Tissue-autonomous immune response regulates stress signaling during hypertrophy
- Department of Molecular Biosciences, The Wenner-Gren Institute (MBW), Stockholm University, Sweden
Figures
Figure 1 with 1 supplement
RasV12-induced hypertrophy induces local and cellular immune responses.
(A) RasV12-glands and controls stained with Phalloidin (red) to monitor tissue integrity at 96 hr and 120 hr after egg deposition (AED). (B) Nuclei stained with DAPI (white) to visualize nuclear …
Figure 1—figure supplement 1
Homeostasis, local and cellular immune responses separate along the longitudinal axis of RasV12-glands.
(A) Right: Schematic representation of deployed algorithm to measure fluorescene signals along all vertical axis perpendicular to the glands longitudinal axis. Left: mCD8::RFP;;RasV12- and mCD8::RFP-…
Figure 2 with 3 supplements
Drs expression is part of a genuine tissue-autonomous immune response.
(A) Semi quantitative DrsGFP reporter assay to identify upstream effectors of Drs expression by RNAi in RasV12-glands. Schematic representation (left) of the Toll-/imd-pathways showing components …
Figure 2—figure supplement 1
Drs expressed in a bona fide, tissue-autonomous, RasV12-dependent manner.
Larvae with RasV12-glands and DrsGFP reporter (green). (A) raised on plates with standard potatomash/molasses medium including stringent antibiotics cocktail, (A’) transferred immediately after …
Figure 2—figure supplement 2
Drs expression in RasV12-glands is dorsal-dependent.
(A) DrsGFP reporter assay with RNAi constructs against Caudal and Drifter in RasV12-glands. Sketched phenotypes (right) were scored, their mean and standard deviations plotted. Dunn’s test performed …
Figure 2—figure supplement 3
Mef2 contributes to Drs expression in RasV12-glands.
(A) Effect sizes of dlRNAi-knock-down on Drs-expression in proximal part (PP) and distal part (DP) compartments of and compared to RasV12-glands at 96 and 120 hr after egg deposition (AED). Mean of …
Figure 3 with 2 supplements
Hypertrophic RasV12-glands induce parallel immune and stress responses.
(A) Common and specific genesets significantly upregulated (log2(beta) ≥1; q-value ≤0.05) in either RasV12, lglRNAi;RasV12, or lglRNAi;RasV12-PP compared to w1118-glands. (B) PCA including all …
Figure 3—figure supplement 1
Drs is the only AMP detected to be expressed in the distal part of RasV12-glands until 96 hr.
(A) Schematic overview of protocol for preparing tissues analyzed by RNAseq. (B) Comparative GO term enrichment analysis for genes significantly upregulated in either RasV12- or lglRNAi;RasV12-glands…
Figure 3—figure supplement 2
JNK-signaling is predominantly activated in the distal part of RasV12-glands.
(A) Gene expression for canonical target genes measured by qPCR (log2-transformed, fold-change over Rpl32). Lower/upper hinges of boxplots indicate 1st/3rd quartiles, whisker lengths equal 1.5*IQR …
Figure 4 with 1 supplement
Drs overexpression and JNK inhibition individually prevent tissue disintegration.
(A) Drs-specific in-situ hybridization identifies endogenous (RasV12, jnkDN;;RasV12) and exogenous (Drs, Drs,RasV12) Drs expression. (B) Collagen-GFP trap (vkgG00454, green) and Hemese staining …
Figure 4—figure supplement 1
Hemocyte recruitment requires JNK-dependent Mmp2 expression.
(A) SG size as measured by outlining images of the 120 hr-old, experimental and control glands with the indicated genotypes. Lower/upper hinges of boxplots indicate 1st/3rd quartiles, whisker …
Figure 5 with 3 supplements
Drs overexpression inhibits JNK-activation.
(A) Schematic representation of the JNK-pathway including read-outs (green) employed to track its activation. (B) qPCR results for canonical JNK-target genes (log2-transformed, fold-change over Rpl32…
Figure 5—figure supplement 1
JNK-signaling does not regulkate Drs expression.
(A) DrsGFP reporter (green) and Hemese antibody (red) used to detect endogenous Drs expression and attached hemocytes. Scalebar indicates 100 µm. (B) Expression of Drs and JNK-target genes as …
Figure 5—figure supplement 2
Drs levels determine JNK-activation.
(A) Effect size of Drs-knock-down on Drs-expression in RasV12-glands. Mean RasV12-expression was set to ‘1’ separately at 96 hr and 120 hr after egg deposition (AED). (B) ISH with Drs-probe in RasV12…
Figure 5—figure supplement 3
Overexpression of Drs is specific in its effect on JNK-signaling.
(A) Expression values for Drs and JNK target genes as determined by qPCR for RasV12-glands coexpressing either Drs or mCD8::RFP as an UAS-dilution control at 96 hr and 120 hr after egg deposition …
Figure 6 with 1 supplement
Drs inhibits programmed cell death.
(A) Hid expression as measured by qPCR and plotted as log2-transformed values normalized to Rpl32-expression in RasV12-glands with in- (Drs) or decreased (DrsRNAi) Drs expression. (B) Schematic …
Figure 6—figure supplement 1
Drs inhibits programmed cell death via hid and Dronc.
(A–B) Quantifications and prototypical examples of RasV12-glands with in- (Drs) or decreased (DrsRNAi) Drs expression stained for activated Dronc (red) via the CC3-antibody, JNK-dependent …
Figure 7 with 1 supplement
Drs inhibits the JNK-feedback loop.
(A) Schematic representation of the JNK-feedback loop including levels of interference (blue) and used read-outs of its activity (green). hid-overexpressing glands with or without coexpressed Drs …
Figure 7—figure supplement 1
Dronc-reduction blocks the JNK-feedback loop in RasV12-glands.
(A) RasV12-glands with or without Dronc-knock-down were stained for activated jnk with a phosphorylation sensitive antibody at 120 hr after egg deposition (AED) and (B) the signal was quantified per …
Figure 8
Tissue-autonomous antagonizes cellular immune response via JNK-inhibition in RasV12-glands .
dl-mediated Drs expression inhibits JNK activation in the entire RasV12-gland until 96 hr after egg deposition (AED). At 120 hr AED, dl and thus Drs expression is reduced to the PP, derepressing …
Author response image 1
RasV12-glands show intrinsic anterior-posterior separation.
(A) Right: Schematic representation of deployed algorithm to measure fluorescene signals along all vertical axis perpendicular to the glands longitudinal axis. Left: mCD8::RFP;;RasV12- and mCD8::RFP …
Author response image 2
Drs asserts specific function on JNK-signaling not mimicked by other detected AMPs.
(A) SG size as measured by outlining images of the 120 h-old, experimental and control glands with the indicated genotypes. (B) Quantified CC3-staining in RasV12-glands with coexpressed Drs or …
Author response image 3
Apart from dorsal Drs is putatively regulated by Mef2.
(A) Effect sizes of dlRNAi-knock-down on Drs-expression in PP- and DP-compartments of and compared to RasV12-glands at 96 and 120 h AED. Mean of Drs-expression in RasV12-glands was set to “1”. …
Author response image 4
Mmp2 expression necessary for hemocyte attachment to the surface of RasV12-glands.
(A) Hemocyte attachment at 120 h AED in RasV12-glands hetero- and homozygous mutant for Mmp2 (Mmp2k00604). (B) Effect size of hetero- and homozygous mutant Mmp2-allele (Mmp2k00604) on hemocyte …
Author response image 5
Puc expression levels in RasV12-glands comparable to other tumor models.
(A) Differential expression values for puc as quantified from the here presented RNAseq datasets and Bunker, B.D. et al., 2015. Comparison of sequenced genotypes are presented in the respective …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | UAS-dlRNAi | Bloomington | 36650 | |
| Genetic reagent (D. melanogaster) | UAS-l(2)glRNAi | VDRC | 109604/KK | Rives-Quinto et al., 2017 |
| Genetic reagent (D. melanogaster) | UAS-imdRNAi | VDRC | 101834/KK | Bosch et al., 2005 |
| Genetic reagent (D. melanogaster) | UAS-FaddRNAi | VDRC | 100333/KK | |
| Genetic reagent (D. melanogaster) | UAS-keyRNAi | VDRC | 100257/KK | |
| Genetic reagent (D. melanogaster) | UAS-RelRNAi | VDRC | 108469/KK | Cammarata-Mouchtouris et al., 2020 |
| Genetic reagent (D. melanogaster) | UAS-spzRNAi | VDRC | 105017/KK | Panettieri et al., 2020 |
| Genetic reagent (D. melanogaster) | UAS-TlRNAi | VDRC | 1000788/KK | Alpar et al., 2018 |
| Genetic reagent (D. melanogaster) | UAS-cadRNAi | VDRC | 49562/KK | |
| Genetic reagent (D. melanogaster) | UAS-Stat92ERNAi | VDRC | 106980/KK | Recasens-Alvarez et al., 2017 |
| Genetic reagent (D. melanogaster) | UAS-DroncRNAi | VDRC | 100424/KK | Kale et al., 2015 |
| Genetic reagent (D. melanogaster) | UAS-DroncRNAi | VDRC | 23035/GD | Florentin and Arama, 2012 |
| Genetic reagent (D. melanogaster) | UAS-Myd88RNAi | VDRC | 25402/GD | Li et al., 2020 |
| Genetic reagent (D. melanogaster) | UAS-pllRNAi | VDRC | 2889/GD | Wu et al., 2015 |
| Genetic reagent (D. melanogaster) | UAS-DifRNAi | VDRC | 30578/GD | Wu et al., 2015 |
| Genetic reagent (D. melanogaster) | UAS-DifRNAi | VDRC | 30579/GD | Wu et al., 2015 |
| Genetic reagent (D. melanogaster) | UAS-DrsRNAi | VDRC | 2703/GD | |
| Genetic reagent (D. melanogaster) | UAS-dfrRNAi | S. Certel | ||
| Genetic reagent (D. melanogaster) | UAS-hidRNAi | VDRC | 8269/GD | Nagata et al., 2019 |
| Genetic reagent (D. melanogaster) | UAS-foxoRNAi | VDRC | 107786/KK | McLaughlin et al., 2019 |
| Genetic reagent (D. melanogaster) | UAS-grhRNAi | VDRC | 33680/GD | |
| Genetic reagent (D. melanogaster) | UAS-Mef2RNAi | Bloomington | 38247 | Zhao et al., 2020 |
| Genetic reagent (D. melanogaster) | UAS-Nrf2RNAi | VDRC | 101235/KK | Brock et al., 2017 |
| Genetic reagent (D. melanogaster) | UAS-Nrf2RNAi | VDRC | 108127/KK | Brock et al., 2017 |
| Genetic reagent (D. melanogaster) | UAS-Sox14RNAi | VDRC | 107146/KK | Wang et al., 2020 |
| Genetic reagent (D. melanogaster) | DrsGFP | W.-J. Lee | ||
| Genetic reagent (D. melanogaster) | TRE-GFP1b | D. Bohmann | ||
| Genetic reagent (D. melanogaster) | UAS-Drs | B. Lemaitre | ||
| Genetic reagent (D. melanogaster) | UAS-CecA1 | B. Lemaitre | ||
| Genetic reagent (D. melanogaster) | dl15 | Y. Engström | ||
| Genetic reagent (D. melanogaster) | Myd88KG03447 | Y. Engström | ||
| Genetic reagent (D. melanogaster) | UAS-hid | M.Suzanne | ||
| Genetic reagent (D. melanogaster) | UAS-Mmp2#4 | A. Page-McCaw | ||
| Genetic reagent (D. melanogaster) | UAS-Mmp1APM1037 | A. Page-McCaw | ||
| Genetic reagent (D. melanogaster) | UAS-Mmp1APM3099 | A. Page-McCaw | ||
| Genetic reagent (D. melanogaster) | UAS-RasV12 | Bloomington | 4847 | |
| Genetic reagent (D. melanogaster) | BxMS1096 | Bloomington | 8860 | |
| Genetic reagent (D. melanogaster) | UAS-jnkDN | Bloomington | 6409 | UAS-bskDN |
| Genetic reagent (D. melanogaster) | tubP-Gal80ts | Bloomington | 7108 | |
| Genetic reagent (D. melanogaster) | Mmp2k00604 | Bloomington | 10358 | |
| Genetic reagent (D. melanogaster) | 10xStat92E-GFP | Bloomington | 26197 | |
| Genetic reagent (D. melanogaster) | UAS-p35.H | Bloomington | 5072 | |
| Genetic reagent (D. melanogaster) | UAS-mCD8::mRFP | Bloomington | 27400 | |
| Genetic reagent (D. melanogaster) | vkgG00454 | Flytrap | Ref. 100; CollagenIV | |
| Antibody | Anti-Hemese (mouse monoclonal) | István Andó | H2 | IF(1:5) |
| Antibody | Anti-pJNK (mouse monoclonal) | Cell Signaling Technology | Cat#:9255 | IF (1:250) |
| Antibody | Anti-cleaved caspase 3 (rabbit polyclonal) | Cell Signaling Technology | Cat#:9661 | IF(1:200) |
| Antibody | Anti-dorsal (mouse monoclonal) | DSHB | 7A4-39 | IF(1:50) |
| Antibody | Anti-mouse-IgG-Alexa546 (goat polyclonal) | ThemoFisher Scientific | Cat#: A-11030 | IF(1:500) |
| Antibody | Anti-rabbit-IgG-Alexa568 (goat polyclonal) | ThemoFisher Scientific | Cat#: A-11011 | IF(1:500) |
| Recombinant DNA reagent | Drs (cDNA clone) | DGRC | LP03851 | |
| Recombinant DNA reagent | CecA1 (cDNA clone) | DGRC | IP21250 | |
| Sequence-based reagent | oligo(dT)16-primer | ThermoFisher Scientific | Cat#:8080128 | |
| Sequence-based reagent | Drs_F | This paper | qPCR primers | gaggagggacgctccagt |
| Sequence-based reagent | Drs_R | This paper | qPCR primers | ttagcatccttcgcaccag |
| Sequence-based reagent | AttD_F | This paper | qPCR primers | gtttatggagcggtcaacg |
| Sequence-based reagent | AttD_R | This paper | qPCR primers | tctggaagagattggcttgg |
| Sequence-based reagent | TIMP_F | This paper | qPCR primers | aacagagcgtcatggcttca |
| Sequence-based reagent | TIMP_R | This paper | qPCR primers | tcacaccaaaacaggtggca |
| Sequence-based reagent | Upd1_F | This paper | qPCR primers | cgggtgatcgcttcaatc |
| Sequence-based reagent | Upd1_R | This paper | qPCR primers | ctgcggtactcccgaaag |
| Sequence-based reagent | Upd2_F | This paper | qPCR primers | aagttcctgccgaacatgac |
| Sequence-based reagent | Upd2_R | This paper | qPCR primers | atccttgcggaacttgtactg |
| Sequence-based reagent | Upd3_F | This paper | qPCR primers | actgggagaacacctgcaat |
| Sequence-based reagent | Upd3_R | This paper | qPCR primers | gcccgtttggttctgtagat |
| Sequence-based reagent | Hid_F | This paper | qPCR primers | tctacgagtgggtcaggatgt |
| Sequence-based reagent | Hid_R | This paper | qPCR primers | gcggatactggaagatttgc |
| Sequence-based reagent | Rpr_F | This paper | qPCR primers | gatcaggcgactctgttgc |
| Sequence-based reagent | Rpr_R | This paper | qPCR primers | actgtgactcccgcaagc |
| Sequence-based reagent | Grim_F | This paper | qPCR primers | atcgatgaccatgtcggagt |
| Sequence-based reagent | Grim_R | This paper | qPCR primers | cgcagagcgtagcagaagat |
| Sequence-based reagent | MMP1_F | This paper | qPCR primers | gtttccaccaccacacagg |
| Sequence-based reagent | MMP1_R | This paper | qPCR primers | gcagaggcgggtagatagc |
| Sequence-based reagent | MMP2_F | This paper | qPCR primers | tttcgatgcggacgagac |
| Sequence-based reagent | MMP2_R | This paper | qPCR primers | gccacgttcagaaaattggt |
| Sequence-based reagent | PUC_F | This paper | qPCR primers | cgtcatcatcaacggcaat |
| Sequence-based reagent | PUC_R | This paper | qPCR primers | aggcggggtgtgtttctat |
| Sequence-based reagent | RPL32_F | This paper | qPCR primers | cggatcgatatgcta |
| Sequence-based reagent | RPL32_R | This paper | qPCR primers | cgacgcactctgttg |
| Peptide, recombinant protein | RNase-free DNase I | ThermoFisher Scientific | Cat#:EN0521 | |
| Peptide, recombinant protein | SuperscriptIII | ThermoFisher Scientific | Cat#:18080-093 | |
| Peptide, recombinant protein | Phalloidin-546 | Molecular probes | Cat#:A22283 | |
| Commercial assay or kit | KAPA SYBR FAST qPCR Master Mix (2x) kit | Kapa Biosystems; Sigma-Aldrich | KR0389, v9.13 | |
| Commercial assay or kit | RNAqueous-Micro Kit | ThermoFisher Scientific | Cat#:AM1931 | |
| Commercial assay or kit | RNAqueous Kit | ThermoFisher Scientific | Cat#:AM1912 | |
| Commercial assay or kit | Experion RNA StdSens Reagents and Supplies | Bio-Rad | Cat#:700-7154 | |
| Commercial assay or kit | Experion RNA StdSens Chips | Bio-Rad | Cat#:700-7153 | |
| Chemical compound, drug | Vancomycin | Sigma-Aldrich | Cat#:V2002 | |
| Chemical compound, drug | Metronidazole | Sigma-Aldrich | Cat#:M3761 | |
| Chemical compound, drug | Neomycin | Sigma-Aldrich | Cat#:N1876 | |
| Chemical compound, drug | Carbenicillin | Sigma-Aldrich | Cat#:C1389 | |
| Chemical compound, drug | Sodium Hypochlorite solution | Fisher Scientific | Cat#:10401841 | |
| Chemical compound, drug | DAPI | Sigma-Aldrich | D9542 | |
| Software, algorithm | ImageJ | Fiji contributors | v1.52n | https://imagej.nih.gov/ij/ |
| Software, algorithm | Zen software | Zeiss | Blue edition | |
| Software, algorithm | kallisto | Bray et al., 2016 | v0.44.0 | https://pachterlab.github.io/kallisto/ |
| Software, algorithm | sleuth | Pimentel et al., 2017 | v0.30.0 | https://pachterlab.github.io/sleuth/ |
| Software, algorithm | GOstats | Falcon and Gentleman, 2007 | v2.48.0 | https://github.com/Bioconductor/GOstats/ |
| Software, algorithm | AnnotationDbi | Pagès et al., 2020 | v1.44.0 | https://github.com/Bioconductor/AnnotationDbi/ |
| Software, algorithm | org.Dm.eg.db | Carlson, 2019 | v3.7.0 | http://bioconductor.org/packages/org.Dm.eg.db/ |
| Software, algorithm | RNAseq_sg_ analysis.Rmd | This paper | https://github.com/robertkrautz/sg_analysis/; Krautz, 2021; copy archived at swh:1:rev:82c91040d3434b215c04cfce11cf73f70300e099 | |
| Software, algorithm | RNAseq_motif_ enrichment.Rmd | This paper | https://github.com/robertkrautz/sg_analysis/ | |
| Software, algorithm | scanner.ijm | This paper | https://github.com/robertkrautz/sg_analysis/ | |
| Software, algorithm | RcisTarget | Aibar et al., 2017 | v1.6.0 | https://www.bioconductor.org/packages/release/bioc/html/RcisTarget.html |
| Software, algorithm | biomaRt | Durinck et al., 2009 | v2.42.1 | https://bioconductor.org/packages/release/bioc/html/biomaRt.html |
| Software, algorithm | Biostrings | Pàges et al., 2020 | v2.54.0 | https://bioconductor.org/packages/release/bioc/html/Biostrings.html |
| Software, algorithm | PWMEnrich | Stojnic and Diez, 2020 | v4.22.0 | https://www.bioconductor.org/packages/release/bioc/html/PWMEnrich.html |
Additional files
-
Supplementary file 1
Complete list of all crosses associated with the experimental results in the indicated figures.
- https://cdn.elifesciences.org/articles/64919/elife-64919-supp1-v2.docx
-
Supplementary file 2
Complete list of all sequences corresponding to forward and reverse primers used for qPCR.
- https://cdn.elifesciences.org/articles/64919/elife-64919-supp2-v2.docx
-
Supplementary file 3
Overview of all RNAi-lines used in the DrsGFP-reporter assay, including references indicating prior use and evidence for active inhibition of the outlined target of the respective RNAi-line.
- https://cdn.elifesciences.org/articles/64919/elife-64919-supp3-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64919/elife-64919-transrepform-v2.docx
