(a) Scheme for human embryo culture. Supernumerary in vitro fertilized human embryos were warmed at day 3, and cultured for 2, 9, or 24 hr to examine the localization of polarization markers. (b) …
Source data for Figure 1.
This file contains the source data used to make the graphs presented in Figure 1 and Figure 1—figure supplement 1. GraphPad Prism was utilized to visually represent the quantitative data.
(a-b) Histograms showing the number of total (a) and intact (b) cells at the time of embryo warming, N = 132 control embryos. (c–d) Histograms showing the number of total (c) and intact (d) cells …
(a) Scheme of the PLCE1/PLCB1 siRNA injections. (b), Representative images of embryos injected with control siRNA or PLCE1/PLCB1 siRNA and cultured until embryonic day four to reveal the …
Source data for Figure 2.
This file contains the source data used to make the graphs presented in Figure 2 and Figure 2—figure supplements 1 and 2. GraphPad Prism was utilized to visually represent the quantitative data.
(a) Scheme of the PLC inhibitor treatment. (b) Quantification of the total number of cells in embryos from panel d. Each dot represents one embryo. N = 42 embryos for media control group, N = 19 …
(a) Expression profile for all PLC isoforms at different stages of human preimplantation development. Data retrieved from Yan et al., 2013. (b) The expression level of PLCE1 and PLCB1 in human …
(a) Representative images of in vitro fertilized human embryos warmed at day 3 and cultured for 2, 9, or 24 hr (see scheme in Figure 1a ) to reveal the localization of F-actin, PARD6, and GATA3. …
Source data for Figure 3 and Figure 3—figure supplement 1.
This file contains the source data used to make the graphs presented in Figure 3. GraphPad Prism was utilized to visually represent the quantitative data.
(a) Number of cells showing nuclear GATA3 (defined as a nucleus to cytoplasm ratio of more than 1.5) in relation to their polarity status in human embryos at embryonic day 4. Numbers in each bar …
(a) Representative images of embryos that have inner cells with a low number of outer polarized cells. White arrowheads indicate the presence of inner cells. (b) Line chart showing the relation …
Source data for Figure 4.
This file contains the source data used to make the graphs presented in Figure 4. GraphPad Prism was utilized to visually represent the quantitative data.
F-actin polarization precedes PAR complex polarization and it is triggered by PLC activation in mouse and human embryos. In human embryos, blastomeres initiate the expression of TE factors …
Duration of compaction was defined as the time in hours between the start of compaction and morula formation. r: pearson correlation coefficient; p: p-value. No correlation was found between both …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
Sequenced-based reagent | siRNA to PLCE1 and PLCB1 | Qiagen | Hs_PLCB1_4, SI00115521; Hs_PLCB1_6, SI02781184Hs_PLCE1_1, SI00115521; negative control siRNA:1022076. | A 20 μM concentration of siRNA solution was used for injection. |
Biological sample (Human) | Human embryos | Donated supernumerary embryos generated from in vitro fertilization experiments | ||
Antibody | (Rabbit monoclonal), anti-PARD6 | Santa Cruz | sc-67393 | (1:200) |
Antibody | (Goat polyclona)l, anti-GATA3 | R&D systems | AF2605 | (1:200) |
Antibody | (Mouse monoclonal), anti-aPKC | Santa Cruz | sc-17781 | (1:50) |
Antibody | (Mouse monoclonal), anti-YAP1 | Santa Cruz | sc-101199 | (1:200) |
Recombinant DNA reagent | pRN3P- GAP-GFP | Zhu et al., 2017 | ||
Sequence-based reagent | GAPDH-F | This paper | qPCR primers | GATCATCAGCAATGCCTCCT |
Sequence-based reagent | GAPDH-R | This paper | qPCR primers | TTCAGCTCAGGGATGACCTT |
Sequence-based reagent | PLCB1-F | This paper | qPCR primers | GGAAGCGGCAAAAAGAAGCTC |
Sequence-based reagent | PLCB1-R | This paper | qPCR primers | CGTCGTCGTCACTTTCCGT |
Sequence-based reagent | PLCE1-F | This paper | qPCR primers | TGCAGCCTCTCATCCAGTT |
Sequence-based reagent | PLCE1-R | This paper | qPCR primers | CCCTGCGGTAAATAGTCTGC |
Commercial assay or kit | SMART-Seq v4 Ultra Low Input RNA Kit | Takara | Cat. No. 634,888 | |
Commercial assay or kit | Agencourt AMPure XP Kit | Beckman Coulter | A63880 | |
Chemical compound, drug | U73122 | Caymanchem | No. 70,740 | |
Chemical compound, drug | DMSO | Sigma-Alrich | D2650−5 × 10 ML | |
Software, algorithm | Prism 8 | Graphpad |