Uncovering an allosteric mode of action for a selective inhibitor of human Bloom syndrome protein
- Cancer Research UK DNA Repair Enzymes Group, Genome Damage and Stability Centre, School of Life Sciences, University of Sussex, United Kingdom
- Bioinformatics Lab, School of Life Sciences, University of Sussex, United Kingdom
- Sussex Drug Discovery Centre, School of Life Sciences, University of Sussex, United Kingdom
- School of Life Sciences, University of Sussex, United Kingdom
- Medicines Discovery Institute, Park Place, Cardiff University, United Kingdom
Figures
Figure 1 with 2 supplements
Inhibition of BLM helicase unwinding activity.
(A, left) Chemical drawings for compounds 1, 2, and ML216. (A, right) Dose response curves from fluorescence-based DNA unwinding assays with BLM-HD. Experimental data were fitted with a four …
Figure 1—figure supplement 1
Assay data for compunds 3 to 7.
(Top) Chemical drawings for compounds 3 to 7. (Middle) Dose response curves from fluorescence-based DNA unwinding assays with BLM-HD. Data points are the mean of three technical replicates with …
Figure 1—figure supplement 2
Indicative binding isotherms for titrations of Mg-ADP and Mg-ATPγS into BLM-HD as measured by MST.
Fitted lines are intended as visual aids only, as the data only represent values from a single preliminary experiment.
Figure 2 with 1 supplement
DNA interaction assays.
(A) Titration of BLM-HD with 2 prevents the unwinding of a forked-50mer dsDNA substrate into its component strands, as judged by native gel electrophoresis. (B) Quantification of inhibitory activity …
Figure 2—figure supplement 1
Dose response curves from fluorescence-based DNA unwinding assays with BLM-HD, carried out at two different ATP concentrations.
Experimental data were fitted with a four parameter, log(inhibitor) vs. response model with variable slope. Calculated values for IC50, Hill slope (nH) and 95% confidence intervals (95% CI) are …
Figure 3 with 3 supplements
Structural overview of BLM-HDΔWHD in complex with compound 2.
(A) Schematic representation of the domain composition and respective amino acid boundaries for full-length human BLM and the two expression constructs used in this study BLM-HD and BLM-HDΔWHD. D1 …
Figure 3—figure supplement 1
Superposition of the structures of BLM-HD (PDB: 4CDG) and BLM-HDΔWHD using PyMOL (Schrödinger, 2020).
Values for rmsd in Angstrom are shown, calculated over the indicated number of equivalent atoms. See associated key for details of colour scheme.
Figure 3—figure supplement 2
Isotherms for binding of BLM-HDΔWHD to (top) ssDNA-15mer and (bottom) compound 2 in the presence of ssDNA-15mer, as determined by MST.
Values for Kd and 95% CI are given in each case. For all plots, data represent the mean of three technical replicates with error bars representing 1 SD.
Figure 3—figure supplement 3
Schematic summary of DNA-interactions made within the crystal lattice of the liganded complex (BLM-HDΔWHD + Mg-ADP + ssDNA-15mer + compound 2).
Interaction network determined through by the PDBsum Generate webserver (PDBsum, 2021). Green solid lines represent hydrophobic / stacking interactions. Black dotted lines represent potential …
Figure 4 with 3 supplements
Structural transitions around the aromatic rich loop.
(A) Molecular secondary structure cartoons for the region surrounding the aromatic rich loop (ARL) of BLM-HDΔWHD (top), PDB entry 4CGZ; BLM-HD in complex with DNA (middle) and liganded complex; …
Figure 4—figure supplement 1
Molecular secondary structure cartoons showing selected amino acid side chains of the aromatic-rich loop (ARL) region in PDB entries 4CDG and 4CGZ (BLM-HD) and 4TMU (Cronobacter sakazakii RecQ) to that reported here for liganded-BLM-HDΔWHD.
Amino acid numbering is provided for the start and end of the region compared, with the identity of key residues also provided.
Figure 4—figure supplement 2
Superposition of the ARL in liganded-BLM-HDΔWHD (coloured orange) with those found in PDB entries 4TMU (cyan) and 6CRM (Voter et al., 2018) (grey); which both represent structures of the catalytic core of C. sakazakii RecQ in complex with different DNA substrates.
Figure 4—figure supplement 3
Molecular cartoon representations of the helicase catalytic cores reported in PDB entries 4CGZ, 4O3M, and 4TMU, highlighting their respective interactions with bound DNA substrates and comparing this to liganded BLM-HDΔWHD.
Additional details for the colour scheme can be found in the associated key. The distance between the C-alpha positions of Ser729 and Asn936 is also shown, highlighting a widening of the pocket in …
Figure 5
Repositioning of the HRDC domain.
(A) Molecular surface representation of BLM-HDΔWHD (left) and the liganded complex (right) highlighting the relative positions of the HRDC domain (cylindrical helices coloured in pink). The HRDC …
Figure 6 with 1 supplement
Selectivity profile of compound 2.
(A) Dose response curves from ATP-turnover assays for titration of compounds 2 and ML216 against purified recombinant BLM-HD, WRN-HD, RecQ1-HD, RecQ5-HD and UvrD respectively. Calculated values for …
Figure 6—figure supplement 1
The active site of the liganded complex is compatible with binding of ATP, as judged by superposition of PDB entry 1OYY (E. coli RecQ in complex with ATP-γS Bernstein et al., 2003).
Only a small movement of Thr691 would be necessary to accommodate the gamma phosphate group (as indicated by the dotted line / arrowhead). Only the D1 domain of each protein is shown in order to …
Figure 7
Compound selectivity/speculative model.
(A) The observed selectivity of compound 2 appears to arise from interactions made with amino acids of the Zn-binding domain ‘Helical Hairpin’ that are poorly conserved (or absent) from the other …
Tables
Table 1
Summary of inhibition data for seven exemplars from the identified compound series.
IC50 values were determined by fitting of experimental data to log (inhibitor) vs response models provided in GraphPad Prism. Data for the unwinding assay correspond to three technical replicates …
| unwinding | turnover | ||
|---|---|---|---|
| # | Chemical drawing | IC50 [95% CI]; µM | IC50 [95% CI]; µM |
| 2 |  | 2.2 [1.7–2.7] | 3.2 [2.3–4.0] |
| 3 |  | 3.5 [2.4–5.2] | 5.3 [4.7–6.1] |
| 4 |  | 6.6 [3.4–12.7] | 11.2 [8.3–15.3] |
| 5 |  | 12.8 [4.5–36.8] | 47.86 [18.28–180.7] |
| 6 |  | 56.9 [25.4–171.3] | 40.94 [15.9–139.8] |
| 7 |  | No inhibition | No inhibition |
| ML216 |  | 4.0 [3.7–4.3] | 4.4 [4.0–4.8] |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | BLM | UniProt | P54132 | BLM_HUMAN |
| Gene (Homo sapiens) | RECQL | UniProt | P46063 | RECQ1_HUMAN |
| Gene (Homo sapiens) | WRN | UniProt | Q14191 | WRN_HUMAN |
| Gene (Homo sapiens) | RECQL5 | UniProt | O94762 | RECQ5_HUMAN |
| Gene (Escherichia coli) | uvrD | UniProt | P03018 | UVRD_ECOLI |
| Strain (Escherichia coli) | BL21(DE3) | New England Biolabs | C2527I | Competent Cells |
| Sequence-based reagent | ssDNA-15mer | This paper | CGTACCCGATGTGTT | |
| Sequence-based reagent | ssDNA-20mer | This paper | CGTACCCGATGTGTTCGTTC | |
| Sequence-based reagent | Forked-50mer: FORK A | This paper | XGAACGAACACATCGGGTACG TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT X = Black Hole Quencher 2 or none | |
| Sequence-based reagent | Forked-50mer: FORK B | This paper | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT CGTACCCGATGTGTTCGTTCY Y = Tetramethylrhodamine or none | |
| Recombinant DNA reagent | pET-17b | Novagen Merck Millipore | 69663 | |
| Recombinant DNA reagent | pNIC28-Bsa4 | Addgene | 26103 | |
| Chemical compound, drug | ML216 | Merck KGaA Caymen Chemical | SML0661 15186 | |
| Commercial assay or kit | PiColorLock Gold Phosphate Detection System | Novus Biologicals | 303–0030 | |
| Commercial assay or kit | DNA Unwinding Assay Kit | Inspiralis | DUKSR001 | |
| Software, algorithm | BUSTER | Global Phasing | RRID:SCR_015653 | |
| Software, algorithm | CCP4 | CCP4 | RRID:SCR_007255 | |
| Software, algorithm | Coot | Coot | RRID:SCR_014222 | |
| Software, algorithm | Fiji | Fiji | RRID:SCR_002285 | |
| Software, algorithm | Phaser | Phaser | RRID:SCR_014219 | |
| Software, algorithm | PHENIX | PHENIX | RRID:SCR_014224S | |
| Software, algorithm | Prism | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | XDS | XDS | RRID:SCR_015652 |
Appendix 1—table 1
Statistics for data collection, phasing and refinement.
| BLM-HDΔWHD + ADP | Liganded-BLM-HDΔWHD | |
|---|---|---|
| Data collection | ||
| Space group | P21 | P1 |
| Cell dimensions | ||
| a, b, c (Å) | 54.28, 107.69, 55.20 | 84.69, 111.60, 132.38 |
| α, β, γ (°) | 90.00, 109.31, 90.00 | 72.70, 80.13, 79.24 |
| Wavelength | 0.9780 | 0.9762 |
| Resolution (Å) | 51.23–1.53 (1.56–1.53) | 125.37–2.97 (3.08–2.97) |
| Mn I / σI | 12.7 (1.2) | 7.8 (1.4) |
| Mn I, CC1/2 | 1.00 (0.61) | 0.99 (0.57) |
| Completeness (%) | 98.3 (90.3) | 98.0 (94.5) |
| Redundancy | 1.9 (1.7) | 2.6 (2.7) |
| Refinement | ||
| Resolution (Å) | 51.23–1.53 (1.56–1.53) | 47.28–2.97 (3.07–2.96) |
| No. unique reflections | 88464 (8096) | 91661 (8892) |
| Rwork / Rfree | 0.19/0.21 | 0.23/0.27 |
| No. atoms | ||
| Macromolecules | 3870 | 24954 |
| Ligands | 65 | 427 |
| Solvent | 438 | 91 |
| B-factors | ||
| Wilson | 32.58 | 77.77 |
| ADP (mean) | ||
| Macromolecules | 31.00 | 95.79 |
| Ligands | 40.89 | 98.56 |
| Solvent | 45.69 | 53.65 |
| R.m.s. deviations | ||
| Bond lengths (Å) | 0.014 | 0.006 |
| Bond angles (°) | 1.64 | 1.11 |
| Molprobity | ||
| All atom clashscore | 2.44 | 7.42 |
| Ramachandran | ||
| Outliers | 0.21% | 0.42% |
| Allowed | 1.65% | 3.72% |
| Favoured | 98.15% | 95.85% |
-
*Values in parentheses are for the highest resolution shell
