Type 1 polyisoprenoid diphosphate phosphatase modulates geranylgeranyl-mediated control of HMG CoA reductase and UBIAD1
- Department of Molecular Genetics, University of Texas Southwestern Medical Center at Dallas, United States
Figures
Figure 1 with 1 supplement
Overexpression of PDP1 inhibits protein geranylgeranylation and GGOH-enhanced ERAD of HMG CoA reductase.
(A) SV-589/PDP1-Myc-FLAG cells were set up on day 0 at 2 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1, cells were refed identical medium in the absence or presence of tetracycline (1 µg/ml) and the indicated amount of azido-geranylgeraniol (azido-GGOH). Following incubation for 16 hr at 37 °C, cells were harvested, lysed and proteins were precipitated. The resulting material was then resuspended in buffer, labeled with biotin alkyne, and subjected to SDS-PAGE followed by streptavidin blotting as described in ‘Materials and methods’. (B and C) SV-589/PDP1-Myc-FLAG cells were set up on day 0 at 3 × 105 cells per 100 mm dish in medium A supplemented with 5 % FCS. (B) On day 3, cells were refed the identical medium containing 10 µM sodium compactin and 50 µM sodium mevalonate in the absence or presence of tetracycline (1 µg/ml). Following incubation for 16 hr at 37 °C, cells were treated with the indicated amount of GGOH and incubated an additional 6 hrs at 37 °C. Cells were then harvested, lysed, and subjected to subcellular fractionation. Aliquots of resulting membrane fractions (50 µg protein loaded/lane) were subjected to SDS-PAGE, followed by immunoblot analysis with IgG-A9 (against reductase), anti-PDP1 IgG, IgG-1H12 (against UBIAD1), and anti-calnexin IgG. (C) On day 3, cells were depleted of sterol and nonsterol isoprenoids through incubation in medium A containing 10 % LPDS, 10 µM compactin, and 50 µM mevalonate; some of the cells also received 1 µg/ml tetracycline as indicated. After 16 hr at 37 °C, the cells were treated with or without 1 µg/ml 25-HC and the indicated amount of GGOH. Following incubation for 3 hr at 37 °C, cells were harvested, lysed, and subjected to subcellular fractionation. Aliquots of resulting membrane and nuclear extract fractions (30–50 µg protein loaded/lane) were analyzed by immunoblot using IgG-A9 (against reductase), anti-PDP1 IgG, IgG-1H12 (against UBIAD1), anti-calnexin IgG, IgG-22D5 (against SREBP-2), and anti-LSD-1 IgG.
Figure 1—figure supplement 1
Overexpression of catalytically inactive PDP1 (S212T) enhances ERAD of HMG CoA reductase.
SV-589/TR cells were set up on day 0 at 2.4 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1, cells were transfected with 1 µg/dish pCMV-HMGCR (TM1-8)-T7 in the absence or presence of 0.25 µg/dish pCMV-PDP1 (S212T)-FLAG using FuGENE6 as described in ‘Materials and Methods’. Following incubation for 16 hr at 37 °C, cells were treated in the absence or presence of 30 µM GGOH for 4 hr after which they were harvested, lysed and subjected to subcellular fractionation. Aliquots of resulting membrane fractions (50 µg protein loaded/lane) were analyzed by immunoblot using anti-T7•Tag monoclonal antibody (against reductase), anti-FLAG M2 (against PDP1 (S212T), and anti-calnexin IgG).
Figure 2 with 1 supplement
PDP1 overexpression blunts GGOH-induced, ER-to-Golgi transport of UBIAD1.
(A) SV-589/PDP1-Myc-FLAG cells were set up on day 0 at 8 × 104 cells per well of 6-well plates with coverslips in medium A supplemented with 5 % FCS. On day 1, cells were switched to medium A containing 5 % FCS, 10 µM compactin, 50 µM mevalonate in the absence or presence of 1 µg/ml tetracycline. After 16 hr at 37 °C, the cells were treated with the indicated amount of GGOH for an additional 6 hr, after which they were fixed and analyzed by immunofluorescence microscopy using IgG-1H12 (against UBIAD1) using a Zeiss Axio Observer Epifluorescence microscope as described in ‘Materials and methods’. Cells were also stained with DAPI to visualize nuclei. Lower magnification images are shown for anti-Myc-probed samples to illustrate tetracycline-induced expression of PDP1-Myc-FLAG. (B and C) SV-589 (ΔUBIAD1) cells were set up on day 0 at 6 × 105 cells per 100 mm dish in medium A supplemented with 5 % FCS. On day 2, cells were transfected with pCMV-Myc-UBIAD1 (2 µg/dish wild type or 0.5 µg/dish indicated mutant) as described in ‘Materials and methods’. Four hours after transfection, the cells received a direct addition of medium A containing 5 % LPDS, 10 µM compactin, and 50 µM mevalonate (final concentrations) and incubated for an additional 16 hr at 37 °C. The cells were subsequently harvested for preparation of microsomes that were incubated at 37 °C in buffer containing ATP, GTP, and an ATP-regenerating system in absence or presence of UT-2 cytosol and the indicated concentration (B) or 30 µM GGpp (C). After 20 min, reactions were centrifuged to obtain vesicles and membranes, which were subjected to SDS-PAGE followed by immunoblot analysis with IgG-9E10 (against Myc-UBIAD1).
Figure 2—figure supplement 1
Overexpression of PDP1 (S212T) blocks compactin-induced relocation of UBIAD1 from Golgi to ER.
SV-589/TR cells were set up on day 0 at 8 × 104 cells per well of 6-well plates with coverslips in medium A supplemented with 5 % FCS. On day 1, cells were switched identical medium and transfected with 1 µg/dish pCMV-UBIAD1-Myc in the absence or presence of 0.25 µg/dish pCMV-PDP1 (S212T)-FLAG. On day 2, cells received medium A supplemented with 5 % FCS and 1 µg/ml tetracycline in the absence or presence of 10 µM compactin and 50 µM mevalonate as indicated. After 16 hr at 37 °C, the cells were fixed and analyzed by immunofluorescence microscopy using IgG-9E10 (against UBIAD1) using a Zeiss Axio Observer Epifluorescence microscope as described in the legend to Figure 2. Cells were also stained with DAPI to visualize nuclei.
Figure 3 with 1 supplement
RNAi-mediated knockdown of PDP1 enhances GGpp-induced ERAD of HMG CoA reductase.
SV-589 cells were set up on day 0 at a density of 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1 cells were transfected in medium A containing 5 % FCS with siRNAs targeting mRNAs that encode GFP or PDP1. In (A), cells were transfected with PDP1 siRNAs A–E. (A) On day 3, cells were harvested, lysed, and aliquots of resulting whole-cell lysates (10 µg protein loaded/lane), followed by immunoblot analysis using anti-PDP1, anti-calnexin, and IgG-A9 (against reductase). (B) On day 3, cells were switched to medium A supplemented with 5 % FCS in the absence or presence of 10 µM compactin. Following incubation for 24 hr at 37 °C, cells were refed the identical medium and the indicated concentration of GGOH and incubated for an additional 24 hr. Cells were then harvested for subcellular fractionation; aliquots of resulting membrane fractions (15 µg protein loaded/lane) were subjected to SDS-PAGE and immunoblot analysis as described in (A). The amount of reductase was determined by quantifying the band corresponding to reductase using ImageJ software. Each value represents the amount of reductase protein relative to that in untreated cells transfected with GFP siRNA, which was arbitrarily set as 1.
Figure 3—figure supplement 1
Knockdown of PDP1 enhances proteasome-mediated ERAD of HMG CoA reductase.
SV-589 cells were set up on day 0 at a density of 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1 cells were transfected in medium A containing 5 % FCS with siRNAs targeting mRNAs that encode GFP or PDP1. On day 3, cells were treated in the absence or presence of 10 µM compactin and the indicated concentration of GGOH. In (A), cells were also treated with 10 µM cycloheximide and in (B), some of the cells received 10 µM MG-132. Following incubation for 24 (A) or 6 hr (B) at 37 °C, cells cells were harvested for subcellular fractionation; aliquots of resulting membrane fractions (15 µg protein loaded/lane) were subjected to SDS-PAGE followed by immunoblot analysis using anti-PDP1, anti-calnexin, and IgG-A9 (against reductase).
Figure 4
RNAi-mediated knockdown of PDP1 abolishes compactin-induced, Golgi-to-ER redistribution of UBIAD1 and stabilization of HMG CoA reductase.
(A) Proposed role of PDP1 in modulating levels of GGpp that stimulate transport of UBIAD1 from membranes of the ER to Golgi. (B) SV-589/pMyc-UBIAD1 cells were set up on day 0 at 7.5 × 104 cells per well of 6-well plates with glass coverslips in medium A supplemented with 5 % FCS. On day 1, the cells were transfected in identical medium with siRNAs against GFP or PDP1 mRNAs as described in the legend to Figure 3. Following incubation for 16 h at 37 °C, cells were switched to medium A supplemented with 5 % FCS in the absence or presence 10 µM compactin. After 2 hr, cells were fixed, permeabilized, and analyzed by immunofluorescence microscopy using IgG-9E10 (against Myc-UBIAD1) as described in the legend to Figure 2. (C–E) SV-589 cells were set up on day 0 at 2 × 105 cells per 60 mm dish in medium A containing 5 % FCS. On day 1, cells were transfected in identical medium with siRNAs against GFP or PDP1. On day 2, cells were refed medium A supplemented with either 5 % FCS (C) or 10 % LPDS (D and E). Following incubation for 16 hr at 37 °C, the cells were treated with 10 µM compactin in the absence (C and D) or presence (E) of 1 µg/ml 25-HC. The cells were then incubated for the indicated period of time, after which detergent lysates were prepared and subjected to immunoblot analysis using IgG-A9 (against reductase), anti-PDP1, and anti-calnexin.
Figure 5
Depletion of GGpp and subsequent inhibition of geranylgeranylation blocks proteasomal degradation of the small GTPases RhoA and cdc42.
SV-589 cells were set up on day 0 at a density of 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 2, cells were washed and refed identical medium supplemented with 0–10 µM (A) or 10 µM compactin (B–D). Following incubation for 24 hr at 37 °C, the cells received the identical medium in the absence or presence of 20 µM GGOH, 20 µM FOH, 10 µM MG-132, and 10 µM GGTI as indicated and incubated an addition 24 hr. Cells were then harvested for preparation of detergent-solubilized lysates that were subjected to SDS-PAGE, followed by immunoblot analysis with anti-RhoA, anti-cdc42, anti-Rap1, IgG-A9 (against reductase), and anti-calnexin. Prenylated (P) and unprenylated (U) forms of Rap1 protein are denoted by arrows.
Figure 6
RNAi-mediated knockdown of PDP1 blunts compactin-induced stabilization of RhoA, enhances protein geranylgeranylation, and augments synthesis of menaquinone-4 (MK-4).
(A and B) SV-589 cells were set up on day 0 at 1.5 × 105 cells per 60 mm dish in medium A supplemented with 5 % FCS. On day 1, cells were transfected in the identical medium with siRNAs against mRNAs encoding GFP and PDP1 as described in the legend to Figure 3. (A) On day 2, transfected cells were washed and refed medium A containing 5 % FCS and 10 µM compactin, after which they were incubated for the period of indicated time at 37 °C. Following incubations, cells were harvested for preparation of detergent-solubilized lysates that were subjected to immunoblot analysis with anti-RhoA, IgG-A9 (against reductase) and anti PDP1, and anti-calnexin (1:5000). (B) On day 2, transfected cells were refed medium A supplemented with 5 % FCS in the absence or presence of 30 µM azido-GGOH, 10 µM compactin, and 15 µM GGOH as indicated. Following incubation for 24 hr at 37 °C, cells were harvested, lysed and proteins were precipitated. The resulting material was resuspended in buffer, labeled with biotin alkyne as described in the legend to Figure 1. The samples were then subjected to SDS-PAGE followed by streptavidin blotting or immunoblot analysis with anti-PDP1 and anti-calnexin. (C) SV589 cells were set up on day 0 at 2.5 × 105 cells per 60 mm dish in medium A containing 5 % FCS. On day 1, cells were transfected with siRNAs targeting mRNAs encoding GFP or PDP1 as indicated and described in ‘Materials and methods’. On day 2, the cells were treated with 10 nM [3H]-menadione for 12 hours. Following the incubation, the cells were harvested, lysed, and lipids were extracted as described in ‘Materials and methods’. The amount of [3H]menadione-incorporated into MK-4 was determined by TLC and scintillation counting. The values shown are the mean of triplicate samples (standard error). Aliquots of whole cell lysate (20 µg protein/lane) were subjected to SDS-PAGE, and immunoblot analysis was carried with IgG-PDP1.
Figure 7
Contribution of PDP1 and UBIAD1 to the feedback regulatory system that targets HMG CoA reductase ERAD to control synthesis of GGpp.
The synthesis and hydrolysis of GGpp are key focal points in the feedback regulation of the nonsterol branch of the mevalonate pathway (see text for details).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (human) | SV-589 | PMID:6091915 | RRID: CVCL_RW34 | SV40 transformed human fibroblasts |
| Cell line (human) | SV-589/PDP1-Myc-FLAG | This paper | N/A | SV-589 cells stably expressing tetracycline-inducible human PDP1-Myc-FLAG |
| Antibody | Anti-SREBP-2 (rabbit polyclonal) | PMID:25896350 | IgG-22D5 | (1–5 µg/ml) |
| Antibody | Anti-UBIAD1 (mouse monoclonal) | PMID:29167270 | IgG-1H12 | (1–5 µg/ml) |
| Antibody | Anti-HMGCR (mouse monoclonal) | PMID:22143767 | IgG-A9 | (1–5 µg/ml) |
| Antibody | Anti-PDP1 (goat polyclonal) | Santa Cruz Biotechnology | Cat#SC-163253; RRID:AB_10842717 | (1–5 µg/ml) |
| Antibody | Anti-RhoA (mouse monoclonal) | Santa Cruz Biotechnology | IgG-26C4; Cat#SC-418; RRID:AB_628218 | (1–5 µg/ml) |
| Antibody | Anti-Rap1 (mouse monoclonal) | Santa Cruz Biotechnology | IgG-E6; Cat#SC-398755 | (1–5 µg/ml) |
| Antibody | Anti-Cdc42 (mouse monoclonal) | Santa Cruz Biotechnology | IgG-B8; Cat#SC-8401; RRID:AB_627233 | (1–5 µg/ml) |
| Antibody | Anti-Calnexin (rabbit polyclonal) | Novus Biologicals | Cat#NB100-1965; RRID: AB_10002123 | (1–5 µg/ml) |
| Antibody | Anti-LSD-1 (rabbit polyclonal) | Cell Signaling Technology | Cat#2139; RRID: AB_2070135 | (1–5 µg/ml) |
| Antibody | Anti-T7•Tag Antibody (mouse monoclonal) | Sigma Millipore | IgG2b; Cat#69522; RRID:AB_11211744 | (1–5 µg/ml) |
| Antibody | Anti-FLAG M2 (mouse monoclonal) | Sigma-Aldrich | IgG1; Cat#3165; RRID:AB_262044 | (1–5 µg/ml) |
| Transfected construct (human) | pCMV/TO-PDP1-Myc-FLAG | This paper | Cat#V102020 | Human PDP1-Myc inserted into pCDNA4/TO vector (Thermo Fisher) |
| Transfected construct (hamster) | pCMV-HMGCR (TM1-8)-T7 | PMID:12535518 | Membrane domain of hamster HMG CoA reductase inserted into pcDNA3 | |
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-A)GGCGCGAGGUGCUGAUGAAUU | Dharmacon/Thermo Fisher Scientific | ||
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-B)GGCGCGAGGUGCUGAUGAAUU | Dharmacon/Thermo Fisher Scientific | ON-TARGET plus | |
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-C)CGACGUAGCUUUUGGCUUUUU | Dharmacon/Thermo Fisher Scientific | ||
| Transfected construct (human) | siRNA against PDP1 (PDP1 siRNA-D)AGUACAGCAUCGUGGACUAUU | Dharmacon/Thermo Fisher Scientific | ||
| Transfected construct (human) | siRNA against PDP1 (SMARTpool)(PDP1 siRNA-E)GCACAAUGUCACCGACGUA ACAUAAGCUUUCUCGUAUA GUAAACUGAACUUCGAGAA GCCCUGAUGUCGAGGUUA | Dharmacon/Thermo Fisher Scientific | ON-TARGETplus Human PLPP6 (403313) siRNA | |
| Transfected construct (jellyfish) | siRNA against GFPCAGCCACAACGUCUAUAUCUU | PMID:24025715 | ||
| Commercial assay or kit | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat#13778500 | |
| Commercial assay or kit | X-tremeGENE HP DNA Transfection Reagent | Roche Diagnostics | Cat#45274000 | |
| Commercial assay or kit | Click-IT Protein Reaction Buffer Kit | Thermo Fisher Scientific | Cat#c10276 | |
| Commercial assay or kit | Novex WedgeWell 4%–20%, Tris-Glycine, 1.0 mm, Mini Protein Gel, 15-well | Thermo Fisher Scientific | Cat#c10276 | |
| Chemical compound, drug | Cholesterol | Sigma-Aldrich | Cat#C8667 | |
| Chemical compound, drug | Azido-geranylgeraniol | Thermo Fisher Scientific | Cat#C10249 | |
| Chemical compound, drug | Geranylgeraniol | Sigma-Aldrich | Cat#G3278 | |
| Chemical compound, drug | Menaquinone-4 | Sigma-Aldrich | Cat#809,896 | |
| Chemical compound, drug | Benzonase Nuclease | Sigma-Aldrich | Cat#E1014-5KU | |
| Chemical compound, drug | 25-Hydroxycholesterol | Avanti Polar Lipids | Cat#700019 P | |
| Chemical compound, drug | Trans, trans-farnesol | Sigma-Aldrich | Cat# 277,541 | |
| Chemical compound, drug | GGTI-298 | Cal Biochem | Cat# 345,883 | |
| Chemical compound, drug | MG-132 | Peptides | Cat# 12 L-3175-V | |
| Software, algorithm | Image J (Fiji) | NIH |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64688/elife-64688-transrepform1-v2.pdf
-
Source data 1
- https://cdn.elifesciences.org/articles/64688/elife-64688-supp1-v2.zip
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Type 1 polyisoprenoid diphosphate phosphatase modulates geranylgeranyl-mediated control of HMG CoA reductase and UBIAD1
eLife 10:e64688.
https://doi.org/10.7554/eLife.64688
