A polarity pathway for exocyst-dependent intracellular tube extension
- NYU Grossman School of Medicine, United States
- Department of Cell Biology, NYU Grossman School of Medicine, United States
Figures
Figure 1 with 1 supplement
SEC-5 and RAL-1 are required in the excretory cell for lumen extension.
(A) Schematics of L4 larval stage worms depicting excretory cell-specific protein depletion using excP::zif-1. The H-shaped excretory canal is outlined and a hypothetical ubiquitous ZF1-tagged protein is depicted in green. The typical region of the canal examined by microscopy is enlarged to show cytoplasmic (yellow, excP::YFP) and lumenal membrane (cyan, IFB-1::CFP) markers used for analyzing excretory canal morphology. Anterior left, dorsal top. (B and C) L4 stage excretory canal in transgenic control (B) and excP::zif-1 (C) animals expressing ZF1::GFP::CDC-42. Outline of excretory canal cytoplasm is indicated by dotted line. ZF1::GFP::CDC-42 is degraded in the excretory cell, but not surrounding cells (arrowhead), in excP::zif-1 animals. (D) Endogenous expression of SEC-5::ZF1::YFP at the excretory canal lumenal membrane of L4 stage larva. (E–J’’) Larval excretory canal phenotypes in control (E–F’’), SEC-5exc(-) (G–H’’), and RAL-1exc(-) (I–J’’). Canal cytoplasm and lumenal membrane are marked by an extrachromosomal array expressing excretory cell-specific cytoplasmic and lumenal membrane markers (see panel A). Confocal images were acquired using ×20 (E, G, I) and ×63 objectives (F–F’’, H–H’’, J–J’’). Excretory cell body indicated by asterisk. Posterior tip of excretory canal indicated by white arrow. Posterior excretory canal that has extended beyond the focal plane is indicated by dashed white arrow. Dashed box indicates approximate region represented in high magnification images. Outline of each animal is indicated by solid white line. Scale bars, 10 μm.
Figure 1—figure supplement 1
t28h11.8p is an excretory cell-specific promoter during embryonic and larval canal outgrowth.
(A) Widefield fluorescence images of t28h11.8p::mCherry (‘excP::mCh’) transcriptional reporter during embryonic elongation. Threefold stage of embryo elongation is shown as this represents the initial stage of posterior canal growth. t28h11.8p::mCherry expression could not be visually detected in any tissues outside of the excretory canal during embryogenesis. (B) t28h11.8p::mCh expression during the L1 larval stage, as canal growth proceeds beyond half of the animal’s body length. Excretory cell body indicated by asterisk. Posterior tip of excretory canal indicated by white arrow. Outline of each animal is indicated by solid white line. A single canal arm is shown in each image with anterior canal extensions visible adjacent to the cell body. Scale bars, 10 μm. ‘Unsharp mask’ filter was applied equally to all images using ImageJ software.
Figure 2 with 1 supplement
Canal outgrowth phenotypes upon exocyst or PAR protein depletion.
Schematics of the excretory cell are shown at the L1 stage, when the canal is extending, and the L4 larval stage, when the canal is fully extended. Canal outgrowth defects upon depleting the indicated proteins in the excretory cell are depicted as the percentage of animals in each of four phenotypic categories (quartiles) that measure posterior canal extension relative to body length. The relative intensity of green shading reflects the percentage of larvae observed in each phenotypic category. p values were calculated using Fisher’s exact test after pooling quartiles and comparing each genotype to the control group (L1 stage:<50% versus>50% canal outgrowth; L4 stage:<75% versus>75% canal outgrowth). p value significance was adjusted using Bonferroni correction to account for multiple comparisons to a common control, such that p≤0.008 is considered statistically significant.
-
Figure 2—source data 1
Positions of posterior excretory canal arms in control, SEC-5exc(-), RAL-1exc(-), PKC-3exc(-), PAR-6exc(-), CDC-42exc(-), and PAR-3exc(-).
Source data corresponding to Figure 2.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig2-data1-v3.xlsx
Figure 2—figure supplement 1
The SEC-5exc(-) canal outgrowth phenotype is not enhanced by a sec-5 null allele.
Canal outgrowth defects upon depleting the indicated proteins in the excretory cell are indicated as the percentage of animals in each of four phenotypic categories that measure posterior canal extension relative to body length at L4 larval stage (see Figure 2). The relative intensity of green shading reflects the percentage of larvae observed in each phenotypic category. The pvalue was calculated using Fisher’s exact test (<50% versus>50% canal outgrowth).
Figure 3
PAR-6, PKC-3, and PAR-3 are enriched at the lumenal membrane and CDC-42 extends into the canal cytoplasm.
(A–C) Distribution of endogenously tagged PAR-6, PKC-3, and PAR-3 in the excretory cell canal. (D) Schematic of excretory cell line trace measurements displayed in F and H. Three line-trace measurements (m1, m2, m3) were taken perpendicular to the excretory cell lumen in each animal. Measurements were averaged to generate a single line trace for each larva, and five larvae were measured from each genotype. (E–E’’) Distribution of PAR-6::ZF1::YFP and PAR-3::mCherry in the larval excretory canal. (F) Line traces of PAR-6::ZF1::YFP (green) and PAR-3::mCherry (magenta). Solid line represents mean and shaded area is ± SD. Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (G–G’’) Distribution of ZF1::YFP::CDC-42 and PAR-6::mKate in the larval excretory canal. (H) Line trace of ZF1::YFP::CDC-42 (green) and PAR-6::mKate (magenta). Solid line represents mean and shaded area is ± SD. Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. Outline of excretory canal cytoplasm is indicated by dashed lines. Scale bars, 10 μm.
-
Figure 3—source data 1
Fluorescent intensity values for line trace measurements of PAR-6::ZF1::YFP; PAR-3::mCherry and ZF1::YFP::CDC-42; PAR-6::mKate.
Source data corresponding to Figure 3F,H. Fluorescence intensity values were obtained in Fiji by drawing a line the width of the excretory canal cytoplasm and using the ‘plot profile’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig3-data1-v3.xlsx
Figure 4 with 2 supplements
PAR-6, PKC-3, and CDC-42, but not PAR-3, are required for excretory cell lumen extension.
Larval excretory canal phenotypes in PAR-6exc(-) (A–B’’), PKC-3exc(-) (C–D’’), CDC-42exc(-) (E–F’’) and PAR-3exc(-) (G–H’’) L4 stage worms expressing cytoplasmic and lumenal membrane markers. Confocal images were acquired using ×20 (A, C, E, G) and ×63 (B–B’’, D–D’’, F–F’’, H–H’’) objectives. Excretory cell body indicated by asterisk. Posterior tip of excretory canal indicated by white arrow. Posterior excretory canal that has extended beyond the focal plane is indicated by dashed white arrow. Dashed box indicates approximate region represented in high-magnification images. Outline of each animal is indicated by solid white line. Scale bars, 10 μm.
Figure 4—figure supplement 1
CDC-42 depletion causes a split lumen phenotype in larval excretory canals.
(A–B’’) Widefield fluorescence images of larval excretory canal phenotypes in CDC-42exc(-) L1 and L4 larval stage worms expressing cytoplasmic and lumenal membrane markers. An additional lumen that has split off of the canal arm is indicated by white arrowhead. Scale bars, 10 μm. ‘Unsharp mask’ filter was applied equally to all images using ImageJ software.
Figure 4—figure supplement 2
Depletion of PAR-3 causes mild excretory cell lumen defects during early larval stages.
(A–B’’) Larval excretory canal phenotypes in PAR-3exc(-) L1 stage worms expressing cytoplasmic and lumenal membrane markers. Images are of the same animal at different magnifications, ×20 (A) and ×63 (B–B’’). Excretory cell body indicated by asterisk. Posterior tip of excretory canal indicated by white arrow. Outline of animal is indicated by solid white line. Single canal arm is shown in each image with anterior canal extensions visible adjacent to cell body. Scale bars, 10 μm.
Figure 5 with 1 supplement
PAR-6, but not PAR-3, is required to enrich SEC-10 at the lumenal membrane.
(A) Schematic of L4 larval stage worms depicting heat-shock inducible protein depletion. The excretory canal is outlined in black and a hypothetical ubiquitous ZF1-tagged protein is shown in green. Upon heat-shock, the ZF1-tagged protein is rapidly degraded in all somatic cells of animals expressing hspP::zif-1. To measure fluorescence intensity, average pixel intensity was calculated along a region of the excretory cell lumenal membrane (‘L’) and within the cytoplasm (‘C’); dividing L/C yields the lumen/cytoplasm ratio shown in (F and K). Anterior left, dorsal top. (B–C) Distribution of PAR-6::ZF1::YFP in larval excretory canal in control (B) and hspP::zif-1 (C). (B’–C’) Distribution of mCherry::SEC-10 in larval excretory canal of control (B’) and hspP::zif-1 (C’) worms expressing PAR-6::ZF1::YFP. (D–E) Line trace of PAR-6::ZF1::YFP (green) and mCherry::SEC-10 (magenta). Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (F) Quantification of lumenal membrane to cytoplasm intensity ratio of mCherry::SEC-10 in the excretory canal of control and hspP::zif-1 larvae expressing PAR-6::ZF1::YFP. Individual data points (small dots) are color-coded (orange, purple, and light blue) from three independent replicates. Large dots represent the mean of each replicate, horizontal bar is the mean of means, and error bars are the SEM. p values were calculated using a ratio paired t-test of the means. n = 5, 8, 7 for control; n = 13, 11, 10 for hspP::zif-1. (G–H) Distribution of PAR-3::ZF1::YFP in larval excretory canal in control (G) and hspP::zif-1 (H). (G’–H’) Distribution of mCherry::SEC-10 in the larval excretory canal of control (G’) and hspP::zif-1 (H’) worms expressing PAR-3::ZF1::YFP. (I–J) Line trace of PAR-3::ZF1::YFP (green) and mCherry::SEC-10 (magenta). Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (K) Quantification of lumenal membrane to cytoplasm intensity ratio of mCherry::SEC-10 expression in the excretory canal of control and hspP::zif-1 larvae expressing PAR-3::ZF1::YFP. Data is shown as in panel F. p values were calculated using a ratio paired t-test of the means. n = 7, 9, 8 for control; n = 7, 8, 8 for hspP::zif-1. Outline of excretory canal cytoplasm is indicated by dashed line. Scale bars, 10 μm.
-
Figure 5—source data 1
Fluorescent intensity values for line trace measurements of PAR-6::ZF1::YFP; mCherry::SEC-10 and PAR-3::ZF1::YFP; mCherry::SEC-10.
Source data corresponding to Figure 5D,E,I,J. Fluorescence intensity values were obtained in Fiji by drawing a line the width of the excretory canal cytoplasm and using the ‘plot profile’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig5-data1-v3.xlsx
-
Figure 5—source data 2
Fluorescent intensity values for lumenal membrane and cytoplasmic mCherry::SEC-10 measurements in PAR-6::ZF1::YFP and PAR-3::ZF1::YFP backgrounds.
Source data corresponding to Figure 5F,K. Fluorescence intensity values were obtained in Fiji by drawing a line along lumenal membrane and adjacent cytoplasmic region and using the ‘measure’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig5-data2-v3.xlsx
Figure 5—figure supplement 1
PAR-6::ZF1::YFP depletion by acute ZIF-1 expression.
(A–B) Distribution of PAR-6::ZF1::YFP in larval excretory canal in control (A) and hspP::zif-1 (B). (C) Quantification of PAR-6::ZF1::YFP intensity in the excretory canal of control and hspP::zif-1 larvae. Individual data points from a single experiment are represented by black dots, horizontal bar is the mean, and error bars are the SEM. Outline of excretory canal cytoplasm is indicated by dotted line. Scale bar, 10 μm.
Figure 6
PAR-3 is required to enrich PAR-6 at the lumenal membrane.
(A–B) Distribution of PAR-3::ZF1::YFP in larval excretory canal in control (A) and hspP::zif-1 (B) worms. (A’–B’) Distribution of PAR-6::mKate in the larval excretory canal of control (A’) and hspP::zif-1 (B’) worms expressing PAR-3::ZF1::YFP. Arrowheads show punctate PAR-6::mKate along lumenal membrane. (C–D) Line traces of PAR-3::ZF1::YFP (green) and PAR-6::mKate (magenta). Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (E) Quantification of lumenal membrane to cytoplasm intensity ratio of PAR-6::mKate expression in the excretory canal of control and hspP::zif-1 larvae expressing PAR-3::ZF1::YFP. Individual data points (small dots) are color-coded (orange, purple, and light blue) from three independent replicates. Large dots represent the mean of each replicate, horizontal bar is the mean of means, and error bars are the SEM. p values were calculated using a ratio paired t-test of the means. n = 6, 6, 8 for control; n = 4, 7, 8 for hspP::zif-1. (F–G) Distribution of PAR-6::ZF1::YFP in larval excretory canal in control (F) and hspP::zif-1 (G) worms. (F’–G’) Distribution of PAR-3::mCherry in larval excretory canal of control (F’) and hspP::zif-1 (G’) worms expressing PAR-6::ZF1::YFP. (H–I) Line traces of PAR-6::ZF1::YFP (green) and PAR-3::mCherry (magenta). Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (J) Quantification of lumenal membrane to cytoplasm intensity ratio of PAR-3::mCherry expression in the excretory canal of control and hspP::zif-1 larvae expressing PAR-6::ZF1::YFP. Data depicted as in panel E. p values were calculated using a ratio paired t-test of the means. n = 9, 8, 9 for control; n = 7, 8, 9 for hspP::zif-1. Outline of excretory canal cytoplasm is indicated by dotted line. Scale bars, 10 μm.
-
Figure 6—source data 1
Fluorescent intensity values for line trace measurements of PAR-3::ZF1::YFP; PAR-6::mKate and PAR-6::ZF1::YFP; PAR-3::mCherry.
Source data corresponding to Figure 6C,D,H,I. Fluorescence intensity values were obtained in Fiji by drawing a line the width of the excretory canal cytoplasm and using the ‘plot profile’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig6-data1-v3.xlsx
-
Figure 6—source data 2
Fluorescent intensity values for lumenal membrane and cytoplasmic measurements of PAR-6::mKate in PAR-3::ZF1::YFP background and PAR-3::mCherry measurements in PAR-6::ZF1::YFP background.
Source data corresponding to Figure 6E,J. Fluorescence intensity values were obtained in Fiji by drawing a line along lumenal membrane and adjacent cytoplasmic region and using the ‘measure’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig6-data2-v3.xlsx
Figure 7
CDC-42 and EXC-5 are required to enrich PAR-6 and PKC-3 at the lumenal membrane.
(A–B) Distribution of ZF1::YFP::CDC-42 in larval excretory canal in control (A) and hspP::zif-1 (B) worms. (A’–B’) Distribution of PAR-6::mKate in the larval excretory canal of control (A’) and hspP::zif-1 (B’) worms expressing ZF1::YFP::CDC-42. (C–D) Line trace of ZF1::YFP::CDC-42 (green) and PAR-6::mKate (magenta). Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (E) Quantification of lumenal membrane to cytoplasm intensity ratio of PAR-6::mKate expression in the excretory canal of control and hspP::zif-1 larvae expressing ZF1::YFP::CDC-42. Individual data points (small dots) are color-coded (orange, purple, and light blue) from three independent replicates. Large dots represent the mean of each replicate, horizontal bar is the mean of means, and error bars are the SEM. p values were calculated using a ratio paired t-test of the means. n = 8, 7, 7 for control; n = 9, 7, 8 for hspP::zif-1. (F–G) Distribution of EXC-5::ZF1::mScarlet in the larval excretory canal in control (F) and hspP::zif-1 (G) worms. (F’–G’) Distribution of GFP::PKC-3 in the larval excretory canal of control (F’) and hspP::zif-1 (G’) worms expressing EXC-5::ZF1::mScarlet. (H–I) Line trace of GFP::PKC-3 (green) and EXC-5::ZF1::mScarlet (magenta). Intensities were normalized to compare peak values of each channel. ‘0.0’ on x-axis represents the center point of the canal lumen. n = 5 larvae. (J) Quantification of lumenal membrane to cytoplasm intensity ratio of GFP::PKC-3 expression in the excretory canal of control and hspP::zif-1 larvae expressing EXC-5::ZF1::mScarlet. Data are depicted as in panel E. p values were calculated using a ratio paired t-test of the means. n = 5, 6, 6 for control; n = 5, 5, 6 for hspP::zif-1. (K) Model of PAR and exocyst regulation of excretory cell lumen extension. Cross section of larval excretory canal (left) depicts large, canalicular vesicles fusing with the lumenal membrane (red) during lumen extension. Boxed region represents a portion of canal where lumen extension is occurring, magnified at right to show a proposed molecular pathway for lumenal vesicle tethering. Outline of excretory canal cytoplasm is indicated by dotted line. Scale bars, 10 μm.
-
Figure 7—source data 1
Fluorescent intensity values for line trace measurements of ZF1::YFP::CDC-42; PAR-6::mKate and EXC-5::ZF1::mScarlet; GFP::PKC-3.
Source data corresponding to Figure 7C,D,H,I. Fluorescence intensity values were obtained in Fiji by drawing a line the width of the excretory canal cytoplasm and using the ‘plot profile’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig7-data1-v3.xlsx
-
Figure 7—source data 2
Fluorescent intensity values for lumenal membrane and cytoplasmic measurements of PAR-6::mKate in ZF1::YFP::CDC-42 background and GFP::PKC-3 measurements in EXC-5::ZF1::mScarlet background.
Source data corresponding to Figure 7E,J. Fluorescence intensity values were obtained in Fiji by drawing a line along lumenal membrane and adjacent cytoplasmic region and using the ‘measure’ function.
- https://cdn.elifesciences.org/articles/65169/elife-65169-fig7-data2-v3.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (C. elegans) | xnIs23[cdc-42p::zf1::gfp::cdc-42 unc-119(+)]; unc-119(ed3) | Armenti et al., 2014b | FT95 | Shown in Figure 1B |
| Strain, strain background (C. elegans) | sec-5(tm1443)/mIn1[mIs14 dpy-10(e128)] | Frische et al., 2007 | FT1202 | Shown in Figure 2—figure supplement 1 See Genetic test of ZIF-1 degradation section in Materials and methods |
| Strain, strain background (C. elegans) | sec-5(xn51[sec-5::zf1::yfp loxP unc-119(+) loxP]); unc-119(ed3) | Armenti et al., 2014b | FT1523 | Shown in Figure 1D |
| Strain, strain background (C. elegans) | xnIs23; xnEx437[t28h11.8p::mCherry, t28h11.8p::zif-1]; unc-119(ed3) | This study | FT1692 | Shown in Figure 1C, Figure 1—figure supplement 1 See Transgene construction section in Materials and methods |
| Strain, strain background (C. elegans) | par-3(xn59[par-3::zf1::yfp loxP unc-119(+) loxP]); unc-119(ed3) | This study | FT1699 | Shown in Figure 3C See CRISPR knock-ins section in Materials and methods |
| Strain, strain background (C. elegans) | par-6(xn60[par-6::zf1::yfp loxP unc-119(+) loxP]); unc-119(ed3) | Zilberman et al., 2017 | FT1702 | Shown in Figure 3A |
| Strain, strain background (C. elegans) | sec-5(xn51); xnIs547[t28h11.8p::zif-1]; par-3(it301[par-3::mCherry]); xnEx466[t28h11.8p::yfp::sl2::ifb-1::cfp, pRF4] | This study | FT1834 | FT1523 crossed to FT1837 Shown in Figure 1G-H'', Figure 2, Figure 2—figure supplement 1 |
| Strain, strain background (C. elegans) | xnIs547; par-3(it301); xnEx466 | This study | FT1837 | Shown in Figure 1E-F'', Figure 2 |
| Strain, strain background (C. elegans) | par-6(xn60); xnIs547; xnSi31[sec-8p::sec-8::mCherry unc-119(+)]; xnEx473[t28h11.8p::yfp::sl2::ifb-1::cfp, pRF4] | This study | FT1844 | Shown in Figure 2, Figure 4A-B'' |
| Strain, strain background (C. elegans) | par-3(xn59); xnIs547; xnSi31; xnEx475[t28h11.8p::yfp::sl2::ifb-1::cfp, pRF4] | This study | FT1846 | Shown in Figure 22, Figure 4G-H'', Figure 4—figure supplement 2 |
| Strain, strain background (C. elegans) | cdc-42(xn65[zf1::yfp::cdc-42 loxP unc-119(+) loxP]); xnIs547; par-3(it301); xnEx477[t28h11. 8p::yfp::sl2::ifb-1::cfp, pRF4] | This study | FT1849 | Shown in Figure 2, Figure 4E-F'', Figure 4—figure supplement 1 |
| Strain, strain background (C. elegans) | ral-1(tm5205); xnIs472[ral-1p::zf1::yfp::ral-1]; xnIs547;xnEx472[t28h11.8p::yfp::sl2::ifb-1::cfp, pRF4] | This study | FT1866 | Shown in Figure 1I-J'', Figure 2 |
| Strain, strain background (C. elegans) | pkc-3(xn84[zf1::gfp::pkc-3]); xnIs547; xnEx466 | This study | FT1942 | pkc-3(xn84) crossed to FT1837 Shown in Figure 2, Figure 4C-D'' |
| Strain, strain background (C. elegans) | cdc-42(xn65); par-6(cp60[par-6::mKate::3xMyc loxP unc-119(+) loxP]); xnEx481[hsp-16.41p::zif-1; t28h11.8p::yfp::sl2::ifb-1::cfp, pRF4] | This study | FT1945 | Shown in Figure 3G-H |
| Strain, strain background (C. elegans) | par-3(xn59); par-6(cp60); xnEx491[t28h11.8p::cfp, pRF4] | This study | FT2015 | Shown in Figure 6A-A',C,E |
| Strain, strain background (C. elegans) | par-6(xn60); par-3(it301); xnEx494[hsp-16.41p::zif-1; t28h11.8p::CFP, pRF4] | This study | FT2020 | Shown in Figure 6G-G',I,J, Figure 5—figure supplement 1 |
| Strain, strain background (C. elegans) | par-6(xn60); par-3(it301); xnEx496[t28h11.8p::CFP, pRF4] | This study | FT2022 | Shown in Figure 3E-F, Figure 6F-F',H,J |
| Strain, strain background (C. elegans) | par-3(xn59); par-6(cp60); xnEx501[hsp-16.41p::zif-1; t28h11.8p::CFP, pRF4] | This study | FT2027 | Shown in Figure 6B-B',D,E |
| Strain, strain background (C. elegans) | par-6(xn60); xnIs485[sec-10p::mCherry::sec-10]; xnEx508[hsp-16.41p::zif-1; t28h11.8p::CFP, pRF4] | This study | FT2061 | Shown in Figure 5C-C',E,F |
| Strain, strain background (C. elegans) | par-6(xn60); xnIs485; xnEx511[t28h11.8p::cfp, pRF4] | This study | FT2065 | Shown in Figure 5B-B',D,F |
| Strain, strain background (C. elegans) | par-3(xn59); xnIs485; xnEx514[t28h11.8p::cfp, pRF4] | This study | FT2069 | Shown in Figure 5G-G',I,K |
| Strain, strain background (C. elegans) | exc-5(xn108[exc-5::zf1::mScarlet]) | This study | FT2074 | See CRISPR knock-ins section in Materials and methods |
| Strain, strain background (C. elegans) | exc-5(xn108[exc-5::zf1::mScarlet]); pkc-3(it309[gfp::pkc-3]) | This study | FT2076 | FT2074 crossed to KK1228 |
| Strain, strain background (C. elegans) | exc-5(xn108); pkc-3(it309[gfp::pkc-3]); xnEx519[hsp-16.41p::zif-1; t28h11.8p::CFP, pRF4] | This study | FT2089 | Shown in Figure 7G-G',I,J |
| Strain, strain background (C. elegans) | exc-5(xn108); pkc-3(it309); xnEx523[t28h11.8p::cfp, pRF4] | This study | FT2093 | Shown in Figure 7F-F',H,J |
| Strain, strain background (C. elegans) | par-3(xn59); xnIs485; xnEx528[hsp-16.41p::zif-1; t28h11.8p::CFP, pRF4] | This study | FT2100 | Shown in Figure 5H-H',J,KH |
| Strain, strain background (C. elegans) | cdc-42(xn65); par-6(cp60); xnEx551[hsp-16.41p::zif-1; t28h11.8p::CFP, pRF4] | This study | FT2289 | Shown in Figure 7A-E |
| Strain, strain background (C. elegans) | par-3(it301) | Gift from K. Kemphues (Cornell University, Ithaca, NY) | KK1218 | |
| Strain, strain background (C. elegans) | pkc-3(it309) | Gift from K. Kemphues (Cornell University, Ithaca, NY) | KK1228 | |
| Strain, strain background (C. elegans) | par-6(cp60); par-3(cp54[mNeonGreen::3xFlag::par-3]) | Dickinson et al., 2017 | LP282 | |
| Recombinant DNA reagent | Peft-3::Cas9 + ttTi5605 sgRNA | Dickinson et al., 2013 | pDD122 | Cas9 + sgRNA plasmid that is targeted to a genomic site near the ttTi5605 Mos1 insertion allele. Addgene plasmid #47550 |
| Recombinant DNA reagent | t28h11.8p::mCherry | This study | pJA022 | See transgene construction section in Materials and methods |
| Recombinant DNA reagent | t28h11.8p::zif-1 | This study | pJA027 | See transgene construction section in Materials and methods |
| Recombinant DNA reagent | Peft-3::Cas9 + par-3 sgRNA 1 | sgRNA target sequence: GTACTGGGGAAAACGATGAGG | pJA029 | Cas9 + sgRNA targeting genomic site at par-3 locus. Derived from pDD122. |
| Recombinant DNA reagent | Peft-3::Cas9 + par-3 sgRNA 2 | sgRNA target sequence: GAAGCCTACGAGACACGTGG | pJA030 | Cas9 + sgRNA targeting genomic site at par-3 locus. Derived from pDD122. |
| Recombinant DNA reagent | Peft-3::Cas9 + par-6 sgRNA 1 | sgRNA target sequence: GCACCGCAGCCGCTACAGG | pJA031 | Cas9 + sgRNA targeting genomic site at par-6 locus. Derived from pDD122. Zilberman et al., 2017 |
| Recombinant DNA reagent | Peft-3::Cas9 + par-6 sgRNA 2 | sgRNA target sequence: GTCCACCTGTAGCGGCTGCGG | pJA032 | Cas9 + sgRNA targeting genomic site at par-6 locus. Derived from pDD122. Zilberman et al., 2017 |
| Recombinant DNA reagent | par-3::zf1::yfp + unc-119 | This study | pJA033 | Homologous repair plasmid for par-3 with ten silent point mutations adjacent to sgRNA cut sites |
| Recombinant DNA reagent | par-6::zf1::yfp + unc-119 | Zilberman et al., 2017 | pJA034 | Homologous repair plasmid for par-6 with six silent point mutations adjacent to sgRNA cut sites |
| Recombinant DNA reagent | zf1::yfp::cdc-42 + unc-119 | Zilberman et al., 2017 | pJA036 | Homologous repair plasmid for cdc-42 with five silent point mutations adjacent to sgRNA cut sites |
| Recombinant DNA reagent | Peft-3::Cas9 + cdc-42 sgRNA | sgRNA target sequence: GTCACAGTAATGATCGG | pJA037 | Cas9 + sgRNA targeting genomic site at cdc-42 locus. Derived from pDD122. Zilberman et al., 2017 |
| Recombinant DNA reagent | t28h11.8p::ifb-1::cfp | This study | pJA042 | See transgene construction section in Materials and methods |
| Recombinant DNA reagent | t28h11.8p::yfp::sl2::ifb-1::cfp | This study | pJA043 | See transgene construction section in Materials and methods |
| Recombinant DNA reagent | hsp-16.41p::zif-1 | This study | pJA045 | See transgene construction section in Materials and methods |
| Recombinant DNA reagent | t28h11.8p::cfp | This study | pJA050 | See transgene construction section in Materials and methods |
| Recombinant DNA reagent | zf1::yfp + unc-119 | Armenti et al., 2014b | pJN601 | Plasmid backbone used to generate pJA033. Addgene plasmid #59790. |
| Recombinant DNA reagent | pgp-12p::mCherry | Armenti et al., 2014b | pSA086 | Plasmid backbone used to generate pJA022 |
| Recombinant DNA reagent | hsp-16.41p::zif-1::sl2::mCherry | Armenti et al., 2014b | pSA120 | Plasmid backbone used to generate pJA045. Addgene plasmid #59789 |
| Recombinant DNA reagent | Peft-3::Cas9 + sec-5 sgRNA | sgRNA target sequence: gattatcggctgtgttgta | pSA121 | Cas9 + sgRNA targeting genomic site at sec-5 locus. Derived from pDD122. Armenti et al., 2014b |
| Recombinant DNA reagent | sec-5::zf1::yfp + unc-119 | Armenti et al., 2014b | pSA122 | Homologous repair plasmid for sec-5 with a silent point mutation in the sgRNA cut site |
| Sequence-based reagent | exc-5(xn108) crRNA | gaatcaTCATTCAGATTGCT | crRNA (IDT) target site used to target the exc-5 locus | |
| Sequence-based reagent | exc-5(xn108)_F | CGAATGTACACAATGACCGCTGAAGACGAACAAACCCAAATGAAATGGTTGGCGATTTTGGATTTAGCCGCAAACGCACATCTGAAGAATCAACGGAATTCTGGATCCGAACAGAGCGAACCGACAGAATACAAAACGCGAC | Forward primer for zf1::mScarlet dsDNA repair template with 120 bp homology arms. Includes five silent point mutations adjacent to predicted crRNA cut sites | |
| Sequence-based reagent | exc-5(xn108)_R | gaaaatttggatacagtttcaacgaacgaataataagaattgagagaaaaacaagaatagaacactgaaataactaagaaaataaacatatgtcttggctgggtgccaaaaaagaatcaTCACTTGTAGAGCTCGTCCATTCCTC | Reverse primer for zf1::mScarlet dsDNA repair template with 120 bp homology arms | |
| Sequence-based reagent | t28h11.8p_F | atgtgggcgtgaacaaaaa | Forward primer to amplify t28h11.8p from genomic DNA | |
| Sequence-based reagent | t28h11.8p_R | tccagttgaaattgaac | Reverse primer to amplify t28h11.8p from genomic DNA | |
| Sequence-based reagent | par-3(xn59) 5’ homology arm_F | ACTTCCGGATATGAGTCGTACGCCGACTCTGAGCTC | Forward primer to amplify par-3 5’ homology arm for Gibson cloning to generate pJA033 | |
| Sequence-based reagent | par-3(xn59) 5’ homology arm_R | AGAGATCAGGGACCGCCGCACCGATTCCCTCAGTAC | Reverse primer to amplify par-3 5’ homology arm for Gibson cloning to generate pJA033. Includes five silent point mutations adjacent to predicted crRNA (pJA029) cut sites shown as underlined base pairs | |
| Sequence-based reagent | par-3(xn59) 5’ homology arm | AACAAACTTCGGGGGAGAAGCCTATGAAACTCGAGGCGGAGGAGCCGGC | Forward + Reverse primer to generate five silent point mutations adjacent to predicted crRNA (pJA030) cut sites shown as underlined base pairs | |
| Sequence-based reagent | par-3(xn59) 3’ homology arm_F | gtcagttttttctcaaagttatattacgcagcc | Forward primer to amplify par-3 3’ homology arm for Gibson cloning to generate pJA033 | |
| Sequence-based reagent | par-3(xn59) 3’ homology arm_R | gttgatagtattgtggaacgagacaatcc | Reverse primer to amplify par-3 3’ homology arm for Gibson cloning to generate pJA033 | |
| Software, algorithm | Fiji | GitHub | RRID:SCR_002285 | https://fiji.sc/ |
| Software, algorithm | GraphPad Prism 8 | GraphPad | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
| Software, algorithm | Adobe Illustrator CC | Adobe Systems Inc | RRID:SCR_010279 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A polarity pathway for exocyst-dependent intracellular tube extension
eLife 10:e65169.
https://doi.org/10.7554/eLife.65169
