RNF43 inhibits WNT5A-driven signaling and suppresses melanoma invasion and resistance to the targeted therapy
- Department of Experimental Biology, Faculty of Science, Masaryk University, Czech Republic
- Department of Cytokinetics, Institute of Biophysics CAS, Czech Republic
- International Clinical Research Center FNUSA-ICRC, Czech Republic
- Laboratory of Molecular Oncology, Cancer Research Institute, Biomedical Research Center of the Slovak Academy of Sciences, Slovakia
- Department of Histology and Embryology, Faculty of Medicine, Masaryk University, Czech Republic
- Central European Institute of Technology, Masaryk University, Czech Republic
Figures
Figure 1
RNF43 interactome is enriched with the Wnt planar cell polarity pathway components.
(A) Western blot analysis of T-REx 293 wild type (WT) and WNT5A KO cells. Phosphorylation-dependent shifts of endogenous ROR1, DVL2, and DVL3 were suppressed upon WNT5A loss (TCL: total cell lysate; …
-
Figure 1—source data 1
BioID RNF43 interactors.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig1-data1-v1.xlsx
-
Figure 1—source data 2
gProfiler GO terms analysis.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig1-data2-v1.xlsx
Figure 2 with 1 supplement
RNF43 interacts with Wnt/planar cell polarity (PCP) components.
(A) RNF43 interacts with VANGL2, but not with its mutants lacking N- or C-termini. VANGL2-EGFP and its variants (schematized) were overexpressed with RNF43-HA in Hek293 T-REx cells, …
-
Figure 2—source data 1
RNF43 interacts with Wnt/planar cell polarity (PCP) components.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
RNF43 interacts with Wnt/planar cell polarity (PCP) components.
A. RNF43 interacts with VANGL1. VANGL1-Myc was co-immunoprecipitated in the HA pull-down, prepared from lysate of Hek293 T-REx cells transiently overexpressing RNF43-HA and VANGL1-Myc, but not from …
-
Figure 2—figure supplement 1—source data 1
RNF43 interacts with Wnt/planar cell polarity (PCP) components.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig2-figsupp1-data1-v1.xlsx
Figure 3 with 3 supplements
Mechanism of Wnt/planar cell polarity (PCP) inhibition by RNF43.
(A) Hek293 T-REx cells were transfected with plasmid encoding His-tagged ubiquitin, VANGL2-GFP and HA-tagged wild-type or Mut1 RNF43 constructs. Ubiquitinated proteins were enriched by His pull down …
-
Figure 3—source data 1
Mechanism of Wnt/planar cell polarity (PCP) inhibition by RNF43.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Mechanism of Wnt/planar cell polarity (PCP) inhibition by RNF43.
(A) DVL1 and DVL2 are ubiquitinylated by the E3 ubiquitin ligase RNF43, but not by its enzymatically inactive mutant (RNF43Mut1). Hek293 T-REx cells were transfected with plasmid encoding His-tagged …
-
Figure 3—figure supplement 1—source data 1
Mechanism of Wnt/planar cell polarity (PCP) inhibition by RNF43.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig3-figsupp1-data1-v1.xlsx
Figure 3—figure supplement 2
Mechanism of Wnt/planar cell polarity (PCP) inhibition by RNF43.
(A) Tetracycline-induced RNF43 (anti-HA, green) co-localized with transiently expressed lysosomal marker (Lamp1-mCherry, red). TO-PRO-3 Iodide was used to stain nuclei (blue). Scale bar: 25 μm. (B) …
Figure 3—figure supplement 3
Mechanism of Wnt/planar cell polarity (PCP) inhibition by RNF43.
(A, B) Confocal imaging of the inducible T-REx RNF43/ZNRF3 dKO (A) and T-REx WT RNF43 TetON (B) and transfected with plasmids encoding ROR1-V5 (anti-V5, magenta) and RAB11-GFP-HA (GFP, green). 24 hr …
Figure 4 with 3 supplements
RNF43 in melanoma.
(A, B) RNF43 expression is lower in melanoma when compared with the skin and benign melanocytic skin nevus (A) and in the case of distant metastasis compared to the primary tumors (B), unpaired …
-
Figure 4—source data 1
RNF43 in melanoma.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
RNF43 in melanoma.
(A) ZNRF3 gene expression has no impact on melanoma patients’ survival (logrank p-value=0.897). (B) DVL3 expression level is elevated in human melanoma, unpaired two-tailed t-test, *p=0,0159, ****p<0…
-
Figure 4—figure supplement 1—source data 1
RNF43 in melanoma.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig4-figsupp1-data1-v1.xlsx
Figure 4—figure supplement 2
RNF43 in melanoma.
(A–D) RT-qPCR results – expression of the WNT5A (A), RNF43 (B), ZNRF3 (C), and ROR1 (D) genes was analyzed in the tested melanoma cells and presented as 2−ΔΔCt ± SD, two-tailed t-test: *p<0.05, **p<0…
-
Figure 4—figure supplement 2—source data 1
RNF43 in melanoma.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig4-figsupp2-data1-v1.xlsx
Figure 4—figure supplement 3
RNF43 in melanoma.
(A-A’’, B-B’’) Effects of the inducible RNF43 overexpression in RAS-mutant MelJuso (A) and BRAF V600E A375 (B) cells. Exogenous RNF43 expression blocked response to the 40 and 80 ng/ml 3 hr-long …
-
Figure 4—figure supplement 3—source data 1
RNF43 in melanoma.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig4-figsupp3-data1-v1.xlsx
Figure 5 with 4 supplements
RNF43 inhibits WNT5A-dependent invasive properties of human melanoma.
(A–E) RNF43 reduced migration of A375 (B), A375 RNF43 TetON (C), A375 IV (D), and A2058 RNF43 TetON (E) in the wound healing assay. Wound was photographed 48 hr after scratch and presented as % of …
-
Figure 5—source data 1
RNF43 inhibits WNT5A-dependent invasive properties of human melanoma.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
RNF43 inhibits Wnt5a-dependent invasive properties of human melanoma.
(A) Wound healing experiment – representative photos at the experimental end point (data Figure 5B–E). (B) Collagen I hydrogel chemotaxis assay A375 cell line results. After 24 hr, cells did not …
-
Figure 5—figure supplement 1—source data 1
RNF43 inhibits Wnt5a-dependent invasive properties of human melanoma.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig5-figsupp1-data1-v1.xlsx
Figure 5—figure supplement 2
RNF43 inhibits Wnt5a-dependent invasive properties of human melanoma.
Confocal imaging of A375, A375 IV, and RNF43 overexpressing and RNF43/ZNRF3 double knockout cell lines modifications. Cells were paraformaldehyde fixed, Triton X-100 permeabilized and stained for …
Figure 5—figure supplement 3
RNF43 inhibits Wnt5a-dependent invasive properties of human melanoma.
Confocal imaging of gelatin degradation assay without (Figure 5—figure supplement 3) and after (Figure 5—figure supplement 4) rhWNT5A treatment. Serum-starved cells were plated onto gelatin-Oregon …
Figure 5—figure supplement 4
RNF43 inhibits Wnt5a-dependent invasive properties of human melanoma.
Confocal imaging of gelatin degradation assay after rhWNT5A treatment. Serum-starved cells were plated onto gelatin-Oregon Green (green)-coated coverslips and incubated for 24 hr. Fixed cells were …
Figure 6 with 1 supplement
RNF43-overexpressing melanoma cells do not develop resistance to BRAF V600E targeted therapies.
(A) Scheme showing the experimental model used for the analysis of vemurafenib resistance (VR) acquisition. Melanoma cells are exposed to the increasing doses of the BRAF V600E inhibitor vemurafenib …
-
Figure 6—source data 1
RNF43-overexpressing melanoma cells do not develop resistance to BRAF V600E targeted therapies.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
RNF43-overexpressing melanoma cells do not develop resistance to BRAF V600E targeted therapies.
(A, B) Protein levels of ROR1 (A) and ROR2 (B) (western blot shown in Figure 6B) were quantified using ImageJ software, two-tailed t-test: *p<0.05, **p<0.01; N = 3. Expression ROR1 (A′) and ROR2 (B′)…
-
Figure 6—figure supplement 1—source data 1
RNF43-overexpressing melanoma cells do not develop resistance to BRAF V600E targeted therapies.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig6-figsupp1-data1-v1.xlsx
Figure 7 with 1 supplement
RNF43 inhibits melanoma proliferation and response to vemurafenib in vivo.
(A) RT-qPCR results – expression of the RNF43 gene in control (RNF43 low) and A375 RNF43 TetON cells in the absence (RNF43 mid) and presence of doxycycline (RNF43 high). Results are presented as 2−ΔΔ…
-
Figure 7—source data 1
RNF43 inhibits melanoma proliferation and response to vemurafenib in vivo.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig7-data1-v1.xlsx
Figure 7—figure supplement 1
RNF43 inhibits melanoma proliferation and response to vemurafenib in vivo.
(A) Vemurafenib formulations test for the in vivo application. Vemurafenib 2.5 mg/ml was prepared in aqueous solutions of 1% carboxymethyl cellulose (CMC), 10, 20, and 25% Kolliphor. DMSO was used …
-
Figure 7—figure supplement 1—source data 1
RNF43 inhibits melanoma proliferation and response to vemurafenib in vivo.
- https://cdn.elifesciences.org/articles/65759/elife-65759-fig7-figsupp1-data1-v1.xlsx
Figure 8
RNF43 inhibits WNT5A-driven signaling and suppresses melanoma invasion and resistance to the targeted therapy.
Graphical summary. RNF43 is an inhibitor of the noncanonical WNT5A-induced pathway. RNF43 interacts with receptor complexes of the Wnt/PCP signaling and its enzymatic activity results in the reduced …
Tables
Table 1
Cloning and mutagenesis primers.
| Primer | Sequence | Purpose |
|---|---|---|
| RNF43 BirA*F | ATGCAGTTAACATGAGTGGTGGCCACCAGCTG | RNF43 cDNA cloning into pcDNA3.1 MCS-BirA(R118G)-HA |
| RNF43 BirA*R | ATGCAGAATTCCACAGCCTGTTCACACAGCTCCT | |
| RNF43 InFusion F | GTTTAAACTTAAGCTTATGAGTGGTGGCCACCAG | RNF43-BirA(R118G)-HA into pcDNA4 |
| RNF43 InFusion R | AAACGGGCCCTCTAGACTATGCGTAATCCGGTACA | |
| RNF43-HA F | TTAAAGCTTATGAGTGGTGGCCACCAG | RNF43-HA cloning into pcDNA3 |
| RNF43-HA R | ATCGATATCTCAAGCGTAATCTGGAACATCGTATGGGTACACAGCCTGTTCACACAGCT | |
| pCW57-RNF43 InFusion F | ATTGGCTAGCGAATTATGAGTGGTGGCCACCAGC | pCW57-RNF43 generation |
| pCW57-RNF43 InFusion R | CGGTGTCGACGAATTTCAGGCGTAGTCGGGCACG |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | NOD-Rag1null IL2rgnull | Jackson Laboratory | RRID:BCBC_1261 | 9-week-old males |
| Cell line (Homo sapiens) | T-REx 293 | Thermo Fisher Scientific | R71007; RRID:CVCL_D585 | For TetON system using pcDNA4-TO backbone |
| Cell line (Homo sapiens) | T-REx 293 RNF43 TetON | This publication | Cells inducibly overexpressing RNF43 | |
| Cell line (Homo sapiens) | T-REx 293 RNF43 Mut1 TetON | This publication | Cells inducibly overexpressing inactive RNF43 | |
| Cell line (Homo sapiens) | T-REx 293 RNF43/ZNRF3 dKO | This publication | Cells lacking RNF43/ZNRF3; CRISPR/Cas9 | |
| Cell line (Homo sapiens) | T-REx 293 RNF43/ZNRF3 dKO RNF43 TetON | This publication | RNF43/ZNRF3 dKO inducibly overexpressing RNF43 | |
| Cell line (Homo sapiens) | T-REx 293 DVL1/2/3 tKO | Paclíková et al., 2017 | Cells lacking all DVL isoforms; CRISPR/Cas9 | |
| Cell line (Homo sapiens) | T-REx 293 WNT5A/B KO | This publication | Cells lacking WNT5A/B isoforms; CRISPR/Cas9 | |
| Cell line (Homo sapiens) | T-REx 293 ROR1 KO | This publication | Cells lacking ROR1; CRISPR/Cas9 | |
| Cell line (Homo sapiens) | A375 (amelanotic malignant melanoma) | Kucerova et al., 2014 | RRID:CVCL_0132 | BRAF V600E; GFP constitutive expression |
| Cell line (Homo sapiens) | A375 RNF43/ZNRF3 dKO | This publication | Cells lacking RNF43/ZNRF3; CRISPR/Cas9 | |
| Cell line (Homo sapiens) | A375+ RNF43 | This publication | Stable overexpression of RNF43 | |
| Cell line (Homo sapiens) | A375 RNF43 TetON | This publication | Cells inducibly overexpressing RNF43 | |
| Cell line (Homo sapiens) | A375 TetON ctrl | This publication | Control cells for A375 RNF43 TetON | |
| Cell line (Homo sapiens) | A375 IV (amelanotic malignant melanoma) | Kucerova et al., 2014 | BRAF V600E; GFP constitutive expression | |
| Cell line (Homo sapiens) | A375 IV RNF43/ZNRF3 dKO | This publication | Cells lacking RNF43/ZNRF3; CRISPR/Cas9 | |
| Cell line (Homo sapiens) | A375 IV + RNF43 | This publication | Stable overexpression of RNF43 | |
| Cell line (Homo sapiens) | A2058 (metastatic melanoma) | ECACC | 91100402; RRID:CVCL_1059 | BRAF V600E |
| Cell line (Homo sapiens) | A2058 RNF43 TetON | This publication | Cells inducibly overexpressing RNF43 | |
| Cell line (Homo sapiens) | MelJuso | Laboratory of Stjepan Uldrijan | RRID:CVCL_1403 | NRASQ61L/WT HRASG13D/G13D |
| Cell line (Homo sapiens) | MelJuso RNF43 TetON | This publication | Cells inducibly overexpressing RNF43 | |
| Peptide, recombinant protein | Recombinant human R-Sponidin-1 | PeproTech | 120-38 | Final concentration 50 ng/ml |
| Peptide, recombinant protein | Recombinant human WNT3A | R&D Systems | 5036-WN | Range 40–80 ng/ml |
| Peptide, recombinant protein | Recombinant human WNT5A | R&D Systems | 645-WN | Range 40–80 ng/ml |
| Chemical compound, drug | LGK-974, Porcupine inhibitor | PeproTech | 1241454 | 1 μM |
| Chemical compound, drug | C-59, Porcupine inhibitor | Abcam | ab142216 | 0.5 μM |
| Chemical compound, drug | Dansylcadaverine, inhibitor of clathrin-dependent endocytosis | Sigma-Aldrich | D4008 | 50 µM |
| Chemical compound, drug | Chloroquine, inhibitor of lysosomal hydrolases | Sigma-Aldrich | C662 | 10 μM |
| Chemical compound, drug | MG-132, proteasome inhibitor | Sigma-Aldrich | C2211 | 10 μM |
| Chemical compound, drug | Vemurafenib BRAF V600E inhibitor | MedChem Express | HY-12057 | Up to 5 μM |
| Chemical compound, drug | Cobimetinib, Mek1 inhibitor | MedChem Express | HY-13064 | Up to 0.5 μM |
| Antibody | β-actin (rabbit monoclonal) | Cell Signaling Technology | CS-4970; RRID:AB_2223172 | WB (1:3000) |
| Antibody | DVL-2 (rabbit polyclonal) | Cell Signaling Technology Mentink et al., 2018 | CS-3216; RRID:AB_2093338 | WB (1:1000) |
| Antibody | DVL-3 (rabbit polyclonal) | Cell Signaling Technology Mentink et al., 2018 | CS-3218; RRID:AB_10694060 | WB (1:1000) |
| Antibody | DVL-3 (rabbit monoclonal) | Santa Cruz Biotechnology Kaiser et al., 2019 | SC-8027; RRID:AB_627434 | WB (1:1000) |
| Antibody | Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (rabbit polyclonal) | Cell Signaling Technology Radaszkiewicz et al., 2020 | CS-9101; RRID:AB_331646 | WB (1:1000) |
| Antibody | Total MAPK (Erk1/2) (rabbit monoclonal) | Cell Signaling Technology Radaszkiewicz and Bryja, 2020 | CS-4695; RRID:AB_390779 | WB (1:1000) |
| Antibody | ROR1 (rabbit polyclonal) | Kind gift from Ho et al., 2012 | WB (1:3000) | |
| Antibody | ROR2 (mouse monoclonal) | Santa Cruz Biotechnology Ozeki et al., 2016 | sc-374174; RRID:AB_10989358 | WB (1:1000) |
| Antibody | WNT5A (rat monoclonal) | R&D Systems Kaiser et al., 2019 | MAB645; RRID:AB_10571221 | WB (1:500) |
| Antibody | WNT11 (rabbit polyclonal) | LifeSpan BioSciences Kotrbová et al., 2020 | LS-C185754 | WB (1:500) |
| Antibody | VANGL2 2 G4 (rat monoclonal) | Merck Mentink et al., 2018 | MABN750; RRID:AB_2721170 | WB (1:500) |
| Antibody | MITF (rabbit monoclonal) | Cell Signaling Technology Lavelle et al., 2020 | CS-12590; RRID:AB_2616024 | WB (1:1000) |
| Antibody | HA-11 (mouse monoclonal) | Covance Paclíková et al., 2017 | MMS-101R; RRID:AB_291262 | WB (1:2000); IF (1:500); IP (1 µg) |
| Antibody | HA (rabbit polyclonal) | Abcam Paclíková et al., 2017 | ab9110; RRID:AB_307019 | WB (1:2000); IF (1:500); IP (1 µg); FC (1:1000) |
| Antibody | c-Myc (9E10) (mouse monoclonal) | Santa Cruz Biotechnology Hanáková et al., 2019 | sc-40; RRID:AB_2857941 | WB (1:500); IF (1:250); IP (1 µg) |
| Antibody | GFP 3 H9 (rat monoclonal) | Chromotek Harnoš et al., 2019 | 3 H9 | WB (1:2000); IP (1 µg) |
| Antibody | GFP (rabbit polyclonal) | Fitzgerald Hanáková et al., 2019 | 20R-GR-011; RRID:AB_1286217 | WB (1:2000); IP (1 µg) |
| Antibody | FLAG M2 (mouse monoclonal) | Sigma-Aldrich Paclíková et al., 2017 | F3165; RRID:AB_259529 | WB (1:2000), IF (1:500) |
| Antibody | FLAG (rabbit polyclonal) | Sigma Paclíková et al., 2017 | F7425; RRID:AB_439687 | WB (1:2000); IF (1:500) |
| Antibody | V5 (mouse monoclonal) | Thermo Fisher Scientific Kaiser et al., 2019 | R96025; RRID:AB_159313 | WB (1:1000), IF (1:1000); IP (1 µg) |
| Antibody | Cortactin (mouse monoclonal) | Santa Cruz Biotechnology Weeber et al., 2019 | sc-55579; RRID:AB_831187 | IF (1:250) |
| Antibody | Golgin-97 (mouse monoclonal) | Invitrogen | A-21270; RRID:AB_221447 | IF (1:500) |
| Antibody | a-mouse IgG HRP (goat polyclonal) | Sigma-Aldrich | A4416; RRID:AB_258167 | WB (1:4000) |
| Antibody | a-rabbit IgG HRP (goat polyclonal) | Sigma-Aldrich | A0545; RRID:AB_257896 | WB (1:4000) |
| Antibody | a-rat IgG HRP (goat polyclonal) | Sigma-Aldrich | A9037; RRID:AB_258429 | WB (1:4000) |
| Antibody | Streptavidin-HRP conjugate | Abcam | ab7403 | WB (1:4000) |
| Antibody | Ror1-APC (mouse monoclonal) | Miltenyi Biotec Kotašková et al., 2016 | 30-119-860 | FC (1:25) |
| Antibody | a-mouse Alexa Fluor 488 (goat polyclonal) and 568 (donkey polyclonal) | Thermo Fisher Scientific | A-11001 (RRID:AB_2534069) and A10037 (RRID:AB_2534013) | IF (1:600) |
| Antibody | a-rabbit Alexa Fluor 488 (donkey polyclonal) and 568 (goat polyclonal) | Thermo Fisher Scientific | A21206 (RRID:AB_2535792) and A11011 (RRID:AB_143157) | IF (1:600) |
| Antibody | Streptavidin, Alexa Fluor 488 conjugate | Thermo Fisher Scientific | S-32354 | IF (1:600) |
| Antibody | Phalloidine Alexa Fluor 594 | Thermo Fisher Scientific | A12381 | IF (1:600) |
| Antibody | Phalloidine 4 Alexa Fluor 488 | Thermo Fisher Scientific | A12379 | IF (1:600) |
| Recombinant DNA reagent | pcDNA4-TO-RNF43-2xHA-2xFLAG | Kindly gifted by Bon-Kyoung Koo (Koo et al., 2012) | Inducible expression of RNF43; backbone for cloning | |
| Recombinant DNA reagent | pcDNA4-TO-RNF43Mut1-2xHA-2xFLAG | Kindly gifted by Bon-Kyoung Koo (Koo et al., 2012) | Inducible expression of inactive RNF43-HA-FLAG | |
| Recombinant DNA reagent | pcDNA4-TO-RNF43-BirA*-HA | This publication | Inducible expression of RNF43 with BirA* and HA tags | |
| Recombinant DNA reagent | pcDNA3-RNF43-HA | This publication | Expression of RNF43-HA | |
| Recombinant DNA reagent | pCW57-RNF43 | This publication | Lentiviral plasmid allowing inducible expression of HA/FLAG tagged RNF43 | |
| Recombinant DNA reagent | myc-Vangl1, GFP-Vangl2, GFP-Vangl2ΔN, GFP-Vangl2ΔC, GFP-Vangl2ΔNΔC | Belotti et al., 2012 | Expression of VANGL1 and VANGL2 and their variants | |
| Recombinant DNA reagent | pLAMP1-mCherry | Addgene #45147 Van Engelenburg and Palmer, 2010 | RRID:Addgene_45147 | Expression of lysosomes marker |
| Recombinant DNA reagent | pEGFP-C1-Rab5a | Chen et al., 2009 | Expression of early endosomes marker | |
| Recombinant DNA reagent | GFP-rab11 WT | Addgene #12674 Choudhury et al., 2002 | RRID:Addgene_12674 | Expression of recycling endosomes marker |
| Recombinant DNA reagent | His-ubiquitin | Tauriello et al., 2010 | Tagged ubiquitin for His-Ub pulldown assay | |
| Recombinant DNA reagent | pcDNA3-Flag-mDvl1 | Tauriello et al., 2010 | Expression of Dvl1 with Flag tag | |
| Recombinant DNA reagent | pCMV5-3xFlag Dvl2 | Addgene #24802 Narimatsu et al., 2009 | RRID:Addgene_24802 | Expression of DVL2 with Flag tag |
| Recombinant DNA reagent | pCDNA3.1-Flag-hDvl3 | Angers et al., 2006 | Expression of DVL3 with Flag tag | |
| Recombinant DNA reagent | pcDNA3.1-hROR1-V5-His | gifted by Kateřina Tmějová | Expression of ROR1 with V5 tag | |
| Recombinant DNA reagent | pcDNA3-Ror2-Flag; pcDNA3-Ror2-dCRD-FLAG | Sammar et al., 2004 | Expression of ROR2 with FLAG tag and its mutant lacking CRD domain | |
| Recombinant DNA reagent | pRRL2_ROR1ΔCYTO and pRRL2_ROR1ΔTail | Gentile et al., 2011 | Expression of ROR1 and its truncated versions | |
| Recombinant DNA reagent | hCas9 | Addgene #41815 Mali et al., 2013 | RRID:Addgene_41815 | Humanized Cas9 |
| Recombinant DNA reagent | gRNA_GFP-T1 | Addgene #41819 Mali et al., 2013 | RRID:Addgene_41819 | gRNA expression plasmid |
| Recombinant DNA reagent | PiggyBack-Hygro; Transposase | Gifted by Bon-Kyoung Koo | RRID:Addgene_64324 | PiggyBack transposase system for stable cell lines generation |
| Recombinant DNA reagent | pU6-(BbsI)CBh-Cas9-T2A-mCherry | Addgene #64324 Chu et al., 2015 | RRID:Addgene_64324 | All-in-1 Cas9 plasmid |
| Recombinant DNA reagent | pSpCas9(BB)-2A-GFP (PX458) | Addgene #48138 Ran et al., 2013 | RRID:Addgene_48138 | All-in-1 Cas9 plasmid |
| Sequence-based reagent | RNF43 gRNA | This publication | gRNA | TGAGTTCCATCGTAACTGTGTGG |
| Sequence-based reagent | ZNRF3 gRNA | This publication | gRNA | AGACCCGCTCAAGAGGCCGGTGG |
| Sequence-based reagent | WNT5A gRNA | This publication | gRNA | AGTATCAATTCCGACATCGAAGG |
| Sequence-based reagent | ROR1 gRNA | This publication | gRNA | CCATCTATGGCTCTCGGCTGCGG |
| Sequence-based reagent | RNF43 gRNA | This publication | gRNA | AGTTACGATGGAACTCATGG |
| Sequence-based reagent | ZNRF3 gRNA | This publication | gRNA | CTCCAGACAGATGGCACAGTCGG |
| Sequence-based reagent | B2M_F | This publication | qPCR primer | CACCCCCACTGAAAAAGATG |
| Sequence-based reagent | B2M_R | This publication | qPCR primer | ATATTAAAAAGCAAGCAAGCAGAA |
| Sequence-based reagent | GAPDH_F | This publication | qPCR primer | GACAGTCAGCCGCATCTTCT |
| Sequence-based reagent | GAPDH_R | This publication | qPCR primer | TTAAAAGCAGCCCTGGTGAC |
| Sequence-based reagent | HSPCB_F | This publication | qPCR primer | TCTGGGTATCGGAAAGCAAGCC |
| Sequence-based reagent | HSPCB_R | This publication | qPCR primer | GTGCACTTCCTCAGGCATCTTG |
| Sequence-based reagent | RPS13_F | This publication | qPCR primer | CGAAAGCATCTTGAGAGGAACA |
| Sequence-based reagent | RPS13_R | This publication | qPCR primer | TCGAGCCAAACGGTGAATC |
| Sequence-based reagent | RNF43_F | This publication | qPCR primer | TTTCCTGCCTCCATGAGTTC |
| Sequence-based reagent | RNF43_R | This publication | qPCR primer | CAGGGACTGGGAAAATGAATC |
| Sequence-based reagent | ZNRF3_F | This publication | qPCR primer | GCTTTCTTCGTCGTGGTCTC |
| Sequence-based reagent | ZNRF3_R | This publication | qPCR primer | GCCTGTTCATGGAATTCTGAC |
| Sequence-based reagent | DVL2_F | This publication | qPCR primer | TCCTTCCACCCTAATGTGTCCA |
| Sequence-based reagent | DVL2_R | This publication | qPCR primer | CATGCTCACTGCTGTCTCTCCT |
| Sequence-based reagent | DVL3_F | This publication | qPCR primer | ACCTTGGCGGACTTTAAGGG |
| Sequence-based reagent | DVL3_R | This publication | qPCR primer | TCACCACTCCGAAATCGTCG |
| Sequence-based reagent | WNT5A_F | This publication | qPCR primer | GCAGCACTGTGGATAACACCTCTG |
| Sequence-based reagent | WNT5A_R | This publication | qPCR primer | AACTCCTTGGCAAAGCGGTAGCC |
| Sequence-based reagent | ROR1_F | This publication | qPCR primer | TCTCGGCTGCGGATTAGAAAC |
| Sequence-based reagent | ROR1_R | This publication | qPCR primer | TCCAGTGGAAGAAACCACCTC |
| Sequence-based reagent | ROR2_F | This publication | qPCR primer | GTGCGGTGGCTAAAGAATGAT |
| Sequence-based reagent | ROR2_F | This publication | qPCR primer | ATTCGCAGTCGTGAACCATATT |
| Sequence-based reagent | MITF_F | Su et al., 2020 | qPCR primer | TGCCCAGGCATGAACACAC |
| Sequence-based reagent | MITF_R | Su et al., 2020 | qPCR primer | GGGAAAAATACACGCTGTGAG |
-
WB: western blot; IF:immunofluorescence; IP: immunoprecipitation.
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/65759/elife-65759-transrepform1-v1.docx
-
Supplementary file 1
Sequencing of the CRISPR/Cas9 derived cell lines.
- https://cdn.elifesciences.org/articles/65759/elife-65759-supp1-v1.pptx
