An in vivo reporter for tracking lipid droplet dynamics in transparent zebrafish
- Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, United States
- Weill Cornell/Rockefeller/Sloan Kettering Tri-Institutional MD-PhD Program, United States
- Gerstner Sloan Kettering Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center, United States
- Developmental Biology Program, Memorial Sloan Kettering Cancer Center, United States
Figures
Figure 1
An in vivo lipid droplet reporter using a PLIN2-tdTOMATO fusion transgene.
(A) Schematic of ubb:plin2-tdTomato construct injected into zebrafish and an adipocyte lipid droplet labeled with PLIN2-tdTOMATO fusion protein. Widefield microscope images of adult (B) wild-type …
Figure 2 with 1 supplement
Tg(-3.5ubb:plin2-tdTomato) is an in vivo reporter for visceral adipocytes.
(A) Schematic of visceral adipose tissue development in the 21 days post-fertilization (dpf) zebrafish. Abdominal visceral adipocytes (orange) develop around the swim bladder (gray) and pancreatic …
-
Figure 2—source data 1
Data values for Figure 2D-F.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Adipose tissue development in wild-type and Tg(-3.5ubb-plin2-tdTomato) zebrafish.
(A) Heatmap of adipose depot presence during zebrafish development in Tg(-3.5ubb:plin2-tdTomato) and wild-type siblings. Shown is the percent of fish scored for presence of the depot using either …
-
Figure 2—figure supplement 1—source data 1
Data values for Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 1 supplement
Fasting reduces visceral adipose tissue area.
(A) Schematic of experimental set-up for fasting experiment. 21 days post-fertilization (dpf) wild-type casper and Tg(-3.5ubb:plin2-tdTomato) zebrafish were fed or fasted for 7 days and imaged to …
-
Figure 3—source data 1
Data values for Figure 3C-E.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Data values for Figure 3H-J.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig3-data2-v1.xlsx
Figure 3—figure supplement 1
Forskolin reduces visceral adipose tissue area.
(A) Schematic of experimental set-up for Forskolin drug treatment. 21 days post-fertilization (dpf) Tg(-3.5ubb:plin2-tdTomato) zebrafish were individually placed in six-well plates with either …
-
Figure 3—figure supplement 1—source data 1
Data values for Figure 3—figure supplement 1B-D.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig3-figsupp1-data1-v1.xlsx
Figure 4
High-fat diet leads to specific enlargement of visceral adipose tissue.
(A) Percent breakdown of nutritional content for control feed and high-fat diet (HFD). (B) Schematic of experimental set-up for HFD experiment. 21 days post-fertiization (dpf) Tg(-3.5ubb:plin2-tdToma…
-
Figure 4—source data 1
Data values for Figure 4A-E.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig4-data1-v1.xlsx
Figure 5 with 1 supplement
A screen to discover novel compounds that modulate lipolysis and lipid droplets in vivo.
(A) Schematic of pharmacologic lipolysis screen in 3T3-L1 adipocytes using a glycerol release assay. Normalized log2 transformed values for top 10 drugs that inhibit lipolysis are shown. Magenta …
-
Figure 5—source data 1
Complete list of lipolysis screen compounds and log2 transformed values.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig5-data1-v1.xlsx
-
Figure 5—source data 2
Data values for Figure 5B.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig5-data2-v1.xlsx
-
Figure 5—source data 3
Data values for Figure 5C-E.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig5-data3-v1.xlsx
Figure 5—figure supplement 1
Atglistatin, Auranofin, and JS-K in vivo dose titration.
Viability of 21 days post-fertilization (dpf) Tg(-3.5ubb:plin2-tdTomato) zebrafish was measured after 24 hr of treatment with dimethyl sulfoxide (DMSO) or increasing concentrations of (A) …
-
Figure 5—figure supplement 1—source data 1
Data values for Figure 3—figure supplement 1A-F.
- https://cdn.elifesciences.org/articles/64744/elife-64744-fig5-figsupp1-data1-v1.xlsx
Figure 6 with 1 supplement
Lipolysis modulators also inhibit lipid droplet loss in melanoma cells.
(A) Schematic of zebrafish melanoma cell line with lipid droplet reporter (ZMEL-LD) with lipid droplet labeled by PLIN2-tdTOMATO. (B) Confocal images of ZMEL-LD cells after 24 hr of oleic acid treatm…
Figure 6—figure supplement 1
Lipid droplet production is equivalent between ZMEL-GFP and ZMEL-LD.
(A) Confocal images of ZMEL-GFP and ZMEL-LD after 24 hr of 150 µM oleic acid treatment. Cells were fixed and stained, with panels showing fluorescence signals for PLIN2-tdTOMATO, Lipidtox (lipid …
Videos
Video 1
3D reconstruction of ZMEL-LD lipid droplet.
ZMEL-LD cells were given oleic acid for 24 hr, fixed, and stained with the lipid droplet dye MDH. This video is a 3D reconstruction of 37 planes covering a 6 µm stack of a lipid droplet cluster in a …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Danio rerio) | ZMEL | Heilmann et al., 2015 | mitfa:BRAFV600E/p53-/- | |
| Cell line (Danio rerio) | ZMEL-LD | This paper | (-3.5ubb:plin2-tdtomato) in pDestTol2pA2-blastocidin | |
| Cell line (Mus musculus) | 3T3-L1 | ZenBio | SP-L1-F | |
| Strain, strain background (Danio rerio) | casper | White et al., 2008 | mitfaw2/w2;mpv17a9/a9 | |
| Strain, strain background (Danio rerio) | (-3.5ubb:plin2-tdtomato) | This paper | ||
| Recombinant DNA reagent | (-3.5ubb:plin2-tdtomato) in pDestTol2CG2 (plasmid) | This paper | ||
| Recombinant DNA reagent | (-3.5ubb:plin2-tdtomato) in pDestTol2pA2-blastocidin (plasmid) | This paper | ||
| Recombinant DNA reagent | pDestTol2pA2-blastocidin (plasmid) | Heilmann et al., 2015 | ||
| Recombinant DNA reagent | pDestTol2CG2 (plasmid) | Kwan et al., 2007 | ||
| Sequence-based reagent | PLIN2 cDNA FWD | This paper | PCR primer | AAAGCAGGCTCCACCATGAGCTTTCTTCTGTACTTGAAACTG |
| Sequence-based reagent | PLIN2 cDNA REV | This paper | PCR primer | GCCCTTGCTCACCATTTCAGTGACTTGAAGGGTCCTCTGT |
| Sequence-based reagent | PLIN2-TMT FWD | This paper | PCR primer | GCCGCCCCCTTCACCATGAGCTTTCTTCTGTACTTGAAAC |
| Sequence-based reagent | PLIN2-TMT REV | This paper | PCR primer | GCCCTTGCTCACCATTTCAGTGACTTG |
| Sequence-based reagent | tdTOMATO ME PLIN2 FWD | This paper | PCR primer | ATGGTGAGCAAGGGCGAG |
| Sequence-based reagent | tdTOMATO ME PLIN2 REV | This paper | PCR primer | GGTGAAGGGGGCGGC |
| Commercial assay or kit | Cloneamp HiFi PCR Premix | Takara | Catalog #639298 | |
| Commercial assay or kit | In-Fusion HD Cloning Plus | Takara | Catalog #638920 | |
| Commercial assay or kit | Gateway LR Clonase Enzyme mix | Thermo Fisher | Catalog #11791019 | |
| Commercial assay or kit | Zymogen Quick RNA Miniprep Kit | Zymo Research | Catalog #R1054 | |
| Commercial assay or kit | Invitrogen SuperScriptIII First-Strand Synthesis SuperMix Kit | Thermo Fisher | Catalog #18080400 | |
| Commercial assay or kit | NucleoSpin Gel and PCR Clean up | Takara | Catalog #740609.50 | |
| Commercial assay or kit | Free Glycerol Reagent | Sigma-Aldrich | Catalog #F6428 | |
| Chemical compound | Glycerol Standard Solution | Sigma-Aldrich | Catalog #G7793 | |
| Other | HCS LipidTOX deep red | Thermo Fisher | Catalog #H34477 | 1:250 or 1:500 |
| Other | BODIPY 493/503 | Thermo Fisher | Catalog #D3922 | 5 or 10 ng/µl |
| Other | AUTODOT Visualization Dye (MDH) | Abcepta | Catalog #SM1000a | 1:500 |
| Chemical compound, drug | Forskolin | Sigma-Aldrich | Catalog #F6886 | 5 µM (fish) |
| Chemical compound, drug | Auranofin | Sigma-Aldrich | Catalog #A6733 | 1 µM (fish), 0.5 µM (cells) |
| Chemical compound, drug | JS-K | Sigma-Aldrich | Catalog #J4137 | 1 µM (fish), 0.5 µM (cells) |
| Chemical compound, drug | Atglistatin | Sigma-Aldrich | Catalog #SML1075 | 40 µM |
| Chemical compound | Oleic Acid-Albumin | Sigma-Aldrich | Catalog #O3008-5M | |
| Chemical compound | LOPAC 1280 Library | Sigma-Aldrich | Catalog #LO1280 | |
| Antibody | Anti-RFP antibody (rabbit polyclonal) | Rockland | Catalog #600-401-379, RRID:AB_2209751 | (1:500), (1 µL) |
| Software, algorithm | MATLAB | Mathworks | ||
| Software, algorithm | PRISM | Graphpad | ||
| Software, algorithm | FIJI | Schindelin et al., 2012 | ||
| Software, algorithm | FlowJo | Becton, Dickinson and Company | ||
| Other | High-fat diet | Sparos | See detailed description of high-fat diet contents in the 'Methods' section below |
