The Ca2+-activated cation channel TRPM4 is a positive regulator of pressure overload-induced cardiac hypertrophy
- Molecular Cardiology and Biophysics Division, Victor Chang Cardiac Research Institute, Australia
- Cardiac Physiology and Transplantation Division, Victor Chang Cardiac Research Institute, Australia
- St Vincent’s Clinical School, Faculty of Medicine, University of New South Wales, Australia
- Laboratory of Ion Channel Research, Department of Molecular and Cellular Medicine, Katholieke Universiteit Leuven, Belgium
- TRP Research Platform Leuven (TRPLe), Katholieke Universiteit Leuven, Belgium
- Department of Cardiology, St Vincent’s Hospital, Australia
Figures
Figure 1 with 1 supplement
TRPM4 expression was downregulated in response to left ventricular (LV) pressure overload.
(A) Relative mRNA expression of Trpm4 in LV tissue and (B) in LV cardiomyocytes (CMs) after 2 days and 14 days of sham and TAC. (C) Representative western blots of TRPM4 protein expression in LV …
-
Figure 1—source data 1
Source data file (Excel) for Figure 1A,B,D and E.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Enlarged heart and cardiac fibrosis were detected 14 days after TAC.
(A) Representative photos of hearts from WT mice 2 days or 14 days after sham or TAC. (B) Representative photos of cardiac fibrosis, evaluated by Masson’s trichrome staining of LV tissue from WT …
Figure 2
The hypertrophic response of WT and Trpm4 cKO mice to TAC-induced LV pressure overload.
(A) Systolic pressure, (B) heart rate, (C, D) dP/dt after 14 days of sham or TAC in WT and Trpm4 cKO mice. (n = 6–7/group). (E) Lung weight after 14 days of sham or TAC in WT and Trpm4 cKO mice. (n =…
-
Figure 2—source data 1
Source data file (Excel) for Figure 2A,B,C,D,E,G,H,I,J,L, and M.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig2-data1-v1.xlsx
Figure 3
Comparison of gene expression of LVH markers in response to TAC-induced pressure overload in WT and Trpm4 cKO mice.
(A) Relative mRNA expression of ANP (Nppa), BNP (Nppb), and α-SA (Acta1) after 2 days of TAC compared to sham-operated mice. (n = 6/group). (B) Relative mRNA expression of ANP (Nppa), BNP (Nppb), …
-
Figure 3—source data 1
Source data file (Excel) for Figure 3A,B.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig3-data1-v1.xlsx
Figure 4 with 2 supplements
CaMKII-HDAC4-MEF2 signalling pathway in response to TAC after 2 days in WT and Trpm4 cKO mouse hearts.
(A) Representative western blots showing the expression of key proteins in the CaMKII-HDAC4-MEF2 signalling pathway in the cytoplasm (left) and nucleus (right). (B) Cytoplasmic (left) and nuclear …
-
Figure 4—source data 1
Source data file (Excel) for Figure 4B.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Demonstration of successful fractionation of compartments.
The purity of the fractions extracted from the LV tissue was assessed by western blot using specific marker proteins: GAPDH for cytoplasmic fraction and histone H2B for nuclear fraction. Each …
Figure 4—figure supplement 2
Cytoplasmic/nuclear ratio of the key proteins in CaMKII-HDAC4-MEF2 signalling pathway.
Cytoplasmic/nuclear ratios are shown as fold changes relative to sham groups, in each genotype. Results are presented as means ± SEM, n = 6/group, *p<0.05, ***p<0.001.
-
Figure 4—figure supplement 2—source data 1
Source data file (Excel) for Figure 4—figure supplement 2.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig4-figsupp2-data1-v1.xlsx
Figure 5 with 1 supplement
Calcineurin-NFAT signalling pathway in response to TAC after 2 days in WT and Trpm4 cKO mouse hearts.
(A) Representative western blots showing the expression of key proteins in the calcineurin-NFAT signalling pathway in cytoplasm (left) and nucleus (right). (B) Cytoplasmic (left) and nuclear (right) …
-
Figure 5—source data 1
Source data file (Excel) for Figure 5B.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Cytoplasmic/nuclear ratio of the key proteins in calcineurin-NFAT signalling pathway.
Cytoplasmic/nuclear ratios are shown as fold changes relative to sham groups, in each genotype. Results are presented as means ± SEM, n = 6/group.
-
Figure 5—figure supplement 1—source data 1
Source data file (Excel) for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/66582/elife-66582-fig5-figsupp1-data1-v1.xlsx
Figure 6
Schematic of the putative TAC-induced pathway that culminates in left ventricular hypertrophy.
A Ca2+-permeable MS channel (e.g. Piezo1, TRPV2, TRPV4) acts as the mechanotransducer providing local Ca2+ that in turn stimulates TRPM4. The Na+-permeable TRPM4 activity then could either stimulate …
Tables
Table 1
Haemodynamic parameters were measured in wild-type (WT) mice 14 days after subjected to TAC versus sham-operated controls (n = 7–11/group).
Post-mortem analysis of mice 2 days or 14 days after sham or TAC; LVH developed 14 days after TAC, indicated by the ratios of HW/BW, LVW/BW, and LVW/TL in WT mice subjected to TAC versus …
| 2 days | 14 days | |||
|---|---|---|---|---|
| Sham | TAC | Sham | TAC | |
| Haemodynamic parameter | ||||
| n | 7 | 7 | ||
| HR (bpm) | 506 ± 4 | 506 ± 3 | ||
| Aortic systolic pressure (mmHg) | 103 ± 1 | 164 ± 2*** | ||
| Aortic diastolic pressure (mmHg) | 76 ± 1 | 74 ± 1 | ||
| LV systolic Pressure (mmHg) | 105 ± 3 | 164 ± 8*** | ||
| dP/dtmax (mmHg/s) | 9438 ± 367 | 9838 ± 259 | ||
| dP/dtmin (mmHg/s) | −9666 ± 377 | −10108 ± 364 | ||
| Anatomical parameter | ||||
| n | 8 | 8 | 11 | 11 |
| BW (g) | 28.5 ± 0.3 | 27.7 ± 0.5 | 28.6 ± 0.3 | 27.2 ± 0.5 |
| HW (mg) | 136.7 ± 2.2 | 132.8 ± 1.3 | 133.1 ± 1.9 | 176.1 ± 3.6 *** |
| LVW (mg) | 98.0 ± 2.0 | 97.7 ± 1.4 | 96.4 ± 1.8 | 136.1 ± 1.4 *** |
| LW (mg) | 141.9 ± 0.9 | 143.6 ± 1.5 | 146.9 ± 1.8 | 147.0 ± 1.9 |
| TL (mm) | 17.4 ± 0.1 | 17.5 ± 0.2 | 17.5 ± 0.2 | 17.2 ± 0.1 |
| HW/BW (mg/g) | 4.8 ± 0.1 | 4.8 ± 0.1 | 4.6 ± 0.1 | 6.6 ± 0.1 *** |
| LVW/BW (mg/g) | 3.4 ± 0.1 | 3.5 ± 0.1 | 3.4 ± 0.1 | 5.1 ± 0.1 *** |
| LVW/TL (mg/mm) | 5.6 ± 0.1 | 5.6 ± 0.1 | 5.3 ± 0.1 | 7.9 ± 0.1 *** |
| LW/BW (mg/g) | 5.0 ± 0.1 | 5.2 ± 0.1 | 5.2 ± 0.1 | 5.4 ± 0.1 |
| Assessment of cardiac fibrosis | ||||
| n | 5 | 5 | 6 | 6 |
| Fibrosis areas (%) | 4.0 ± 0.2 | 3.6 ± 0.2 | 4.4 ± 0.1 | 12.4 ± 0.5*** |
| n | 4 | 4 | 4 | 4 |
| Collagen III mRNA expression (fold change) | 1.0 ± 0.1 | 5.7 ± 0.8** | 1.0 ± 0.1 | 5.1 ± 0.7** |
-
Table 1—source data 1
Haemodynamic and anatomical parameters.
- https://cdn.elifesciences.org/articles/66582/elife-66582-table1-data1-v1.xlsx
Table 2
Early markers of LVH induction in response to left ventricular pressure overload in WT mice.
Relative mRNA expression of ANP (Nppa), BNP (Nppb), and a-SA (Acta1) after 2 days or 14 days of TAC compared to sham (n = 4–5/group). The relative mRNA expression was normalised by GAPDH and …
| 2 days | 14 days | |||
|---|---|---|---|---|
| Sham | TAC | Sham | TAC | |
| LVH markers (fold change) | ||||
| n | 4 | 4 | 5 | 5 |
| ANP | 1.0 ± 0.1 | 9.9 ± 1.1** | 1.0 ± 0.1 | 9.6 ± 0.7*** |
| BNP | 1.0 ± 0.1 | 8.1 ± 0.8** | 1.0 ± 0.2 | 7.5 ± 0.4*** |
| α-SA | 1.0 ± 0.1 | 4.5 ± 0.5** | 1.0 ± 0.1 | 4.2 ± 0.4*** |
-
Table 2—source data 1
Early gene markers.
- https://cdn.elifesciences.org/articles/66582/elife-66582-table2-data1-v1.xlsx
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-TRPM4 (rabbit polyclonal) | Alomone Labs | Cat# ACC-044, RRID:AB_2040250 | Western blot (1:200) |
| Antibody | Anti-CaMKII delta (rabbit monoclonal) | Abcam | Cat# ab181052, RRID:AB_2891241 | Western blot (1:1000) |
| Antibody | Anti-p-CaMKII (Thr287) (rabbit polyclonal) | Thermo Fisher Scientific | Cat# PA5-37833, RRID:AB_2554441 | Western blot (1:5000) |
| Antibody | Anti-HDAC4 (rabbit monoclonal) | Cell Signaling Technology | Cat# 7628 RRID:AB_10860255 | Western blot (1:1500) |
| Antibody | Anti-p-HDAC4 (Ser246) (rabbit monoclonal) | Cell Signaling Technology | Cat# 3443 RRID:AB_2118723 | Western blot (1:1500) |
| Antibody | Anti-MEF2A (rabbit polyclonal) | Cell Signaling Technology | Cat# 9736 RRID:AB_10691852 | Western blot (1:3000) |
| Antibody | Anti-NFATc4 (rabbit polyclonal) | Abcam | Cat# ab99431, RRID:AB_10675673 | Western blot (1:1500) |
| Antibody | Anti-GSK3β (rabbit monoclonal) | Cell Signaling Technology | Cat# 9315, RRID:AB_490890 | Western blot (1:500) |
| Antibody | Anti-p-GSK3β (Ser9) (rabbit polyclonal) | Cell Signaling Technology | Cat# 9336, RRID:AB_331405 | Western blot (1:1500) |
| Antibody | Anti-GATA4 (mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-25310, RRID:AB_627667 | Western blot (1:1000) |
| Antibody | Anti-GAPDH (rabbit monoclonal) | Cell Signaling Technology | Cat# 2118, RRID:AB_561053 | Western blot (1:10,000) |
| Antibody | Anti-Histone H2B (rabbit polyclonal) | Abcam | Cat# ab1790, RRID:AB_302612 | Western blot (1:5000) |
| Antibody | Goat anti-rabbit IgG (goat polyclonal) | Abcam | Cat# ab6721, RRID:AB_955447 | Western blot (1:10,000) |
| Antibody | Rabbit anti-mouse IgG (rabbit polyclonal) | Abcam | Cat# ab6728, RRID:AB_955440 | Western blot (1:5000) |
| Sequence-based reagent | ANP (Nppa)_F | Sigma-Aldrich | PCR primers | TGATAGATGAAGGCAGGAAGCCGC |
| Sequence-based reagent | ANP(Nppa)_R | Sigma-Aldrich | PCR primers | AGGATTGGAGCCCAGAGTGGACTAGG |
| Sequence-based reagent | BNP (Nppb)_F | Sigma-Aldrich | PCR primers | TCTCCAGAGCAATTCAAGAT |
| Sequence-based reagent | BNP (Nppb)_R | Sigma-Aldrich | PCR primers | AACAACTTCAGTGCGTTACA |
| Sequence-based reagent | α-SA (Acta1)_F | Sigma-Aldrich | PCR primers | GTGAGATTGTGCGCGACATC |
| Sequence-based reagent | α-SA (Acta1)_R | Sigma-Aldrich | PCR primers | GGCAACGGAAACGCTCATT |
| Sequence-based reagent | Collagen III (Col3A1)_F | Sigma-Aldrich | PCR primers | GACAGATTCTGGTGCAGAGA |
| Sequence-based reagent | Collagen III (Col3A1)_R | Sigma-Aldrich | PCR primers | CATCAACGACATCTTCAGGAAT |
| Sequence-based reagent | Trpm4_F | Sigma-Aldrich | PCR primers | GAGAAGCCCACAGATGCCTATG |
| Sequence-based reagent | Trpm4_R | Sigma-Aldrich | PCR primers | AGCACCGACACCACCAAGTTTG |
Additional files
-
Source data 1
Western blots.
- https://cdn.elifesciences.org/articles/66582/elife-66582-data1-v1.zip
-
Supplementary file 1
Haemodynamic and anatomical parameters after 2 days and 14 days of sham/TAC in WT and Trpm4 cKO mice.
Haemodynamic measurements include heart rate (HR), aortic systolic and diastolic pressure, LV systolic pressure, dP/dtmax and dP/dtmin; anatomical measurements include body weight (BW), heart weight (HW), LV weight (LVW), lung weight (LW), tibial length (TL), heart weight normalised by body weight (HW/BW), LV weight normalised by body weight and tibial length (LVW/BW; LVW/TL), lung weight normalised by body weight (LW/BW). Data are presented as means ± SEM. Comparison between sham and TAC in WT or Trpm4 cKO groups: **p<0.01, ***p<0.001; Comparison between WT and Trpm4 cKO TAC groups: #p<0.05, ###p<0.001.
- https://cdn.elifesciences.org/articles/66582/elife-66582-supp1-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/66582/elife-66582-transrepform-v1.docx
