MK-4).
(A and B) SV-589 cells were set up on day 0 at 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1, cells were transfected in the identical medium with siRNAs against …
Figure 7
Contribution of PDP1 and UBIAD1 to the feedback regulatory system that targets HMG CoA reductase ERAD to control synthesis of GGpp.
The synthesis and hydrolysis of GGpp are key focal points in the feedback regulation of the nonsterol branch of the mevalonate pathway (see text for details).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (human) | SV-589 | PMID:6091915 | RRID: CVCL_RW34 | SV40 transformed human fibroblasts |
| Cell line (human) | SV-589/PDP1-Myc-FLAG | This paper | N/A | SV-589 cells stably expressing tetracycline-inducible human PDP1-Myc-FLAG |
| Antibody | Anti-SREBP-2 (rabbit polyclonal) | PMID:25896350 | IgG-22D5 | (1–5 µg/ml) |
| Antibody | Anti-UBIAD1 (mouse monoclonal) | PMID:29167270 | IgG-1H12 | (1–5 µg/ml) |
| Antibody | Anti-HMGCR (mouse monoclonal) | PMID:22143767 | IgG-A9 | (1–5 µg/ml) |
| Antibody | Anti-PDP1 (goat polyclonal) | Santa Cruz Biotechnology | Cat#SC-163253; RRID:AB_10842717 | (1–5 µg/ml) |
| Antibody | Anti-RhoA (mouse monoclonal) | Santa Cruz Biotechnology | IgG-26C4; Cat#SC-418; RRID:AB_628218 | (1–5 µg/ml) |
| Antibody | Anti-Rap1 (mouse monoclonal) | Santa Cruz Biotechnology | IgG-E6; Cat#SC-398755 | (1–5 µg/ml) |
| Antibody | Anti-Cdc42 (mouse monoclonal) | Santa Cruz Biotechnology | IgG-B8; Cat#SC-8401; RRID:AB_627233 | (1–5 µg/ml) |
| Antibody | Anti-Calnexin (rabbit polyclonal) | Novus Biologicals | Cat#NB100-1965; RRID: AB_10002123 | (1–5 µg/ml) |
| Antibody | Anti-LSD-1 (rabbit polyclonal) | Cell Signaling Technology | Cat#2139; RRID: AB_2070135 | (1–5 µg/ml) |
| Antibody | Anti-T7•Tag Antibody (mouse monoclonal) | Sigma Millipore | IgG2b; Cat#69522; RRID:AB_11211744 | (1–5 µg/ml) |
| Antibody | Anti-FLAG M2 (mouse monoclonal) | Sigma-Aldrich | IgG1; Cat#3165; RRID:AB_262044 | (1–5 µg/ml) |
| Transfected construct (human) | pCMV/TO-PDP1-Myc-FLAG | This paper | Cat#V102020 | Human PDP1-Myc inserted into pCDNA4/TO vector (Thermo Fisher) |
| Transfected construct (hamster) | pCMV-HMGCR (TM1-8)-T7 | PMID:12535518 | Membrane domain of hamster HMG CoA reductase inserted into pcDNA3 | |
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-A)GGCGCGAGGUGCUGAUGAAUU | Dharmacon/Thermo Fisher Scientific | ||
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-B)GGCGCGAGGUGCUGAUGAAUU | Dharmacon/Thermo Fisher Scientific | ON-TARGET plus | |
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-C)CGACGUAGCUUUUGGCUUUUU | Dharmacon/Thermo Fisher Scientific | ||
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-D)AGUACAGCAUCGUGGACUAUU | Dharmacon/Thermo Fisher Scientific | ||
| Transfected construct (human) | siRNA against PDP1 (SMARTpool)(PDP1 siRNA-E)GCACAAUGUCACCGACGUA ACAUAAGCUUUCUCGUAUA GUAAACUGAACUUCGAGAA GCCCUGAUGUCGAGGUUA | Dharmacon/Thermo Fisher Scientific | ON-TARGETplus Human PLPP6 (403313) siRNA | |
| Transfected construct (jellyfish) | siRNA against GFPCAGCCACAACGUCUAUAUCUU | PMID:24025715 | ||
| Commercial assay or kit | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat#13778500 | |
| Commercial assay or kit | X-tremeGENE HP DNA Transfection Reagent | Roche Diagnostics | Cat#45274000 | |
| Commercial assay or kit | Click-IT Protein Reaction Buffer Kit | Thermo Fisher Scientific | Cat#c10276 | |
| Commercial assay or kit | Novex WedgeWell 4%–20%, Tris-Glycine, 1.0 mm, Mini Protein Gel, 15-well | Thermo Fisher Scientific | Cat#c10276 | |
| Chemical compound, drug | Cholesterol | Sigma-Aldrich | Cat#C8667 | |
| Chemical compound, drug | Azido-geranylgeraniol | Thermo Fisher Scientific | Cat#C10249 | |
| Chemical compound, drug | Geranylgeraniol | Sigma-Aldrich | Cat#G3278 | |
| Chemical compound, drug | Menaquinone-4 | Sigma-Aldrich | Cat#809,896 | |
| Chemical compound, drug | Benzonase Nuclease | Sigma-Aldrich | Cat#E1014-5KU | |
| Chemical compound, drug | 25-Hydroxycholesterol | Avanti Polar Lipids | Cat#700019 P | |
| Chemical compound, drug | Trans, trans-farnesol | Sigma-Aldrich | Cat# 277,541 | |
| Chemical compound, drug | GGTI-298 | Cal Biochem | Cat# 345,883 | |
| Chemical compound, drug | MG-132 | Peptides | Cat# 12 L-3175-V | |
| Software, algorithm | Image J (Fiji) | NIH |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64688/elife-64688-transrepform1-v2.pdf
-
Source data 1
- https://cdn.elifesciences.org/articles/64688/elife-64688-supp1-v2.zip
