OPA1 deletion in brown adipose tissue improves thermoregulation and systemic metabolism via FGF21
- Fraternal Order of Eagles Diabetes Research Center and Division of Endocrinology and Metabolism, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, United States
- Department of Obstetrics and Gynecology, Reproductive Endocrinology and Infertility, Roy J. and Lucille A. Carver College of Medicine, United States
- Department of Neuroscience and Pharmacology, Roy J. and Lucille A. Carver College of Medicine, University of Iowa, United States
Figures
Figure 1 with 2 supplements
Optic atrophy 1 (OPA1) deficiency leads to mitochondrial dysfunction in brown adipose tissue (BAT), while improving energy balance and thermoregulation in mice.
(A, B) OPA1 expression in BAT of wild-type (WT) mice fed either control (10% fat) or a high-fat diet (HFD 60% fat) for 12 weeks. (A) Opa1 mRNA expression in BAT. (B) Representative immunoblot of …
-
Figure 1—source data 1
Optic atrophy 1 (OPA1) deficiency leads to mitochondrial dysfunction in brown adipose tissue (BAT), while improving energy balance and thermoregulation in mice.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Age-dependent changes in body composition and glucose homeostasis in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout (KO) mice.
Related to Figure 1. (A–C) Representative immunoblot of OPA1 and densitometric analysis of OPA1 normalized by tubulin or GAPDH. (A) Inguinal white adipose tissue (iWAT) (dashed line separates …
-
Figure 1—figure supplement 1—source data 1
Age-dependent changes in body composition and glucose homeostasis in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout (KO) mice.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Data collected in 8-week-old optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout mice (KO) and their wild-type littermate controls (WT) reared at thermoneutrality.
Related to Figure 1. (A) Body mass. (B) Percent fat mass normalized to body weight. (C) Percent lean mass normalized to body weight. (D) BAT mass normalized by body weight. (E) Gonadal white adipose …
-
Figure 1—figure supplement 2—source data 1
Data collected in 8-week-old optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout mice (KO) and their wild-type litter mate controls (WT) reared at thermoneutrality.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig1-figsupp2-data1-v2.xlsx
Figure 2
Optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout (KO) mice exhibit improved tolerance to cold despite impaired thermogenic activation of BAT.
(A) Rectal temperature in 8-week-old wild-type (WT) and KO mice exposed to acute cold stress (4°C) over the period of 4 hr. (B–D) mRNA expression of thermogenic genes in BAT of WT and KO mice housed …
-
Figure 2—source data 1
Optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout (KO) mice exhibit improved tolerance to cold despite impaired thermogenic activation of BAT.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig2-data1-v2.xlsx
Figure 3 with 1 supplement
Optic atrophy 1 (OPA1) deletion in brown adipose tissue (BAT) results in compensatory browning of white adipose tissue (WAT).
(A–G) Morphological and functional characterization of inguinal white adipose tissue (iWAT) in 8-week-old wild-type (WT) and knockout (KO) mice. (A) Representative iWAT sections stained with H&E or …
-
Figure 3—source data 1
Optic atrophy 1 (OPA1) deletion in brown adipose tissue (BAT) results in compensatory browning of white adipose tissue (WAT).
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Data collected in 8-week-old optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout mice (KO) and their wild-type littermate controls (WT) at room temperature conditions.
Related to Figure 3. (A) Cre mRNA expression in BAT and inguinal white adipose tissue (iWAT) normalized to Gapdh expression. (B) Fasting fibroblast growth factor 21 (FGF21) serum levels (C) Fgf21 …
-
Figure 3—figure supplement 1—source data 1
Data collected in 8-week-old optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout KO mice (KO) and their wild-type littermate controls (WT) at room temperature conditions.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig3-figsupp1-data1-v2.xlsx
Figure 4 with 1 supplement
Brown adipose tissue (BAT)-derived fibroblast growth factor 21 (FGF21) is required for increased resting metabolic rates and improved thermoregulation in mice lacking optic atrophy 1 (OPA1) in BAT during isocaloric feeding.
(A–L) Data characterizing 8–12-week-old OPA1/FGF21 DKO mice. (A) mRNA expression of Opa1 and Fgf21 in BAT of DKO mice. (B) FGF21 serum levels collected under ad libitum-fed conditions. (C) Total …
-
Figure 4—source data 1
Brown adipose tissue (BAT)-derived fibroblast growth factor 21 (FGF21) is required for increased resting metabolic rates and improved thermoregulation in mice lacking optic atrophy 1 (OPA1) in BAT during isocaloric feeding.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Data collected in optic atrophy 1 (OPA1)/fibroblast growth factor 21 (FGF21) brown adipose tissue (BAT) DKO mice and their wild-type littermate controls (WT).
Related to Figure 4. (A) State 2 and state 3 pyruvate-malate-supported oxygen consumption rates (OCRs) in mitochondria isolated from BAT. (B) State 2 and state 3 palmitoyl-carnitine-supported OCR in …
-
Figure 4—figure supplement 1—source data 1
Data collected in optic atrophy 1 (OPA1)/fibroblast growth factor 21 (FGF21) brown adipose tissue (BAT) DKO mice and their wild-type littermate controls (WT).
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig4-figsupp1-data1-v2.xlsx
Figure 5 with 1 supplement
Optic atrophy 1 (OPA1) deletion in brown adipose tissue (BAT) prevents diet-induced obesity and insulin resistance.
(A–O) Data from wild-type (WT) and OPA1 BAT knockout (KO) mice fed either a control diet (Cont) or a high-fat diet (HFD) for 12 weeks. (A) Total body mass. (B) Percent ratio of fat mass to body …
-
Figure 5—source data 1
Optic atrophy 1 (OPA1) deletion in brown adipose tissue (BAT) prevents diet-induced obesity and insulin resistance.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Data collected in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout mice (KO) and their wild-type littermate controls (WT) fed either control (10% fat content) or high-fat diet (HFD) (60% fat content) for 12 weeks.
Related to Figure 5. (A) Liver mass. (B) Liver triglycerides levels. (C) Serum triglycerides levels. (D) mRNA expression of Ucp1 in BAT. (E) mRNA expression of Ucp1 in inguinal white adipose tissue (…
-
Figure 5—figure supplement 1—source data 1
Data collected in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout KO mice (KO) and their wild-type litter mate controls (WT) fed either control (10% fat content) or high-fat diet (HFD) (60% fat content) for 12 weeks.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig5-figsupp1-data1-v2.xlsx
Figure 6 with 1 supplement
Brown adipose tissue (BAT)-derived fibroblast growth factor 21 (FGF21) does not mediate resistance to diet-induced obesity in optic atrophy 1 (OPA1) BAT knockout (KO) mice.
(A–K) Data from wild-type (WT) and OPA1/FGF21 DKO mice fed either a control diet (Cont) or a high-fat diet (HFD) for 12 weeks. (A) Total body mass. (B) Percent ratio of fat mass to body mass. (C) …
-
Figure 6—source data 1
Brown adipose tissue (BAT)-derived fibroblast growth factor 21 (FGF21) does not mediate resistance to diet-induced obesity in optic atrophy 1 (OPA1) BAT knockout (KO) mice.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Data collected in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout mice (KO), OPA1/fibroblast growth factor 21 (FGF21) DKO mice or their respective wild-type littermate controls (WT) fed either control (10% fat content) or high-fat diet (HFD) (60% fat content) for 12 weeks.
Related to Figure 6. (A) BAT mass normalized to body mass. (B) Gonadal white adipose tissue (gWAT) mass normalized to body mass. (C) Inguinal white adipose tissue (iWAT) mass normalized to body …
-
Figure 6—figure supplement 1—source data 1
Data collected in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout mice (KO), OPA1/fibroblast growth factor 21 (FGF21) DKO mice or their respective wild-type littermate controls (WT) fed either control (10% fat content) or high-fat diet (HFD) (60% fat content) for 12 weeks.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig6-figsupp1-data1-v2.xlsx
Figure 7
Activating transcription factor 4 (ATF4) is required for fibroblast growth factor 21 (FGF21) induction in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout (KO) mice.
(A, B) Analysis of endoplasmic reticulum (ER) stress in BAT tissue from wild-type (WT) and OPA1 BAT KO mice (KO). (A) Representative immunoblot for phosphorylated eukaryotic translation initiation …
-
Figure 7—source data 1
Activating transcription factor 4 (ATF4) is required for fibroblast growth factor 21 (FGF21) induction in optic atrophy 1 (OPA1) brown adipose tissue (BAT) knockout (KO) mice.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig7-data1-v2.xlsx
Figure 8
Activating transcription factor 4 (ATF4) induction in brown adipose tissue (BAT) is necessary for the resistance to diet-induced obesity (DIO) and insulin resistance (IR) in optic atrophy 1 (OPA1) BAT knockout (KO) mice.
(A–K) Data from wild-type (WT) and OPA1/ATF4 BAT DKO mice fed a high-fat diet (HFD) for 12 weeks. (A) Total body mass. (B) Percent ratio of fat mass to body mass. (C) Percent ratio of lean mass to …
-
Figure 8—source data 1
Activating transcription factor 4 (ATF4) induction in brown adipose tissue (BAT) is necessary for the resistance to diet-induced obesity (DIO) and insulin resistance (IR) in optic atrophy 1 (OPA1) BAT knockout (KO) mice.
- https://cdn.elifesciences.org/articles/66519/elife-66519-fig8-data1-v2.xlsx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (mouse, C57Bl/6J) | Murine models | Jackson Laboratories | JAX Stock #024670 RRID:IMSR_JAX:024670 | Tg (Ucp1-cre)1Evdr; male and female |
| Strain, strain background (mouse, C57Bl/6J) | Murine models | Jackson Laboratories | JAX Stock #025124 RRID:IMSR_JAX:025124 | C57BL/6-Tg(Adipoq-cre/ERT2)1Soff/J; male and female |
| Antibody | Anti-OPA1 (Mouse monoclonal) | BD Biosciences | #612606 RRID:AB_399888 | WB (1:1000), primary |
| Antibody | Anti-FGF21(Rabbit monoclonal) | Abcam | #ab171941 | WB (1:1000), primary |
| Antibody | Anti-GAPDH (Rabbit monoclonal) | Cell Signaling Technology | #2118 RRID:AB_561053 | WB (1:1000), primary |
| Antibody | Anti-VDAC (Rabbit polyclonal) | Thermo Scientific | #PA1‐954A RRID:AB_2304154 | WB (1:1000), primary |
| Antibody | Anti-UCP1 (Rabbit polyclonal) | Abcam | #Ab10983 RRID:AB_2241462 | WB (1:1000), primary Histology 1:250 |
| Antibody | Anti-SDH (Mouse monoclonal) | Abcam | #Ab14714 | WB (1:1000), primary |
| Antibody | Anti-α-tubulin (Mouse monoclonal) | Sigma | #T9026 | WB (1:1000), primary |
| Antibody | Anti-β-actin (Rabbit polyclonal) | Sigma | #A2066 RRID:AB_476693 | WB (1:1000), primary |
| Antibody | Anti-tyrosine hydroxylase (Rabbit polyclonal) | Cell Signaling Technology | #2792 RRID:AB_2303165 | WB (1:1000), primary |
| Antibody | Anti-phosphorylated eIF2α serine 51 (Rabbit monoclonal) | Cell Signaling Technology | #3597 | WB (1:1000), primary |
| Antibody | anti-eIF2α (Mouse monoclonal) | Santa Cruz Biotechnology | #SC81261 | WB (1:1000), primary |
| Antibody | IRDye 800CW anti‐mouse | LI-COR | #925‐32212 RRID:AB_2716622 | WB (1:10,000), secondary |
| Antibody | Alexa Fluor anti‐rabbit 680 | Invitrogen | #A27042 | WB (1:10,000), secondary |
| Antibody | Anti-rabbit biotinylated secondary antibody | Cell Signaling Technology | #14708 | Histology (1:500) |
| Chemical compound, drug | 5-hydroxytamoxifen | Sigma | T176 | Used in vitro |
| Commercial assay or kit | RNeasy kit | Qiagen Inc | #74104 | |
| Commercial assay or kit | EnzyChrom Triglyceride Assay Kit | BioAssay Systems | #ETGA-200 | |
| Commercial assay or kit | Mouse/rat fibroblast growth factor 21 ELISA | Biovendor | #RD291108200R | |
| Commercial assay or kit | Ultra-Sensitive Mouse Insulin ELISA Kit | Chrystal Chem | #90080 | |
| Commercial assay or kit | High-Capacity cDNA reverse Transcription Kit | Applied Biosystems | #4368814 | |
| Commercial assay or kit | Hematoxylin and Eosin Stain Kit | Vector Laboratories | #H3502 | |
| Software, algorithm | GraphPad Prism Software | GraphPad Software, La Jolla, CA, USA | Version 8.0.0 for Windows RRID:SCR_002798 | |
| Other | 2920X, standard chow | Harlan Teklad | 2920X | |
| Other | Chow, 60% HFD | Research Diets | D12492 | |
| Other | Chow, 10% Control | Research Diets | D12450J | |
| Sequence-based reagent | Fgf21_F | Integrated DNA Technologies, Inc | PCR primers | TGACGACCAAGACACTGAAGC |
| Sequence-based reagent | Fgf21_R | Integrated DNA Technologies, Inc | PCR primers | TTTGAGCTCCAGGAGACTTTCTG |
| Sequence-based reagent | Atf4_F | Integrated DNA Technologies, Inc | PCR primers | AGCAAAACAAGACAGCAGCC |
| Sequence-based reagent | Atf4_R | Integrated DNA Technologies, Inc | PCR primers | ACTCTCTTCTTCCCCCTTGC |
| Sequence-based reagent | Chop_F | Integrated DNA Technologies, Inc | PCR primers | GTCCCTAGCTTGGCTGACAGA |
| Sequence-based reagent | Chop _R | Integrated DNA Technologies, Inc | PCR primers | TGGAGAGCGAGGGCTTTG |
| Sequence-based reagent | Ern1_F | Integrated DNA Technologies, Inc | PCR primers | TGAAACACC CCTTCTTCTGG |
| Sequence-based reagent | Ern1_R | Integrated DNA Technologies, Inc | PCR primers | CCT CCT TTT CTA TTC GGT CAC TT |
| Sequence-based reagent | Opa1_F | Integrated DNA Technologies, Inc | PCR primers | ATACTGGGATCTGCTGTTGG |
| Sequence-based reagent | Opa1_R | Integrated DNA Technologies, Inc | PCR primers | AAGTCAGGCACAATCCACTT |
| Sequence-based reagent | Ucp1_F | Integrated DNA Technologies, Inc | PCR primers | GTGAAGGTCAGAATGCAAGC |
| Sequence-based reagent | Ucp1_R | Integrated DNA Technologies, Inc | PCR primers | AGGGCCCCCTTCATGAGGTC |
| Sequence-based reagent | Prdm16_F | Integrated DNA Technologies, Inc | PCR primers | CAGCACGGTGAAGCCATTC |
| Sequence-based reagent | Prdm16_R | Integrated DNA Technologies, Inc | PCR primers | GCGTGCATCCGCTTGTG |
| Sequence-based reagent | Gapdh_F | Integrated DNA Technologies, Inc | PCR primers | AACGACCCCTTCATTGAC |
| Sequence-based reagent | Gapdh_R | Integrated DNA Technologies, Inc | PCR primers | TCCACGACATACTCAGCAC |
| Sequence-based reagent | Ppargc1a_F | Integrated DNA Technologies, Inc | PCR primers | GTAAATCTGCGGGATGATGG |
| Sequence-based reagent | Ppargc1a_R | Integrated DNA Technologies, Inc | PCR primers | AGCAGGGTCAAAATCGTCTG |
| Sequence-based reagent | Dio2_F | Integrated DNA Technologies, Inc | PCR primers | AATTATGCCTCGGAGAAGACCG |
| Sequence-based reagent | Dio2_R | Integrated DNA Technologies, Inc | PCR primers | GGCAGTTGCCTAGTGAAAGGT |
| Sequence-based reagent | Nrg4_F | Integrated DNA Technologies, Inc | PCR primers | ACTCACTAAGCCAGAGTGAAGCAGG |
| Sequence-based reagent | Nrg4_R | Integrated DNA Technologies, Inc | PCR primers | CATGTCGTCTCTACAGGTGCTCTGC |
| Sequence-based reagent | Cre_F | Integrated DNA Technologies, Inc | PCR primers | AATGCTTCTGTCCGTTTGCC |
| Sequence-based reagent | Cre_R | Integrated DNA Technologies, Inc | PCR primers | ACATCTTCAGGTTCTGCGGG |
| Sequence-based reagent | Cpt1b_F | Integrated DNA Technologies, Inc | PCR primers | TGCCTTTACATCGTCTCCAA |
| Sequence-based reagent | Cpt1b_R | Integrated DNA Technologies, Inc | PCR primers | AGACCCCGTAGCCATCATC |
| Sequence-based reagent | Ppara_F | Integrated DNA Technologies, Inc | PCR primers | GAGAATCCACGAAGCCTACC |
| Sequence-based reagent | Ppara_R | Integrated DNA Technologies, Inc | PCR primers | ATTCGGACCTCTGCCTCTTT |
| Sequence-based reagent | Acadm_F | Integrated DNA Technologies, Inc | PCR primers | ACTGACGCCGTTCAGATTTT |
| Sequence-based reagent | Acadm_R | Integrated DNA Technologies, Inc | PCR primers | GCTTAGTTACACGAGGGTGATG |
| Sequence-based reagent | Metrnl_F | Integrated DNA Technologies, Inc | PCR primers | CTGGAGCAGGGAGGCTTATTT |
| Sequence-based reagent | Metrnl_R | Integrated DNA Technologies, Inc | PCR primers | GGACAACAAAGTCACTGGTACAG |
| Sequence-based reagent | Bmp8b_F | Integrated DNA Technologies, Inc | PCR primers | CAACCACGCCACTATGCA |
| Sequence-based reagent | Bmp8b_R | Integrated DNA Technologies, Inc | PCR primers | CACTCAGCTCAGTAGGCACA |
| Sequence-based reagent | Slit2-c_F | Integrated DNA Technologies, Inc | PCR primers | GCTGTGAACCATGCCACAAG |
| Sequence-based reagent | Slilt2-c_R | Integrated DNA Technologies, Inc | PCR primers | CACACATTTGTTTCCGAGGCA |
| Sequence-based reagent | Evlov6_F | Integrated DNA Technologies, Inc | PCR primers | TCAGCAAAGCACCCGAAC |
| Sequence-based reagent | Evlov6_R | Integrated DNA Technologies, Inc | PCR primers | AGCGACCATGTCTTTGTAGGAG |
| Sequence-based reagent | Il6_F | Integrated DNA Technologies, Inc | PCR primers | TGGGAAATCGTGGAAATGAG |
| Sequence-based reagent | Il6_R | Integrated DNA Technologies, Inc | PCR primers | GAAGGACTCTGGCTTTGTCTT |
