(A) The transcript levels of the three CRTC genes were determined by RT-qPCR assays. All three CRTC transcript levels were normalized against the level of the housekeeping gene GAPDH individually. …
Numerical data for A.
Unedited immunoblots in B.
(A) H322 cell lysates were treated with or without alkaline calf intestinal phosphatase (CIP, one unit per ug protein) for 60 min at 37°C. Samples were loaded together with untreated A549 and H322 …
Unedited immunoblots in A, B.
A549 cells were transduced with retroviruses generated from a pBabe-LKB1 construct or pBabe vector and then selected with puromycin (1.5 µg/ml) for 48 hr. (A) A549-LKB1 cell lysates were treated …
Unedited immunoblots in A, B.
(A) Cas9-expressing H322 cells (H322-Cas9) were transduced with lentiviruses containing non-targeting gRNA (gNT) or two gRNAs targeting LKB1 (gLKB1-1, gLKB1-2). H322 gNT cell lysates were treated …
Unedited immunoblots in A, B.
(A) Western blot analysis of endogenous CRTC proteins in parental A549 cells, A549 cells stably transduced with non-targeting sgRNA, and two independent single knockout clones for each CRTC1, CRTC2, …
Unedited immunoblots in A.
Numerical data for B, C, D, E.
The altered sequences of CRTC1 (a), CRTC2 (b), and CRTC3 (c) genes in two independent single knockout clones were shown.
(A) A diagram of CRTC co-activator and dnCRTC was shown. The dnCRTC consists of CRTC1 (1-55aa) followed by a nuclear localization signal (nls) and GFP, cloned into the retroviral pMSCV vector. (B) …
Unedited immunoblots in C, E.
Numerical data for D, F, G.
(A) Western blotting confirmed dnCRTC-expressing and GFP-expressing control cells. (B, C) The heatmap and volcano plots showed gene expression changes in dnCRTC-expressing and GFP-expressing cells. …
Unedited immunoblots in A.
Numerical data for D.
Two LKB1-null (A549 and H157) and two LKB1-positive (H322 and H522) NSCLC cells were transduced with dnCRTC or control GFP retroviruses. Expression of the top dnCRTC-downregulated gene candidates …
Numerical data for bar graphs.
The Cas9-expressing H322 cells (H322-Cas9) were first generated and then transduced with lentiviruses containing non-targeting gRNA (gNT) or two gRNAs targeting LKB1 (gLKB1-1, gLKB1-2). The …
Numerical data for bar graphs.
The RNA-seq gene expression data from the TCGA-LUAD cohort (n = 503 cases with 428 WT, 75 mut) and the TCGA-LSCC cohort (n = 466 cases with 461 WT, five mut) were downloaded from cBioportal. The top …
(A) Two LKB1-null (A549 and H157) and two LKB1-positive (H322 and H522) NSCLC cells were transduced with dnCRTC or control GFP retroviruses. The MOI was optimized to obtain an infection rate of …
Numerical data for A, C, D, E.
Unedited immunoblots in B.
(a) BEAS-2B cells were transduced with dnCRTC or GFP retroviruses and the dnCRTC and GFP expression were confirmed by western blotting. (b) The transduced dnCRTC- or GFP BEAS-2B cells were …
Unedited immunoblots in A, D.
Numerical data for C, F, G.
(A–E) A549-luc were transduced with GFP control or dnCRTC for 72 hr and the transduced cells (1 × 106 per mouse) were injected subcutaneously to the right flanks of NOD/SCID mice. Tumor volumes of …
Numerical data for A, D, F, I.
(A) Western blot analysis of GFP and dnCRTC proteins in luciferase-expressing A549 (A549-luc) cells and xenograft tumors. Lane 1: A549-luc (parental); Lane 2: A549-luc transduced with GFP control …
Unedited immunoblots in A, B.
(A–C) Luciferase-expressing LKB1-null A549 cells (A549-luc) were transduced with retroviruses expressing GFP control or dnCRTC for 72 hr, and transduced cells (2 × 106 cells per mouse) were …
Numerical data for B, C, E, F.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Homo sapiens) | STK11 | GenBank | Gene ID: 6794 | This gene is commonly known as LKB1 in the field |
Gene (Homo sapiens) | CRTC1 | GenBank | Gene ID: 23373 | |
Gene (Homo sapiens) | CRTC2 | GenBank | Gene ID: 200186 | |
Gene (Homo sapiens) | CRTC3 | GenBank | Gene ID: 64784 | |
Gene (Homo sapiens) | NR4A2 | GenBank | Gene ID: 4929 | |
Gene (Homo sapiens) | INSL4 | GenBank | Gene ID: 3641 | |
Gene (Homo sapiens) | LINC00473 | GenBank | Gene ID: 90632 | |
Gene (Homo sapiens) | PDE4D | GenBank | Gene ID: 5144 | |
Cell line (Homo-sapiens) | A549 | ATCC | CCL-185 | |
Cell line (Homo-sapiens) | H157 | ATCC | CRL-5802 | |
Cell line (Homo-sapiens) | H322 | ATCC | CRL-5806 | |
Cell line (Homo-sapiens) | H522 | ATCC | CRL-5810 | |
Cell line (Homo-sapiens) | H2126 | ATCC | CCL-256 | |
Cell line (Homo-sapiens) | H1819 | ATCC | CRL-5897 | |
Cell line (Homo-sapiens) | H2087 | ATCC | CRL-5922 | |
Cell line (Homo-sapiens) | H2009 | ATCC | CRL-5911 | |
Cell line (Homo-sapiens) | H3123 | Frederic J Kaye lab | CVCL_Y295 PMID:11030152 | |
Cell line (Homo-sapiens) | H23 | ATCC | CRL-5800 | |
Cell line (Homo-sapiens) | H460 | ATCC | HTB-177 | |
Cell line (Homo-sapiens) | H2122 | ATCC | CRL-5985 | |
Cell line (Homo-sapiens) | H358 | ATCC | CRL-5807 | |
Cell line (Homo-sapiens) | BEAS-2B | ATCC | CRL-9609 | |
Cell line (M. musculus) | mLSCCLP | Francesco J DeMayo lab | PMID:31089135 | |
Antibody | anti-CRTC1 (Rabbit Polyclonal) | Rockland Immunochemicals Inc | Cat: #600-401-936 | WB 1:1000 |
Antibody | anti-CRTC1 (Rabbit Polyclonal) | Bethyl Laboratories | Cat: #A300-769A | ChIP 3 ug/ml |
Antibody | anti-CRTC2 (Rabbit Polyclonal) | Bethyl Laboratories | Cat: #A300-637A | WB 1:1000 ChIP 3 ug/ml |
Antibody | anti-CRTC3 (Rabbit Polyclonal) | Bethyl Laboratories | Cat: #A302-703A, | ChIP 3 ug/ml |
Antibody | anti-CRTC3 (Rabbit monoclonal) | Cell Signaling Technology | Cat: #2720 | WB 1:1000 |
Antibody | anti-LKB1 (Rabbit monoclonal) | Cell Signaling Technology | Cat: #3050 | WB 1:1000 |
Antibody | anti-β-TUBULIN (Rabbit monoclonal) | Epitomics | Cat: #1878 | WB 1:2000 |
Antibody | anti-HDCA1 (Rabbit Polyclonal) | Santa Cruz Biotechnology | Cat: #sc7872 | WB 1:2000 |
Antibody | anti-β-ACTIN (Mouse monoclonal) | Sigma-Aldrich | Cat: #A5316 | WB 1:2000 |
Recombinant DNA reagent | lentiCRISPR v2 (plasmid) | Addgene | Plasmid #52961 | |
Recombinant DNA reagent | sgCtr- LentiCRISPRv2 (plasmid) | Addgene | Plasmid #107402 | |
Recombinant DNA reagent | sgCRTC1- lentiCRISPR v2 (plasmid) | This paper | sgRNA sequence cloned into lentiCRISPR v2 | |
Recombinant DNA reagent | sgCRTC2- lentiCRISPR v2 (plasmid) | This paper | sgRNA sequence clone into lentiCRISPR v2 | |
Recombinant DNA reagent | sgCRTC3- lentiCRISPR v2 (plasmid) | This paper | sgRNA sequence clone into lentiCRISPR v2 | |
Recombinant DNA reagent | pMSCV-GFP (plasmid) | Addgene | Plasmid #86537 | |
Recombinant DNA reagent | pMSCV-dnCRTC (plasmid) | This paper | dnCRTC sequence cloned into pMSCV-GFP | |
Recombinant DNA reagent | pcDNA FLAG TORC1 (plasmid) | Addgene | Plasmid #25718 | |
Recombinant DNA reagent | pcDNA FLAG TORC2 (plasmid) | Addgene | Plasmid #22975 | |
Recombinant DNA reagent | pcDNA FLAG TORC3 (plasmid) | Addgene | Plasmid #22976 | |
Recombinant DNA reagent | lentiCas9-Blast (plasmid) | Addgene | Plasmid #52962 | |
Recombinant DNA reagent | non-targeting control gRNA (plasmid) | Addgene | Plasmid #80180 | |
Recombinant DNA reagent | STK11 gRNA-1 (plasmid) | Addgene | Plasmid #75912 | |
Recombinant DNA reagent | STK11 gRNA-2 (plasmid) | Addgene | Plasmid #75913 | |
Recombinant DNA reagent | pMD2.G (plasmid) | Addgene | Plasmid #12259 | Lentiviral Envelope |
Recombinant DNA reagent | psPAX2 (plasmid) | Addgene | Plasmid #12260 | Lentiviral Packaging |
Sequence-based reagent | CRTC1-qRT-F | This paper | qPCR primers | TGTCTCTCTGACCCCCTTCCAATCC |
Sequence-based reagent | CRTC1-qRT-R | This paper | qPCR primers | GTCCGCGGGTGGTGAGAGGTA |
Sequence-based reagent | CRTC2-qRT-F | This paper | qPCR primers | AGCCCCCTGAGTTTGCTCGC |
Sequence-based reagent | CRTC2-qRT-R | This paper | qPCR primers | TGGGGGTAACCGCTGGTCAGT |
Sequence-based reagent | CRTC3-qRT-F | This paper | qPCR primers | TGACCAGCAGTCCATGAGGCCA |
Sequence-based reagent | CRTC3-qRT-R | This paper | qPCR primers | GGTCTTTGAACAGGCTGGTGCTGG |
Sequence-based reagent | LINC00473-qRT-F | This paper | qPCR primers | AAACGCGAACGTGAGCCCCG |
Sequence-based reagent | LINC00473-qRT-R | This paper | qPCR primers | CGCCATGCTCTGGCGCAGTT |
Sequence-based reagent | FOS-qRT-F | This paper | qPCR primers | CACTCCAAGCGGAGACAG |
Sequence-based reagent | FOS-qRT-R | This paper | qPCR primers | AGGTCATCAGGGATCTTGCAG |
Sequence-based reagent | NR4A2-qRT-F | This paper | qPCR primers | GCCGGAGAGGTCGTTTGCCC |
Sequence-based reagent | NR4A2-qRT-R | This paper | qPCR primers | AGGGTTCGCCTGGAACCTGGAA |
Sequence-based reagent | INSL4-qRT-F | This paper | qPCR primers | GATGTGGTCCCCGATTTGGA |
Sequence-based reagent | INSL4-qRT-R | This paper | qPCR primers | AGGTTGACACCATTTCTTTGGG |
Sequence-based reagent | CPS1-qRT-F | This paper | qPCR primers | CTGATGCTGCCCACACAAAC |
Sequence-based reagent | CPS1-qRT-R | This paper | qPCR primers | AGGGGAAGGATCGAGAAGCT |
Sequence-based reagent | PDK4-qRT-F | This paper | qPCR primers | ACAGACAGGAAACCCAAGCC |
Sequence-based reagent | PDK4-qRT-R | This paper | qPCR primers | GTTCAACTGTTGCCCGCATT |
Sequence-based reagent | NR4A1-qRT-F | This paper | qPCR primers | GAGTCCCAGTGGCGGAGGCT |
Sequence-based reagent | NR4A1-qRT-R | This paper | qPCR primers | CAGGCTGCACCCTACCCGGC |
Sequence-based reagent | TM4SF20-qRT-F | This paper | qPCR primers | TCCAGGCTCTCTTAAAAGGTCC |
Sequence-based reagent | TM4SF20-qRT-R | This paper | qPCR primers | ATGGTGTCGTTACTGGTGGG |
Sequence-based reagent | NR4A3-qRT-F | This paper | qPCR primers | GAAGAGGGCAGCCCGGCAAG |
Sequence-based reagent | NR4A3-qRT-R | This paper | qPCR primers | ACGCAGGGCATATCTGGAGGGT |
Sequence-based reagent | PTGS2-qRT-F | This paper | qPCR primers | GTTCCCACCCATGTCAAAAC |
Sequence-based reagent | PTGS2-qRT-R | This paper | qPCR primers | CCGGTGTTGAGCAGTTTTCT |
Sequence-based reagent | SIK1-qRT-F | This paper | qPCR primers | AGCTTCTGAACCATCCACACA |
Sequence-based reagent | SIK1-qRT-R | This paper | qPCR primers | TTTGCCAGAACTTCTTCCGC |
Sequence-based reagent | PDE4B-qRT-F | This paper | qPCR primers | CCGATCGCATTCAGGTCCTTCGC |
Sequence-based reagent | PDE4B-qRT-R | This paper | qPCR primers | TGCGGTCTGTCCATTGCCGA |
Sequence-based reagent | PDE4D-qRT-F | This paper | qPCR primers | AACACATGAATCTACTGGCTGA |
Sequence-based reagent | PDE4D-qRT-R | This paper | qPCR primers | TCACACATGGGGCTTATCTCC |
Sequence-based reagent | GAPDH-qRT-F | This paper | qPCR primers | CAATGACCCCTTCATTGACC |
Sequence-based reagent | GAPDH-qRT-R | This paper | qPCR primers | GACAAGCTTCCCGTTCTCAG |
Sequence-based reagent | ID1-qRT-F | This paper | qPCR primers | TTCTCCAGCACGTCATCGAC |
Sequence-based reagent | ID1-qRT-R | This paper | qPCR primers | CTTCAGCGACACAAGATGCG |
Sequence-based reagent | LINC00473 promotor-qRT-F | This paper | qPCR primers | CTACAGACGTCATCGCCTCC |
Sequence-based reagent | LINC00473 promotor-qRT-R | This paper | qPCR primers | CACATTTGGGGGTGCTTGTG |
Sequence-based reagent | NR4A2 promoter-qRT-F | This paper | qPCR primers | GGGGAAAGTGAAGTGTCG |
Sequence-based reagent | NR4A2 promoter-qRT-R | This paper | qPCR primers | CCGCGCTCGCTTTGGTAT |
Sequence-based reagent | sgCRTC1-A | This paper | gRNA targets | TGGCGACTTCGAACAATCCG |
Sequence-based reagent | sgCRTC1-B | This paper | gRNA targets | TTACCCGCGCGGCCCGCGTC |
Sequence-based reagent | sgCRTC1-C | This paper | gRNA targets | CCCAGCCGAGGCCAGTACTA |
Sequence-based reagent | sgCRTC2-A | This paper | gRNA targets | GCAGCGAGATCCTCGAAGAA |
Sequence-based reagent | sgCRTC2-B | This paper | gRNA targets | AGGATATGTGGCGGGTGTAT |
Sequence-based reagent | sgCRTC2-C | This paper | gRNA targets | ACAGGCCCAAAAACTGCGAC |
Sequence-based reagent | sgCRTC3-A | This paper | gRNA targets | CTGACGCACTGCTCCGCAGC |
Sequence-based reagent | sgCRTC3-B | This paper | gRNA targets | AAAAAGGATATTTGTCGCCC |
Sequence-based reagent | sgCRTC3-C | This paper | gRNA targets | AACCCGCCATCACGGGCTGG |
Sequence-based reagent | sg-Ctr | This paper | gRNA targets | CTTCCGCGGCCCGTTCAA |
Commercial assay or kit | Bronchial Epithelial Cell Growth Medium kit | Lonza | Cat: # CC-4175 | BEAS-2B cell culture |
Commercial assay or kit | Effectene Transfection Reagent | QIAGEN | Cat: #301425 | Transfection |
Commercial assay or kit | RNeasy Mini Kit | QIAGEN | Cat: #74106 | RNA extraction |
Commercial assay or kit | cDNA Reverse Transcription Kit | Applied Biosystems | Cat: #4368814 | |
Commercial assay or kit | SYBR Green Supermix | Bio-Rad | Cat: #1725120 | |
Commercial assay or kit | Alkaline Phosphatase, Calf Intestinal | New England BioLabs | Cat: #M0290 | |
Commercial assay or kit | Nuclear and Cytoplasmic Extraction Reagents | Thermo Scientific | Cat: #78833 | |
Commercial assay or kit | West Dura Extended Duration Substrate | Thermo Scientific | Cat: # 34076 | |
Commercial assay or kit | GFP-Trap Magnetic Agarose | ChromoTek | Cat:# #gtma-10 | |
Commercial assay or kit | VeriBlot for IP Detection Reagent | abcam | Cat:# ab131366 | |
Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | Cat:# E1910 | |
Commercial assay or kit | FITC Annexin V Apoptosis Detection Kit | BD Bioscience | Cat: #556547 | |
Chemical compound, drug | Hexadimethrine bromide | Sigma-Aldrich | Cat: # H9268 | polybrene |
Chemical compound, drug | Puromycin Dihydrochloride | Gibco | Cat: #A1113803 | |
Chemical compound, drug | Matrigel | Corning | Cat: #356231 | |
Chemical compound, drug | D-Luciferin | PerkinElmer | Cat: #122799 | |
Software, algorithm | GraphPad Prism 7 | GraphPad Prism | ||
Software, algorithm | ImageJ software | ImageJ |
dnCRTC-reguated gene analysis and oligo sequences used in this study.
(a) Differentially expressed genes in dnCRTC-expressing A549 lung cancer cells in comparison with GFP-expressing control cells were shown. (b) GSEA analysis revealed that multiple oncogenic signatures were negatively associated with the dnCRTC-regulated target genes. (c) Primer and sgRNA sequences used in this study.