Egr2 induction in spiny projection neurons of the ventrolateral striatum contributes to cocaine place preference in mice
- The Edmond and Lily Safra Center for Brain Sciences, Israel
- Institute of Life Sciences, The Hebrew University of Jerusalem, Israel
- Program in Child and Brain Development, Canadian Institute for Advanced Research, MaRS Centre, Canada
Figures
Figure 1 with 4 supplements
Transcriptional profiling resolves the dynamics of cocaine-induced gene expression within major nodes of the reward circuitry.
(A) Scheme describing the cocaine sensitization paradigm and time points (0, 1, 2, 4 hr) at which samples were obtained for analysis of gene expression following acute (0 = cocaine naïve); repeated …
Figure 1—figure supplement 1
Boundaries of dissected brain structures.
Illustration of the brain tissue collected for RNA extraction and sequencing analysis. Red shaded boxes represent the area dissected from 400-micron coronal sections at specific rostral (+) or …
Figure 1—figure supplement 2
Quality control analysis of RNA-seq experiments.
(A) Histograms of mean usable read depth of 3′-RNA-seq libraries. n = 194 libraries. (B) Principal component analysis (PCA) demonstrates clustering of RNA-seq libraries according to brain region, …
Figure 1—figure supplement 3
Repeated cocaine administration and abstinence induce baseline shifts in gene transcription.
(A) Gene expression profiles of repeated cocaine treated and abstinent mice within different brain regions. Heatmaps reflect log2 (fold change) of genes demonstrating differential expression between …
Figure 1—figure supplement 4
Repeated cocaine exposure and abstinence alters the expression of gene clusters related to neuroplasticity.
Heatmaps depict the expression levels of genes which are modulated between naïve mice and mice following repeated cocaine or abstinence in different brain regions clustered according to GO terms …
Figure 2 with 2 supplements
Dynamic IEG induction in subregions of the striatum accompany the development of cocaine sensitization.
(A) Scheme of a coronal section of the dorsal striatum (DS) (+0.52 ± 0.1 mm from Bregma) corresponding to the region assayed by multicolor smFISH for cocaine-induced IEG expression. (B) …
Figure 2—figure supplement 1
Cocaine dynamically modulates cellular IEG expression in the VLS and MS.
(A) Dot plot of the fraction of cells positive for expression of Arc and Nr4a1 in the VLS and MS (threshold: Arc = 11, Nr4a1 = 12 puncta/cell) following acute, repeated, and challenge cocaine …
Figure 2—figure supplement 2
Coherence of cocaine-induced IEG expression.
(A) Arc, Egr2, and Nr4a1 are coherently induced in cells of the VLS and MS. Coherence refers to the correlated co-expression of multiple IEGs within individual cells. Each dot depicts the expression …
Figure 3 with 4 supplements
Induction of Egr2 in VLS neurons contributes to the acquisition of cocaine reward.
(A) Representative 40× images showing Egr2 expression within Drd1+ and Drd2+ SPNs in the VLS (left) and MS (right) following acute, repeated, and challenge cocaine exposures compared to controls. (B,…
Figure 3—figure supplement 1
Induced IEGs are correlated to Drd1 expression in the VLS and to both Drd1 and Drd2 expressions in the MS.
(A) Egr2 induction in the MS does not exhibit prominent cell-type bias and is modestly affected by the history of cocaine experience. Scatter plots show cellular Egr2 expression with Drd1 or Drd2 …
Figure 3—figure supplement 2
Drd1 and Drd2 receptor expression in the VLS and MS.
(A) Dot plots depicting the fraction of Drd1 vs Drd2 expressing cells in the VLS and MS in control (gray) and cocaine (red) conditions following distinct cocaine experiences. n = 6 sections from …
Figure 3—figure supplement 3
DREADD inhibition of VLS Egr2+ cells does not affect locomotion.
(A, B) Verification of AAV transduction in the VLS of transgenic Egr2-CRE mice tested in experiment depicted in Figure 3F-G. Example of AAV-DIO-hM4Di-mcherry infections in the VLS (A) and summary of …
Figure 3—figure supplement 4
Disruption of Egr2 function in the VLS does not affect locomotor behavior or IEG expression outside of VLS.
(A, B) Verification of AAV-GFP and AAV-DNEgr2 infection in the VLS. Example of AAV-DNEgr2 infection in the VLS (A). (B) Summary of infection from individual mice of VLSDNEgr2 and VLSGFP groups …
Author response image 1
Efficacy and efficiency of transduction of hM4Di infection of CLEgr2+ neurons.
(A) Representative traces of whole-cell current clamp recordings from CLEgr2+ neurons expressing the hM4Di DREADD, in the presence or absence of CNO (clozapine-N-oxide; 1 μM). 50-250 pA current …
Author response image 2
hM4Di-CNO inhibits cocaine-induced Fos induction in Egr2+ claustral neurons.
The claustrum of Egr2-CRE mice was transduced with AAV viruses conditionally expressing hM4Di. 3 weeks later, following habituation to ip saline injections, mice were injected (i.p. 10mg/kg) with …
Author response image 3
hM4Di-CNO inhibits cocaine-induced Fos induction in VLS Drd1+-neurons.
The VLS of Drd1+-CRE mice was transduced with AAV viruses conditionally expressing hM4Di (red). Following habituation to ip saline injections, mice were injected with CNO (i.p. 10 mg/kg), and 30 …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | Wild-type C57BL/6OLAHSD mice | The Harlan Laboratory | NA | |
| Strain, strain background (Mus musculus) | Egr2-Cre knock in mice | The Jackson Laboratory | Cat# 025744 RRID: IMSR_JAX:025744 | |
| Recombinant DNA reagent | AAV2-hSyn-DIO-hM4d(Gi)- mCherry | Addgene | Cat# 44362-AAV2 RRID: Addgene_44362 | 1.15 dilution |
| Recombinant DNA reagent | AAV2-hSyn-DIO-mCherry | UNC vector core facility | N/A | 1.15 dilution |
| Recombinant DNA reagent | AAVdj-CMV-eGFP | ELSC vector core facility | N/A | 1.15 dilution |
| Recombinant DNA reagent | AAVdj-CAG-DNEgr2-IRES-GFP | ELSC vector core facility | N/A | 1.15 dilution |
| Recombinant DNA reagent | Plasmid with dominant negative mutant Egr2 (S382R,D383Y) | Jeffrey Milbrant, Washington University | N/A | |
| Chemical compound, drug | Clozapine-N-oxide (CNO) | Sigma–Aldrich | Cat # C0832-5MG | |
| Chemical compound, drug | Cocaine | Hadassah Hospital Pharmacy | N/A | |
| Commercial assay, kit | Fluorescent Multiplex Reagent Kit | Advanced Cell Diagnostics RNAscope | Cat # 320850 | |
| Commercial assay, kit | NEBNext Ultra II Non-Directional RNA Second-Strand Synthesis Module | New England Biolabs | Cat # E6111L | |
| Commercial assay, kit | KAPA Hifi Hotstart ReadyMix | Roche | Cat # KK-KK2601-2 07958927001 | |
| Commercial assay, kit | MinElute Gel Extraction Kit | Qiagen | Cat # 28604 | |
| Commercial assay, kit | NEBNext Library Quant Kit for Illumina | New England Biolabs | Cat # E7630L | |
| Commercial assay, kit | High-sensitivity DNA kit | Agilent Technologies | Cat # 5067–4626 | |
| Commercial assay, kit | NextSeq 500 High Output V2 kits | Illumina | Cat # FC-404–2005 | |
| Commercial assay, kit | SMARTScribe Reverse Transcriptase | Takara | Cat # 639536 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Drd1a-C2 | Advanced Cell Diagnostics RNAscope | Cat # 406491-C2 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Drd1a-C3 | Advanced Cell Diagnostics RNAscope | Cat # 406491-C3 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Drd2-C2 | Advanced Cell Diagnostics RNAscope | Cat # 406501-C2 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Egr2 | Advanced Cell Diagnostics RNAscope | Cat # 407871 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Fos-C3 | Advanced Cell Diagnostics RNAscope | Cat # 316921-C3 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Arc-C3 | Advanced Cell Diagnostics RNAscope | Cat # 316911-C3 | |
| Sequence-based reagent (smFISH) | Probe-Mm-Nr4a1-C2 | Advanced Cell Diagnostics RNAscope | Cat # 423341-C2 | |
| Sequence-based reagent (RNA-seq) | Primers for first-strand synthesis | This paper | N/A | CGATTGAGGCCGGTAATACGACTCACTATAGGGGCGACGTGTGCTCTTCCGATCTNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTN |
| Sequence-based reagent (RNA-seq) | Forward primer with P5-Read1 sequence | This paper | NA | AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTG |
| Sequence-based reagent (RNA-seq) | Reverse primer with P7-Read2 sequence | This paper | NA | CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
| Software, algorithm | R | R studio | https://rstudio.com/products/rstudio/ | |
| Software, algorithm | ImageJ | National Institutes of Health | https://imagej.nih.gov/ij/ RRID:SCR_003070 | |
| Software, algorithm | CellProfiler | Broad Institute | https://cellprofiler.org/ RRID:SCR_007358 | |
| Software, algorithm | Prism7 | GraphPad | https://www.graphpad.com RRID:SCR_002798 | |
| Software, algorithm | Ethovision XT | Noldus | https://www.noldus.com/ethovision-xt RRID:SCR_000441 | |
| Software, algorithm | Photoshop and Illustrator | Adobe | https://www.adobe.com/in/creativecloud/catalog/desktop.html?promoid=PTYTQ77P&mv=other | |
| Other | 0.9% Nacl | Cat # 3642828 | ||
| Other | Isoflurane | Piramal Critical Care | Cat # AWN34014604 | |
| Other | Microtome (7000 smz2) | Camden Instruments | https://www.emsdiasum.com/microscopy/products/equipment/vibrating_microtome.aspx | |
| Other | Stereoscope | Olympus | Cat # N1197800 | |
| Other | TissueLyser LT | Qiagen | Cat # 69980 | |
| Other | Superfrost Plus slides | ThermoFisher Scientific | Cat # J1800AMNZ | |
| Other | Hermes high-definition cell-imaging system | Wiscan | https://idea-bio.com/products/wiscan-hermes/ | |
| Other | SomnoSuite Low-Flow Anesthesia System | Kent Scientific Corporation | https://www.kentscientific.com/products/somnosuite/ | |
| Other | Fine drill burr | RWD Life Science | Cat # 78001 | |
| Other | Microsyringe (33G) | Hamilton | Cat # 65460–05 | |
| Other | 3M Vetbond tissue Adhesive | 3M (Ebay) | Cat # 8017242664 | |
| Other | Isoflurane | Piramal Critical Care | Cat # AWN34014604 | |
| Other | Tri-Reagent | Sigma–Aldrich | Cat # T9424 | |
| Other | OCT embedding medium | Scigen Scientific Gardena | Cat # 23-730-625 | |
| Other | ACD RNAscope fresh frozen tissue pretreatment | Advanced Cell Diagnostics RNAscope | Cat # 320513 | |
| Other | DAPI | Sigma–Aldrich | Cat # 10236276001 | |
| Other | Lab Vision PermaFluor Aqueous Mounting Medium | ThermoFisher Scientific | Cat # TA-030-FM | |
| Other | dNTPs | New England Biolabs | Cat # N0447s | |
| Other | MnCl2 | Sigma–Aldrich | Cat # 244589–10G | |
| Other | SPRI magnetic beads | Beckman Coulter | Cat # A63881 | |
| Other | 1 M Tris–HCI, pH 8.0 | ThermoFisher Scientific | Cat # 15568025 | |
| Other | SDS Solution (10%) | Biological Industries | Cat # 01-890-1B |
Additional files
-
Supplementary file 1
Distribution of sequencing libraries analyzed in this study.
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp1-v2.xlsx
-
Supplementary file 2
Normalized reads of baseline shifted genes (tabs corresponding to individual structures).
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp2-v2.xlsx
-
Supplementary file 3
Clusters of Gene Ontology (GO) analysis and corresponding genes.
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp3-v2.xlsx
-
Supplementary file 4
Normalized reads of induced genes (tabs correspond to structures).
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp4-v2.xlsx
-
Supplementary file 5
Gene Ontology annotation of cocaine-induced genes in the dorsal striatum.
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp5-v2.xlsx
-
Supplementary file 6
Statistical analysis.
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp6-v2.xlsx
-
Supplementary file 7
Distribution of cell numbers among replicates in smFISH analysis.
- https://cdn.elifesciences.org/articles/65228/elife-65228-supp7-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/65228/elife-65228-transrepform-v2.docx
