1. Developmental Biology
Download icon

SORBS2 is a genetic factor contributing to cardiac malformation of 4q deletion syndrome patients

  1. Fei Liang
  2. Bo Wang
  3. Juan Geng
  4. Guoling You
  5. Jingjing Fa
  6. Min Zhang
  7. Hunying Sun
  8. Huiwen Chen
  9. Qihua Fu  Is a corresponding author
  10. Xiaoqing Zhang  Is a corresponding author
  11. Zhen Zhang  Is a corresponding author
  1. Neonatal Intensive Care Unit, Shanghai Pediatric Congenital Heart Disease Institute and Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
  2. Shanghai Pediatric Congenital Heart Disease Institute and Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
  3. Shanghai Key Laboratory of Clinical Molecular Diagnostics for Pediatrics, Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
  4. Key Laboratory of Pediatric Hematology and Oncology Ministry of Health and Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
  5. Department of thoracic and cardiac surgery, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
Short Report
Cite this article as: eLife 2021;10:e67481 doi: 10.7554/eLife.67481
4 figures, 3 videos, 3 tables and 14 additional files

Figures

Figure 1 with 4 supplements
SORBS2 has a dual role in cardiogenesis.

(A) Flow cytometry analysis of cardiomyocytes at differentiation day 15 (D15). P3 indicates cTnT+ population. (B) Quantification of cTnT+ cells (n = 3). **p<0.01; two-tailed Student’s t test. (C) Immunostaining of D30 cells with anti-cardiac troponin I (cTnI, red) and anti-α-actinin (green) antibodies. Boxed areas are magnified in the lower panels. (D) Quantification of cardiomyocytes with well-organized sarcomeres (control: n = 211, SORBS2-knockdown: n = 197). **p<0.01; two-tailed Student’s t test. (E) qPCR quantification of SORBS2 expression dynamics (n = 3 for each time point). **p<0.01; two-tailed Student’s t test. (F–H) qPCR quantification of second heart field (SHF) progenitor marker expression at different time points (n = 3 for each time point). *p<0.05, **p<0.01; two-tailed Student’s t test. (I) Volcano plot illustrates the differential gene expression from D5 RNA-seq data. Pink, down-regulated genes. Blue, up-regulated genes. (|log2(fold change)|>1 and padj <0.05). FC, fold change. (J, K) Gene ontology (GO) analysis of differentially expressed genes. Up-regulated pathways (J). Down-regulated pathways (K). DEGs, differentially expressed genes. (L) Heatmap illustrating gene expression changes of critical signaling pathways. Color tints correspond to expression levels. *padj <0.05. **padj <0.01. ***padj <0.001. (M) Western blot quantification of c-ABL expression on D5 cell lyses (n = 3). *p<0.05; two-tailed Student’s t test. (N) Western blot quantification of NOTCH1 expression on D5 cell lyses (n = 3). **p<0.01; two-tailed Student’s t test. (O) qPCR quantification analyses of SHH signaling target genes and SHF marker expression at D5 (n = 3 for each group). *p<0.05, **p<0.01; two-tailed Student’s t test. (P) Representative images of immunofluorescent staining of D15 cells with anti-cardiac troponin T(cTnT, green) antibody. (Q) Quantification of cTnT+ cells (n = 6). **p<0.01; two-tailed Student’s t test.

Figure 1—figure supplement 1
Characterization of shRNA-SORBS2 hESCs.

(A) Quantification of SORBS2 expression level in shRNA-SORBS2 human embryonic stem cells (hESCs) (n = 3). **p<0.01; two-tailed Student’s t test. (B–D) Quantification of pluripotential marker expression (n = 3). Two-tailed Student’s t test. (E) Immunostaining of hESCs with anti-NANOG, anti-OCT4, anti-SOX2, and anti-TRI1-60 antibodies (green). (F) Representative image of terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining of hESCs and quantification. Hpf, high-power field.

Figure 1—figure supplement 2
In vitro cardiogenesis from hESCs.

(A) Cell morphological transition during cardiomyocyte differentiation. (B) Immunostaining of D30 cells with anti-cardiac troponin I (cTnI, red) and anti-α-actinin (green) antibodies.

Figure 1—figure supplement 3
Cardiomyocyte defects in SORBS2-knockdown cells.

(A) Transmission electron microscopy images of D30 cardiomyocytes. ZL, Z line. (B–E) qPCR quantificaiton of cardiomyocyte marker expression at different differentiation time points (n = 3 for each time point). *p<0.05, **p<0.01; two-tailed Student’s t test. (F) Representative action potentials of human embryonic stem cell (hESC)-derived ventricular-like cardiomyocytes. (G–J) Quantification of action potential parameters of ventricular-like cardiomyocytes (control, n = 6; SORBS2-knockdown, n = 6). Frequency (G), action potential duration (H), the peak amplitude (I), and the resting membrane potential (J).

Figure 1—figure supplement 4
Molecular profiling of SORBS2-knockdown hESC-derived mesoderm and cardiac progenitors.

(A–B) qPCR quantification of mesoderm marker expression at different differentiation time points (n = 3). Two-tailed Student’s t test. (C–E) qPCR quantification of cardiac progenitor marker expression at different differentiation time points (n = 3). *p<0.05, **p<0.01; two-tailed Student’s t test. (F–G) qPCR verification of differentially expressed genes in RNA-seq (n = 3). *p<0.05, **p<0.01; two-tailed Student’s t test.

Cardiac phenotype of Sorbs2-/- mice.

(A) Gross view of embryos at E18.5. (B) Hematoxylin and eosin (HE)-stained paraffin sections of E18.5 hearts in conotruncal area. (C) HE-stained paraffin sections of E18.5 heart in atrial septum area. Asterisk indicates the absence of PAS. Two sections in the right are from the same heart with double atrial septum. The rightmost section is dorsal to the other. (D) HE-stained paraffin sections of E10.5 embryos. Arrow indicates DMP in the atria. Red asterisk indicates hypoplastic DMP in Sorbs2-/- embryos. Double-headed arrow indicates a duplicated DMP in an Sorbs2-/- embryo. Two sections in the right are from the same embryo with duplicated DMP. The rightmost section is lateral to the other. AO, aorta. PT, pulmonary trunk. LSA, left subclavian artery. RSA, right subclavian artery. LCA, left common carotid artery. RCA, right common carotid artery. LA, left atrium. RA, right atrium. LV, left ventricle. RV, right ventricle. PAS, primary atrial septum. AAS, accessory atrial septum. IVS, interventricular septum. DMP, dorsal mesenchymal protrusion.

Figure 3 with 1 supplement
Molecular changes in Sorbs2 mutants.

(A) qPCR quantification of Sorbs2, Hey1, Heyl, Ptch1, and Gli1 expression (n = 5 for wild-type and heterozygous groups, n = 13 for homozygous group). **p<0.01, *p<0.05; two-tailed Student’s t test. (B) Principal component analysis (PCA) plot of RNA-seq data shows sample clustering according to genotypes. (C) Gene ontology (GO) analysis of genes down-regulated in heterozygous mutants (Het). (D) GO analysis of genes down-regulated in homozygous mutants (Hom). (E) Hierarchical heatmap of cardiac genes. (F) Hierarchical heatmap of posterior second heart field (SHF) markers. (G) RNA in situ hybridization of Tbx5 on E10.5 embryos. (H) RNA in situ hybridization of Hoxb1 on E10.5 embryos. (I) Hierarchical heatmap of Notch and Shh signaling genes. (J) RNA in situ hybridization of Heyl probe on E10.5 embryos. (K) Western blot quantification of c-Abl expression in E10 embryos. *p<0.05; two-tailed Student’s t test. (L) Western blot quantification of Notch1 expression in E10.5 embryos. *p<0.05; two-tailed Student’s t test. pSHF, posterior second heart field.

Figure 3—figure supplement 1
scRNA-seq analysis of Sorbs expression pattern in embryonic hearts.

(A) Clustering analysis of single-cell transcriptomic profiles from E9.25 to E10.5 mouse embryonic hearts. Myocardium and cardiac progenitor (CP) cells were plotted in uniform manifold approximation and projection (UMAP). (B) Subgroups ordered in a phylogenetic tree. Subgroups were grouped into two populations, myocardium and cardiac progenitors. (C) Stack plot showing relative cell number grouped by developmental stages. (D) Dot plot showing marker gene expressions in myocardium and CP. (E) Sorbs2-expressing cells during heart development. A subgroup of Sorbs2-expressing cells is CP (subgroup 6). (F) Sorbs2 expression level in each subgroup. Sorbs2-expressing cells are located within CP subgroup 6, which also expresses Isl1 and Tbx1. Pink arrowheads indicate CP subgroup 6. Ryr2-expressing cells are cardiomyocytes.

Figure 4 with 1 supplement
Rare SORBS2 variants are enriched in CHD patients.

(A) Descriptive statistics of the identified exonic variants. (B) Manhattan plot of gene-level Fisher’s exact test of rare damaging variant counts between congenital heart disease (CHD) and control groups. Raw p-values of 0.05 and 0.01 are indicated by a blue line and a grey dash line, respectively. Genes (SORBS2, KMT2D) with a q-value lower than 0.2 are highlighted in red. Genes (EVC2, SH3PXD2B) with p<0.05 but q>0.2 are highlighted in green. (C) Illustration of rare damaging variants in SORBS2. Most variants are indicated in the longest SORBS2 isoform (SORBS2-201). Three isoform-specific variants are shown in the corresponding exons. Variants in CHD and control groups are indicated by orange and pink dots, respectively. Variants appearing in both groups are indicated by grey dots. (D) Representative images of immunofluorescent staining of HEK293 cells transfected with EGFP-tagged SORBS2 (isoform 206) or variants. Amino acid coding in the bracket is the sequence numbering of isoform 201. Red, phalloidin staining.

Figure 4—figure supplement 1
Ethnic background comparison of CHD and control groups.

Principal component analysis (PCA) plot of population structure with the top two principle components (PC1: principle component 1; PC2: principle component 2). Congenital heart disease (CHD) and control samples are clustered together in PCA of single nucleotide polymorphism (SNP) genotype.

Videos

Video 1
Beating D20 control cardiomyocytes.
Video 2
Beating D20 shRNA-SORBS2-1 cardiomyocytes.
Video 3
Beating D20 shRNA-SORBS2-2 cardiomyocytes.

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
AntibodyAnti-c-ABL (rabbit polyclonal)AbclonalA0282(1:1000)
RRID:AB_2757094
AntibodyAnti-Notch1 (rabbit monoclonal)Cell Signaling Technology3608 s(1:1000)
RRID:AB_2153354
AntibodyAnti-GAPDH (mouse monoclonal)Abcamab8245(1:1000)
RRID:AB_2107448
AntibodyAnti-Rabbit IgG (HRP) (goat polyclonal)Abcamab6721(1:5000)
RRID:AB_955447
AntibodyAnti-Mouse IgG (HRP)(goat polyclonal)Abcamab205719(1:5000)
RRID:AB_2755049
AntibodyAnti-TRA-1–60 (mouse monoclonal)Abcamab16288(1:200)
RRID:AB_778563
AntibodyAnti-Oct4 (rabbit polyclonal)Abcamab18976(1:200)
RRID:AB_444714
AntibodyAnti-SOX2
(rabbit monoclonal)
Abcamab92494(1:200)
RRID:AB_10585428
AntibodyAnti-Cardiac Troponin I (mouse monoclonal)Abcamaab92408(1:200)
RRID:AB_10562928
AntibodyAnti-α-Actinin (mouse monoclonal)SigmaA5044(1:200)
RRID:AB_476737
AntibodyAnti-mouse IgG, Alexa Fluor 488 (goat polyclonal)InvitrogenA11029(1:1000)
RRID:AB_138404
AntibodyAnti-rabbit IgG, AlexaFluor 633 (goat polyclonal)InvitrogenA21071(1:1000)
RRID:AB_2535732
AntibodyAnti-Cardiac Troponin T (mouse monoclonal)Abcamab8295(1:200)
RRID:AB_306445
AntibodyFITC Anti-Cardiac Troponin T (mouse monoclonal)Abcamab105439(1:100)
RRID:AB_10866306
Transfected construct (human)Lentivirus:
SORBS2-shRNA-psPAX2- pMD2.G
AddgenepsPAX2 (12260, Addgene) pMD2.G (12259, Addgene)Lentiviral construct to transfect and express the shRNA
Cell line (Homo sapiens)H1 hESC lineThis paperH1 hESC line-P21Provided by Chen's lab in Shanghai Institute of Biochemistry and Cell Biology
(RRID:CVCL_9771)
Cell line (Homo sapiens)ShRNA-SORBS2-H1-hESCThis paperGenerated in Zhang's lab from Shanghai children's medical center
Software, algorithmClampfit 10.5/Origin 8.0OriginLab, Northampton, MA, USARRID:SCR_014212
Software, algorithmImage JSchneider et al., 2012https://imagej.nih.gov/ij/RRID:SCR_003070
Software, algorithmRR Core Team, 2014https://www.r-project.org/RRID:SCR_001905
Software, algorithmBurrows-Wheeler AlignerLi and Durbin, 2009v0.7.17RRID:SCR_010910
Software, algorithmPicard ToolsBroad Institutev2.21.8RRID:SCR_006525
Software, algorithmGATKBroad Institutev3.8RRID:SCR_001876
Software, algorithmSamtoolsLi and Durbin, 2009v1.9RRID:SCR_002105
Software, algorithmAnnovarWang et al., 2010v2019Oct24RRID:SCR_012821
Biological sample (Homo sapiens)Peripheral bloodThis paperIsolated from of 300 children with complex CHD from Shanghai Children's Medical Center
Sequence-based reagentPrimers for RT-PCRThis paperSequences are provided inSupplementary file 13
Sequence-based reagentSORBS2-shRNA plasmid vectors (U6-MCS-Ubiquitin-Cherry-IRES-puromycin)Shanghai Genechem CoGIEE0117834shRNA-1 and shRNA-2 are 5′-TCCTTGTATCAGTCCTCTA-3′ and 5′-TCGATTCCACAGACACATA-3′, respectively
Sequence-based reagentIn situ probe for MouseTbx5This paperProvided by Dr. Lo's lab in University of Pittsburgh
Sequence-based reagentIn situ probe for MouseHeylThis paperGenerated in house. Primers: F-5’ GCCAGGAGCATAGTCCCAAT, R-5’ GGCCCTCAACCCACTCCATGAC
Sequence-based reagentIn situ probe for MouseHoxb1This paperGenerated in house. Primers: F−5’ TTCCTTTTTAGAGTACCCACTTTG, R-5’ GTTTCTCTTGACCTTCATCCAGTC
Commercial assay or kitIllumina Genome Analyzer IIx platformIllumina
Commercial assay or kitAgilent SureSelect Capture panelAgilent
Commercial assay or kitReverse Transcription KitTakaraRR037A
Commercial assay or kitSYBR Fast qPCR MixTakaraRR430A
Commercial assay or kitTUNEL stainingYeasen BiotechT18120
Commercial assay or kitAccutaseStem cell Technologies7920
Commercial assay or kitTRizol reagentThermo Fisher Scientific15596018
Commercial assay or kitOCTThermo Fisher Scientific6502
Commercial assay or kitMatrigelBD Biosciences354277
Commercial assay or kitTeSR-E8 mediumStem cell
Technologies
05840
Commercial assay or kitRPMI 1640GibcoC14065500
Commercial assay or kitL-ascorbic acid 2-phosphateSigma113170-55-1213 µg/ml
Commercial assay or kitOryza sativa-derived recombinant human albuminHealthgen Biotechnology CorpHY100M1500 µg/ml
Commercial assay or kitCHIR99021Stem cell
Technologies
720526 μM
Commercial assay or kitWnt-C59Peprotech Biogems12489132 μM
Commercial assay or kitRecombinant SHH proteinSinobiological10372-H08H1
Commercial assay or kitRIPA bufferBeyotimeP0013B
OtherB6.C-Tg(CMV-cre)1Cgn/Jmice/C57This paperJackson lab
(RRID:IMSR_JAX:006054)
OtherSorbs2 flox/flox mice/C57This paperGifts from Dr. Guoping Feng’s lab
(RRID:IMSR_JAX:028600)
Author response table 1
Gene nameBase
Mean
Log2FoldChangeLfcSEStatpvaluepadj
GATA47197.3090.3300430.0784224.2085282.57E-050.000904
TBX21295.3330.583540.1227264.7548281.99E-060.000111
Author response table 2
Gene nameBase
Mean
Log2FoldChangeLfcSEStatpvaluepadj
TBX1721.4109-0.998580.116671-8.558971.14E-171.15E-14
ISL12401.652-0.389960.091506-4.261572.03E-050.000749
CXCR4145.2801-0.911790.213437-4.271941.94E-050.000723
MEF2C1242.792-0.228040.107697-2.117410.0342250.216401

Additional files

Supplementary file 1

Down-regulated genes in SORBS2-knockdown D5 cells for GO analysis.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp1-v1.xlsx
Supplementary file 2

Up-regulated genes in SORBS2-knockdown D5 cells for GO analysis.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp2-v1.xlsx
Supplementary file 3

Genotyping distribution in embryos from Sorbs2+/- mouse intercross.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp3-v1.docx
Supplementary file 4

Down-regulated genes in E10.5 Sorbs2+/- embryos for GO analysis.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp4-v1.csv
Supplementary file 5

Down-regulated genes in E10.5 Sorbs2-/- embryos for GO analysis.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp5-v1.csv
Supplementary file 6

Number of exonic variants detected in CHD and normal controls.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp6-v1.docx
Supplementary file 7

Carriers of rare damaging variants in CHD and normal controls.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp7-v1.docx
Supplementary file 8

CHD patients with rare SORBS2 variants.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp8-v1.xlsx
Supplementary file 9

Cardiac phenotype in patients carrying SORBS2 variants.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp9-v1.docx
Supplementary file 10

Primers for qPCR.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp10-v1.docx
Supplementary file 11

Subphenotypes of CHD cohort.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp11-v1.docx
Supplementary file 12

Known CHD genes included in targeted sequencing panel.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp12-v1.docx
Supplementary file 13

Candidate CHD genes included in targeted sequencing panel.

https://cdn.elifesciences.org/articles/67481/elife-67481-supp13-v1.docx
Transparent reporting form
https://cdn.elifesciences.org/articles/67481/elife-67481-transrepform-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)