SORBS2 is a genetic factor contributing to cardiac malformation of 4q deletion syndrome patients
- Neonatal Intensive Care Unit, Shanghai Pediatric Congenital Heart Disease Institute and Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
- Shanghai Pediatric Congenital Heart Disease Institute and Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
- Shanghai Key Laboratory of Clinical Molecular Diagnostics for Pediatrics, Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
- Key Laboratory of Pediatric Hematology and Oncology Ministry of Health and Pediatric Translational Medicine Institute, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
- Department of thoracic and cardiac surgery, Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine, China
Abstract
Chromosome 4q deletion is one of the most frequently detected genomic imbalance events in congenital heart disease (CHD) patients. However, a portion of CHD-associated 4q deletions without known CHD genes suggests unknown CHD genes within these intervals. Here, we have shown that knockdown of SORBS2, a 4q interval gene, disrupted sarcomeric integrity of cardiomyocytes and caused reduced cardiomyocyte number in human embryonic stem cell differentiation model. Molecular analyses revealed decreased expression of second heart field (SHF) marker genes and impaired NOTCH and SHH signaling in SORBS2-knockdown cells. Exogenous SHH rescued SORBS2 knockdown-induced cardiomyocyte differentiation defects. Sorbs2-/- mouse mutants had atrial septal hypoplasia/aplasia or double atrial septum (DAS) derived from impaired posterior SHF with a similar expression alteration. Rare SORBS2 variants were significantly enriched in a cohort of 300 CHD patients. Our findings indicate that SORBS2 is a regulator of SHF development and its variants contribute to CHD pathogenesis. The presence of DAS in Sorbs2-/- hearts reveals the first molecular etiology of this rare anomaly linked to paradoxical thromboembolism.
Introduction
Copy number variation (CNV) is a common structural variation in human genome and causes a variety of genetic syndromes. The identification of causal disease gene(s) within CNV intervals is crucial to understand the pathogenesis of the related disease. Chromosome 4q deletion syndrome is a genetic disease resulting from a chromosomal aberration that causes the missing of a portion of chromosome four long arm (Strehle and Bantock, 2003). Patients have a spectrum of clinical manifestations including craniofacial, cardiovascular, and gastrointestinal abnormalities, and mental and growth deficiencies (Strehle and Bantock, 2003). Congenital heart disease (CHD) is a common defect seen in about half of the 4q deletion patients. A previous study narrowed the cardiovascular critical region to 4q32.2–q34.3, which contains TLL1, HPGD, and HAND2 genes (Xu et al., 2012). Over-represented right-sided CHDs in 4q deletion syndrome patients suggest that HAND2, an essential regulator of the second heart field (SHF), is mainly responsible for the CHD phenotype (Xu et al., 2012; Huang et al., 2002). However, a part of terminal 4q deletions with CHDs that we and others have discovered does not cover HAND2(Geng et al., 2014; Strehle et al., 2012; Tsai et al., 1999). SORBS2 within chromosomal 4q35.1 has been proposed as a candidate gene for CHD of terminal 4q deletion syndrome based on an unusual small interstitial deletion (Strehle et al., 2012). However, there has been no further evidence to substantiate it ever since. Here, we have presented evidence from in vitro cardiogenesis, animal model, and mutation analyses to demonstrate that SORBS2 is a genetic factor regulating cardiac development and contributing to cardiac malformation of the CHD population.
Results
SORBS2 is required for cardiomyocyte differentiation and the integrity of sarcomeric structure
To recapitulate SORBS2 haploinsufficiency of 4q deletion, we knocked down SORBS2 in human embryonic stem cell lines (H1-hESC). We used two different short hairpin RNAs (shRNAs) to knock down SORBS2, and similar knockdown efficiencies (~40% of wild-type expression level) were achieved (Figure 1—figure supplement 1A). SORBS2 knockdown did not affect clone morphology, pluripotency marker expression, and apoptosis of human embryonic stem cells (hESCs) (Figure 1—figure supplement 1B–1F). After in vitro cardiac differentiation (Burridge et al., 2014; Figure 1—figure supplement 2A), spontaneous beating started to appear at differentiation day 8 (D8) in both control and SORBS2-knockdown cells, but differentiated SORBS2-knockdown cardiomyocytes contracted much weaker (Videos 1–3). Since SORBS2-knockdown embyonic stem cells from different shRNAs had similar phenotypes (Figure 1—figure supplement 2B, Videos 1–3), we only used SORBS2-shRNA1 for further analyses.
Video 1
Beating D20 control cardiomyocytes.
Video 2
Beating D20 shRNA-SORBS2-1 cardiomyocytes.
Video 3
Beating D20 shRNA-SORBS2-2 cardiomyocytes.
The cardiomyocyte differentiation efficiency (the proportion of cTnT+ cells) was significantly decreased in SORBS2-knockdown group at D15 (Figure 1A–B). Since SORBS2 is a structural component of sarcomeric Z-line and cardiomyopathy gene (Ding et al., 2020; Li et al., 2020; Sanger et al., 2010), we examined the myofibril structure of differentiated cardiomyocytes. Most cardiomyocytes in SORBS2-knockdown group presented a round or oval shape instead of polygonal or spindle-like outlines in control group, and a close lookup indicated that sarcomeric structure in cells with abnormal shapes was disrupted (Figure 1C). The percentage of cardiomyocytes with well-organized sarcomeres and a normal shape was much lower in SORBS2-knockdown group (Figure 1D). Disrupted sarcomeric structures in SORBS2-knockdown cardiomyocytes were also present in transmission electron microscopy analysis (Figure 1—figure supplement 3A). The expression of sarcomeric genes TNNT2, MYL7, MYH6, and MYH7 was significantly decreased (Figure 1—figure supplement 3B–3E).
Figure 1 with 4 supplements see all
SORBS2 has a dual role in cardiogenesis.
(A) Flow cytometry analysis of cardiomyocytes at differentiation day 15 (D15). P3 indicates cTnT+ population. (B) Quantification of cTnT+ cells (n = 3). **p<0.01; two-tailed Student’s t test. (C) Immunostaining of D30 cells with anti-cardiac troponin I (cTnI, red) and anti-α-actinin (green) antibodies. Boxed areas are magnified in the lower panels. (D) Quantification of cardiomyocytes with well-organized sarcomeres (control: n = 211, SORBS2-knockdown: n = 197). **p<0.01; two-tailed Student’s t test. (E) qPCR quantification of SORBS2 expression dynamics (n = 3 for each time point). **p<0.01; two-tailed Student’s t test. (F–H) qPCR quantification of second heart field (SHF) progenitor marker expression at different time points (n = 3 for each time point). *p<0.05, **p<0.01; two-tailed Student’s t test. (I) Volcano plot illustrates the differential gene expression from D5 RNA-seq data. Pink, down-regulated genes. Blue, up-regulated genes. (|log2(fold change)|>1 and padj <0.05). FC, fold change. (J, K) Gene ontology (GO) analysis of differentially expressed genes. Up-regulated pathways (J). Down-regulated pathways (K). DEGs, differentially expressed genes. (L) Heatmap illustrating gene expression changes of critical signaling pathways. Color tints correspond to expression levels. *padj <0.05. **padj <0.01. ***padj <0.001. (M) Western blot quantification of c-ABL expression on D5 cell lyses (n = 3). *p<0.05; two-tailed Student’s t test. (N) Western blot quantification of NOTCH1 expression on D5 cell lyses (n = 3). **p<0.01; two-tailed Student’s t test. (O) qPCR quantification analyses of SHH signaling target genes and SHF marker expression at D5 (n = 3 for each group). *p<0.05, **p<0.01; two-tailed Student’s t test. (P) Representative images of immunofluorescent staining of D15 cells with anti-cardiac troponin T(cTnT, green) antibody. (Q) Quantification of cTnT+ cells (n = 6). **p<0.01; two-tailed Student’s t test.
The weakened beating force of SORBS2-knockdown cardiomyocytes might be derived from abnormal electrophysiology. To this end, we examined the electrical activities of dissociated D30 cardiomyocytes by patch clamping. The dominant type of cardiomyocytes is ventricular-like in both control and SORBS2-knockdown groups (Figure 1—figure supplement 3F). Statistical analyses on action potential parameters of ventricular-like cells, including average action potential (AP) duration at 90% repolarization, average AP frequency, peak amplitude, and resting potential, showed no difference between two groups (Figure 1—figure supplement 3G–3J).
SORBS2 knockdown decreased the expression of SHF marker genes
Having shown the reduced efficiency of cardiomyocyte differentiation in SORBS2-knockdown group, we hypothesized that SORBS2 had an early role in cardiomyocyte differentiation. Expression dynamics showed that SORBS2 was up-regulated at cardiac progenitor stage D5 after a transient absence at mesodermal cell stage (D2-D3) (Figure 1E). Consistently, SORBS2-knockdown group disrupted the expression of cardiac progenitor markers, whereas mesodermal markers remained unchanged (Figure 1F–H, Figure 1—figure supplement 4A–4E). There are two sets of molecularly distinct cardiac progenitors during mammalian heart development, referred to as the first and second heart fields (FHF and SHF), which contribute to distinct anatomical structures of the heart (Srivastava, 2006). Interestingly, we found significantly increased expression of FHF markers (TBX5, HCN4, HAND1) (Figure 1—figure supplement 4C–4E) while significantly decreased expression of SHF markers (TBX1, ISL1, MEF2C) in SORBS2-knockdown cells (Figure 1F–H). SHF gives rise to cardiac outflow, right ventricle, and inflow (Kelly, 2012). Any defect in these embryonic structures leads to CHDs commonly seen in 4q deletion syndrome.
SORBS2 knockdown decreased NOTCH and SHH signaling
To understand how SORBS2 regulates SHF progenitor commitment, we collected D5 cells for RNA-seq. Using a stringent threshold (padj <0.05, |log2(fold change)|>1), we selected out 160 down-regulated and 104 up-regulated genes for gene ontology (GO) analysis (Figure 1I, Supplementary file 1–2). Results showed that the up-regulated genes were enriched in biological processes like cell adhesion and so on (Figure 1J), which might be a compensatory reaction to reduced SORBS2 as a cytoskeleton component. The down-regulated genes were enriched in biological processes like heart development and so on (Figure 1K), suggesting that SORBS2 positively regulates cardiac development. Particularly, we noted the NOTCH signaling pathway in the down-regulated list (Figure 1K–L). We verified the expression of NOTCH signaling target genes HEY1, HEYL, and NRARP by qPCR (Figure 1—figure supplement 4F). In contrast, we did not see differential expression for NOTCH1 in RNA-seq (Figure 1L), suggesting that the regulation of SORBS2 on NOTCH signaling might be through modulating protein level. SORBS2 can interact with the non-receptor tyrosine kinase c-ABL as SH3 domain-containing adaptor (Kioka et al., 2002). The binding of SORBS2 to c-ABL triggers the recruitment of ubiquitin ligase CBL and leads to the ubiquitination of c-ABL (Soubeyran et al., 2003). Indeed, we noted that c-ABL protein level was significantly elevated in SORBS2-knockdown cells (Figure 1M). c-Abl can promote Notch endocytosis to modulate Notch signaling (Xiong et al., 2013). Consistently, NOTCH1 protein level decreased significantly in SORBS2-knockdown cells (Figure 1N). Notch signaling is a well-known molecular mechanism enhancing cellular response to Shh (Stasiulewicz et al., 2015). We noted that the expression of SHH and SHH signaling targets, PTCH1 and GLI1, was also reduced in SORBS2-knockdown cells (Figure 1—figure supplement 4G). We applied recombinant SHH protein to check whether it can rescue defects caused by SORBS2 knockdown. As expected, exogenous SHH activated PTCH1 and GLI1 expression (Figure 1O). It also up-regulated the expression of SHF markers ISL1 and MEF2C in D5 SORBS2-shRNA1 cells (Figure 1O) and rescued cardiomyocyte differentiation efficiency with more cells presenting a polygonal or spindle-like shape (Figure 1P and Q).
Sorbs2-/- mice have atrial septal defect and defective dorsal mesenchyme protrusion
Since the entire SORBS2 gene is absent in terminal 4q deletion, we used Sorbs2 knockout mice to examine its role in cardiac development. In a previous report, about 40–60% Sorbs2-/- mice died within 1 week after birth (Zhang et al., 2016), indicating a possible structural heart defect(s). To this end, we collected 137 embryos at E18.5. The ratio of genotype distribution among embryos was consistent with Mendel's law (Supplementary file 3), suggesting no embryo loss in early development stage. We dissected 30 Sorbs2-/- embryos, and none of them showed conotruncal defect or ventricular septal defect (Figure 2A–B). However, we found that about 40% (12/30) Sorbs2-/- hearts had atrial septal defect (ASD) with 10 being the absence/hypoplaisa of primary septum and two being double atrial septum (DAS) (Figure 2C, Supplementary file 3). The penetrance of ASD is similar to the ratio of reported postnatal lethality, indicating that ASD might contribute to early postnatal death.
Figure 2
Cardiac phenotype of Sorbs2-/- mice.
(A) Gross view of embryos at E18.5. (B) Hematoxylin and eosin (HE)-stained paraffin sections of E18.5 hearts in conotruncal area. (C) HE-stained paraffin sections of E18.5 heart in atrial septum area. Asterisk indicates the absence of PAS. Two sections in the right are from the same heart with double atrial septum. The rightmost section is dorsal to the other. (D) HE-stained paraffin sections of E10.5 embryos. Arrow indicates DMP in the atria. Red asterisk indicates hypoplastic DMP in Sorbs2-/- embryos. Double-headed arrow indicates a duplicated DMP in an Sorbs2-/- embryo. Two sections in the right are from the same embryo with duplicated DMP. The rightmost section is lateral to the other. AO, aorta. PT, pulmonary trunk. LSA, left subclavian artery. RSA, right subclavian artery. LCA, left common carotid artery. RCA, right common carotid artery. LA, left atrium. RA, right atrium. LV, left ventricle. RV, right ventricle. PAS, primary atrial septum. AAS, accessory atrial septum. IVS, interventricular septum. DMP, dorsal mesenchymal protrusion.
A major part of atrial septum is derived from dorsal mesenchyme protrusion (DMP) originated from posterior SHF (Kelly, 2012). Our previous data indicates that SORBS2 knockdown impaired the in vitro differentiation of SHF progenitors. We also noted DMP malformation in 5 out of 15 E10.5 Sorbs2-/- embryos. The majority of them had DMP aplasia/hypoplasia (n = 4), whereas one of them had duplicated DMP (Figure 2D). The dichotomy of DMP morphology is consistent with two opposite ASD phenotypes seen in E18.5 embryos. Overall, the in vivo phenotype of Sorbs2-/- mice further supports that SORBS2 haploinsufficiency in 4q deletion contributes to CHD pathogenesis through affecting SHF development.
SORBS2 deficiency-induced molecular changes are highly conserved in mice
To examine Sorbs2 expression pattern in early mouse embryos, we pooled publicly available single-cell transcriptomic profiles from E9.25 to 10.5 mouse embryonic hearts (de Soysa et al., 2019; Hill et al., 2019). We identified nine subgroups as cardiac progenitors or cardiomyocytes and noted that Sorbs2 is highly expressed in cardiomyocytes and in a subgroup of cardiac progenitors that also express Isl1 and Tbx1 (Figure 3—figure supplement 1).
We used qPCR to validate molecular findings of hESCs in E10.5 mouse embryos. Since the penetrance of cardiac phenotype is about 40%, we increased the number of Sorbs2-/- embryos according to this ratio. Consistent with hESC differentiation results, we detected significantly down-regulated expression in three out of four Notch and Shh signaling target genes (Hey1, Heyl, and Ptch1) (Figure 3A). Multivariate PERMANOVA (permutational multivariate analysis of variance) revealed a significant combined difference in Notch and Shh signaling target expression between wild-type and Sorbs2-/- embryos (p<0.009).
Figure 3 with 1 supplement see all
Molecular changes in Sorbs2 mutants.
(A) qPCR quantification of Sorbs2, Hey1, Heyl, Ptch1, and Gli1 expression (n = 5 for wild-type and heterozygous groups, n = 13 for homozygous group). **p<0.01, *p<0.05; two-tailed Student’s t test. (B) Principal component analysis (PCA) plot of RNA-seq data shows sample clustering according to genotypes. (C) Gene ontology (GO) analysis of genes down-regulated in heterozygous mutants (Het). (D) GO analysis of genes down-regulated in homozygous mutants (Hom). (E) Hierarchical heatmap of cardiac genes. (F) Hierarchical heatmap of posterior second heart field (SHF) markers. (G) RNA in situ hybridization of Tbx5 on E10.5 embryos. (H) RNA in situ hybridization of Hoxb1 on E10.5 embryos. (I) Hierarchical heatmap of Notch and Shh signaling genes. (J) RNA in situ hybridization of Heyl probe on E10.5 embryos. (K) Western blot quantification of c-Abl expression in E10 embryos. *p<0.05; two-tailed Student’s t test. (L) Western blot quantification of Notch1 expression in E10.5 embryos. *p<0.05; two-tailed Student’s t test. pSHF, posterior second heart field.
To have a view of transcriptomic changes in Sorbs2 mutants, we performed RNA-seq on E10.5 wild-type Sorbs2+/- and Sorbs2-/- embryos. Principal component analysis (PCA) indicates that wild-type embryos are clustered together, whereas Sorbs2-/- embryos are more scattered (±), which is consistent with diverged cardiac phenotypes of Sorbs2-/- embryos. Interestingly, the majority of Sorbs2+/- samples are juxtaposed more closely to Sorbs2-/- embryos in PCA plot, indicating a molecular phenotype in heterozygous mutants. We selected genes significantly down-regulated in heterozygous mutants (log2(fold change)>0.25, p<0.05) to perform GO analysis and found that these genes are enriched in pathways involved in muscle development and embryonic morphogenesis (Figure 3C, Supplementary file 4). Using the same threshold, we selected genes significantly down-regulated in homozygous mutants to perform GO analysis. These genes are enriched in pathways regulating heart development, myofibril assembly, and cardiac septum development (Figure 3D, Supplementary file 5). Particularly, the Notch signaling pathway was also in the enrichment list. Looking closer, we noted that genes involved in cardiac development, myofibril assembly, and contraction force were down-regulated in nearly all the homozygous mutants (Figure 3E). The decrease of posterior SHF marker genes was less general but still clearly down-regulated in the majority of Sorbs2-/- embryos (Figure 3F). Decreased Tbx5 (n = 3) and Hoxb1 (n = 3 out of 4) expression in posterior SHF of Sorbs2-/- embryos was validated by RNA in situ hybridization (Figure 3G and H). A portion of embryos had obvious down-regulation of Notch and Shh signaling targets (Figure 3I), which is consistent with a low penetrance of ASD in homozygous mutants. RNA in situ hybridization confirmed decreased Heyl expression in posterior SHF of Sorbs2-/- embryos (n = 1; Figure 3J). Next, we verified the upstream molecular changes of Notch signaling found in hESC differentiation model. Indeed, we noted that Notch1 expression level significantly decreased whereas c-ABL significantly increased in Sorbs2-/- embryos (Figure 3K–L).
Rare SORBS2 variants are significantly enriched in CHD patients
Rare genetic variants play a significant role in CHD occurrence (Blue et al., 2017), hence we used a rare variant association to help identify genes within CNVs responsible for CHDs. Besides 23 candidate CNV genes containing SORBS2, the targeted panel also includes 81 known CHD genes from literature. Targeted sequencing was performed on 300 complex CHD cases (two cases removed due to low-quality data). 220 Han Chinese descents from the 1000 genome project were used as controls. The ethnicity of these two groups was matched by PCA (Figure 4—figure supplement 1). A total of 1560 exonic variants from CHD and control groups passed quality control and were included for further analyses (Figure 4A). Variant distribution in the breakdown categories of CHD and control groups is shown in Supplementary file 6.
Figure 4 with 1 supplement see all
Rare SORBS2 variants are enriched in CHD patients.
(A) Descriptive statistics of the identified exonic variants. (B) Manhattan plot of gene-level Fisher’s exact test of rare damaging variant counts between congenital heart disease (CHD) and control groups. Raw p-values of 0.05 and 0.01 are indicated by a blue line and a grey dash line, respectively. Genes (SORBS2, KMT2D) with a q-value lower than 0.2 are highlighted in red. Genes (EVC2, SH3PXD2B) with p<0.05 but q>0.2 are highlighted in green. (C) Illustration of rare damaging variants in SORBS2. Most variants are indicated in the longest SORBS2 isoform (SORBS2-201). Three isoform-specific variants are shown in the corresponding exons. Variants in CHD and control groups are indicated by orange and pink dots, respectively. Variants appearing in both groups are indicated by grey dots. (D) Representative images of immunofluorescent staining of HEK293 cells transfected with EGFP-tagged SORBS2 (isoform 206) or variants. Amino acid coding in the bracket is the sequence numbering of isoform 201. Red, phalloidin staining.
Of the 847 nonsynonymous variants, 43.57% (n = 369) variants had a minor allele frequency (MAF) below 1% across ExAC database and were adjudicated as ‘damaging’ by at least two algorithms (PolyPhen2, SIFT, or MutationTaster). We applied gene-based statistic tests to evaluate the cumulative effects of rare damaging variants (MAF<1%) on CHDs. Genes with at least two rare damaging variants (n = 57) were included for analysis (Supplementary file 7). 4 out of 57 genes (SORBS2, KMT2D, EVC2, and SH3PXD2B) had a p-value lower than 0.05 (one-tailed Fisher’s exact) and two of them (SORBS2 and KMT2D) had a statistically significant mutation burden after the correction for multiple testing (q<0.20) (Figure 4B, Supplementary file 7). KMT2D is a well-known CHD gene (Ang et al., 2016; Jin et al., 2017). Our data indicate that rare SORBS2 variants have similar levels of enrichment in CHDs as the known CHD genes. The distribution of rare SORBS2 damaging variants in CHD patients spread throughout the gene (Figure 4C, Supplementary file 8). Although we didn’t detect SORBS2 nonsense variants in CHD patients, missense mutations identified in our cohort caused protein aggregation in cells (Figure 4D), suggesting an abnormal function of these variant proteins. A high prevalence (85%, 17/20) of ASD, the defect seen in Sorbs2-/- hearts, was observed in patients carrying SORBS2 variants (Supplementary file 9). In our CHD cohort, we noted a significant enrichment of SORBS2 rare damaging variants in patients with ASD (17 out of 183 ASD patients versus 3 out of 117 non-ASD patients, p=0.0306, Fisher's exact test). These data further support that SORBS2 contributes to CHD pathogenesis.
Discussion
The common CHDs in 4q deletion syndrome include ASD, ventricular septal defect (VSD), pulmonary stenosis/atresia, and tetralogy of Fallot and so on Strehle and Bantock, 2003; Lin et al., 1988. The affected structures are atrial septum and cardiac outflow tract, which are all derived from SHF (Kelly, 2012). Indeed, our data revealed that SORBS2 functions not only as a sarcomeric component to maintain cardiomyocyte function, but also as an adaptor protein to promote SHF progenitor commitment in in vitro cardiomyocyte differentiation. ASD is detected in Sorbs2-/- mouse hearts. It supports that Sorbs2 regulates SHF development in vivo and its role is conserved across species. In both models, we detected an increased protein level of NOTCH1 endocytosis facilitator c-ABL, a decreased NOTCH1 protein level, and impaired SHH signaling. Notch and Shh signaling is essential for SHF development (Paige et al., 2015). Notch signaling promotes Smo accumulation in cilia and enhances cellular response to Shh, placing Notch upstream of Shh signaling (Stasiulewicz et al., 2015; Kong et al., 2015). Therefore, SORBS2 might promote SHF progenitor fate through c-ABL/NOTCH/SHH axis. In addition, Tbx5 was also significantly down-regulated in posterior SHF of Sorb2 mutants. Tbx5-Hh molecular network is an essential regulatory mechanism in SHF for atrial septation (Xie et al., 2012). It is likely that Tbx5 downregulation also contributes to the pathogenesis of ASD through its effect on Hh signaling. Consistently, adding recombinant SHH protein is sufficient to rescue SHF marker gene expression and cardiomyocyte differentiation efficiency. However, TBX5 was up-regulated in D5 SORBS2-knockdown cells. It is likely that in vitro cardiomyocyte differentiation is a simplified model that cannot fully recapitulate the in vivo spatial and temporal information of various cardiac progenitors and, therefore, has less regulatory layers in which TBX5 may predominantly function as an FHF regulator. Indeed, Tbx5 knockdown reduces FHF progenitors and has no effect on SHF progenitors in an in vitro cardiogenesis model (Andersen et al., 2018).
Unlike human 4q deletion patients, Sorbs2-/- mice have no conotruncal defect and the penetrance of ASD is only 40%, indicating a relatively small effect of SORBS2 in CHD pathogenesis. The high penetrance of conotruncal defects in human 4q deletion patients may be due to genetic modifiers that, together with SORBS2 haploinsufficiency, cause the developmental defect in cardiac outflow tract. An obvious genetic modifier is the HAND2 gene, which is co-missing with SORBS2 in large 4q deletions. Previous studies have shown that CHD is observed more frequently in patients with the terminal deletion at 4q31 than in patients with the terminal deletion at 4q34 or 4q35 (Lin et al., 1988). Since some terminal 4q deletions that do not cover HAND2 still manifest conotruncal defects, there may be another genetic modifier in the terminal deletion region. Helt, whose human homologous HELT is located within 4q35.1, encodes a Hey-related bHLH transcription factor that is expressed in both the brain and heart, and mediates Notch signaling (Nakatani et al., 2004). Therefore, both SORBS2 and HELT haploinsufficiency might synergistically impair NOTCH signaling and cause a cardiac outlfow tract (OFT) defect.
DAS, also called Cor triatriatum type C in the original report (Thilenius et al., 1976), is a very rare CHD characterized by an extra septal structure to the right side of primary atrial septum (Roberson et al., 2006). This anatomic abnormality is implicated as a cause of paradoxical thromboembolic event to stroke or heart attack (Breithardt et al., 2006). However, its etiology and pathogenesis are entirely unknown. Here, we have shown that Sorbs2 deficiency can cause this abnormality. Interestingly, Cor triatriatum, another type of abnormal extra atrial septation, has been reported in a patient with a terminal 4q34.3 deletion (Marcì et al., 2015), which includes SORBS2 but not HAND2. It has been speculated that DAS might result from the persistence of embryologic structures or abnormal duplication of atrial septum. The impaired cardiogenesis in Sorbs2-/- mice suggests that the latter scenario may be the underlying pathogenesis.
Materials and methods
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-c-ABL (rabbit polyclonal) | Abclonal | A0282 | (1:1000) RRID:AB_2757094 |
| Antibody | Anti-Notch1 (rabbit monoclonal) | Cell Signaling Technology | 3608 s | (1:1000) RRID:AB_2153354 |
| Antibody | Anti-GAPDH (mouse monoclonal) | Abcam | ab8245 | (1:1000) RRID:AB_2107448 |
| Antibody | Anti-Rabbit IgG (HRP) (goat polyclonal) | Abcam | ab6721 | (1:5000) RRID:AB_955447 |
| Antibody | Anti-Mouse IgG (HRP)(goat polyclonal) | Abcam | ab205719 | (1:5000) RRID:AB_2755049 |
| Antibody | Anti-TRA-1–60 (mouse monoclonal) | Abcam | ab16288 | (1:200) RRID:AB_778563 |
| Antibody | Anti-Oct4 (rabbit polyclonal) | Abcam | ab18976 | (1:200) RRID:AB_444714 |
| Antibody | Anti-SOX2 (rabbit monoclonal) | Abcam | ab92494 | (1:200) RRID:AB_10585428 |
| Antibody | Anti-Cardiac Troponin I (mouse monoclonal) | Abcam | aab92408 | (1:200) RRID:AB_10562928 |
| Antibody | Anti-α-Actinin (mouse monoclonal) | Sigma | A5044 | (1:200) RRID:AB_476737 |
| Antibody | Anti-mouse IgG, Alexa Fluor 488 (goat polyclonal) | Invitrogen | A11029 | (1:1000) RRID:AB_138404 |
| Antibody | Anti-rabbit IgG, AlexaFluor 633 (goat polyclonal) | Invitrogen | A21071 | (1:1000) RRID:AB_2535732 |
| Antibody | Anti-Cardiac Troponin T (mouse monoclonal) | Abcam | ab8295 | (1:200) RRID:AB_306445 |
| Antibody | FITC Anti-Cardiac Troponin T (mouse monoclonal) | Abcam | ab105439 | (1:100) RRID:AB_10866306 |
| Transfected construct (human) | Lentivirus: SORBS2-shRNA-psPAX2- pMD2.G | Addgene | psPAX2 (12260, Addgene) pMD2.G (12259, Addgene) | Lentiviral construct to transfect and express the shRNA |
| Cell line (Homo sapiens) | H1 hESC line | This paper | H1 hESC line-P21 | Provided by Chen's lab in Shanghai Institute of Biochemistry and Cell Biology (RRID:CVCL_9771) |
| Cell line (Homo sapiens) | ShRNA-SORBS2-H1-hESC | This paper | Generated in Zhang's lab from Shanghai children's medical center | |
| Software, algorithm | Clampfit 10.5/Origin 8.0 | OriginLab, Northampton, MA, USA | RRID:SCR_014212 | |
| Software, algorithm | Image J | Schneider et al., 2012 | https://imagej.nih.gov/ij/ | RRID:SCR_003070 |
| Software, algorithm | R | R Core Team, 2014 | https://www.r-project.org/ | RRID:SCR_001905 |
| Software, algorithm | Burrows-Wheeler Aligner | Li and Durbin, 2009 | v0.7.17 | RRID:SCR_010910 |
| Software, algorithm | Picard Tools | Broad Institute | v2.21.8 | RRID:SCR_006525 |
| Software, algorithm | GATK | Broad Institute | v3.8 | RRID:SCR_001876 |
| Software, algorithm | Samtools | Li and Durbin, 2009 | v1.9 | RRID:SCR_002105 |
| Software, algorithm | Annovar | Wang et al., 2010 | v2019Oct24 | RRID:SCR_012821 |
| Biological sample (Homo sapiens) | Peripheral blood | This paper | Isolated from of 300 children with complex CHD from Shanghai Children's Medical Center | |
| Sequence-based reagent | Primers for RT-PCR | This paper | Sequences are provided inSupplementary file 13 | |
| Sequence-based reagent | SORBS2-shRNA plasmid vectors (U6-MCS-Ubiquitin-Cherry-IRES-puromycin) | Shanghai Genechem Co | GIEE0117834 | shRNA-1 and shRNA-2 are 5′-TCCTTGTATCAGTCCTCTA-3′ and 5′-TCGATTCCACAGACACATA-3′, respectively |
| Sequence-based reagent | In situ probe for MouseTbx5 | This paper | Provided by Dr. Lo's lab in University of Pittsburgh | |
| Sequence-based reagent | In situ probe for MouseHeyl | This paper | Generated in house. Primers: F-5’ GCCAGGAGCATAGTCCCAAT, R-5’ GGCCCTCAACCCACTCCATGAC | |
| Sequence-based reagent | In situ probe for MouseHoxb1 | This paper | Generated in house. Primers: F−5’ TTCCTTTTTAGAGTACCCACTTTG, R-5’ GTTTCTCTTGACCTTCATCCAGTC | |
| Commercial assay or kit | Illumina Genome Analyzer IIx platform | Illumina | ||
| Commercial assay or kit | Agilent SureSelect Capture panel | Agilent | ||
| Commercial assay or kit | Reverse Transcription Kit | Takara | RR037A | |
| Commercial assay or kit | SYBR Fast qPCR Mix | Takara | RR430A | |
| Commercial assay or kit | TUNEL staining | Yeasen Biotech | T18120 | |
| Commercial assay or kit | Accutase | Stem cell Technologies | 7920 | |
| Commercial assay or kit | TRizol reagent | Thermo Fisher Scientific | 15596018 | |
| Commercial assay or kit | OCT | Thermo Fisher Scientific | 6502 | |
| Commercial assay or kit | Matrigel | BD Biosciences | 354277 | |
| Commercial assay or kit | TeSR-E8 medium | Stem cell Technologies | 05840 | |
| Commercial assay or kit | RPMI 1640 | Gibco | C14065500 | |
| Commercial assay or kit | L-ascorbic acid 2-phosphate | Sigma | 113170-55-1 | 213 µg/ml |
| Commercial assay or kit | Oryza sativa-derived recombinant human albumin | Healthgen Biotechnology Corp | HY100M1 | 500 µg/ml |
| Commercial assay or kit | CHIR99021 | Stem cell Technologies | 72052 | 6 μM |
| Commercial assay or kit | Wnt-C59 | Peprotech Biogems | 1248913 | 2 μM |
| Commercial assay or kit | Recombinant SHH protein | Sinobiological | 10372-H08H1 | |
| Commercial assay or kit | RIPA buffer | Beyotime | P0013B | |
| Other | B6.C-Tg(CMV-cre)1Cgn/Jmice/C57 | This paper | Jackson lab (RRID:IMSR_JAX:006054) | |
| Other | Sorbs2 flox/flox mice/C57 | This paper | Gifts from Dr. Guoping Feng’s lab (RRID:IMSR_JAX:028600) |
Mouse lines and breeding
Request a detailed protocolMice were housed under specific pathogen-free conditions at the animal facility of Shanghai Children’s Medical Center. Sorbs2flox/flox mice (Zhang et al., 2016) were a gift from Dr. Guoping Feng’s lab (McGovern Institute for Brain Research, MIT, Cambridge). Sorbs2- allele was obtained by breeding Sorbs2flox allele into CMV-Cre mouse (Schwenk et al., 1995). The strains were backcrossed with C57BL/6 to maintain the lines ever since we obtained them. 2- to 6-month-old males and females were used for timed mating and embryos were collected at E18.5. Neither anesthetic nor analgesic agent was applied. CO2 gas in a closed chamber was used for euthanasia of pregnant dam and cervical dislocation was followed. Isolated fetuses were euthanized by cervical dislocation. Animal care and use were in accordance with the NIH guidelines for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee of Shanghai Children’s Medical Center (SCMC-LAWEC-2017006).
Histological analysis
Request a detailed protocolFor cardiac phenotype analysis, embryos were collected at E18.5 and E10.5, and were fixed in 10% formalin overnight. Isolated hearts were processed for paraffin embedding, sectioned at a thickness of 4 μm, and stained with hematoxylin and eosin. Stained sections were imaged using a Leica DM6000 microscope.
RNA in situ hybridization
Request a detailed protocolE10.5 embryos were collected and fixed in 4% paraformaldehyde (PFA) solution for 2 hr at room temperature, then dehydrated by 30% sucrose, and embedded in OCT (Thermo Fisher Scientific, 6502). 10 µm cryosections were used for RNA in situ hybridization (ISH) according to standard procedure. Tbx5 probe plasmid was a gift of Dr. Cecilia Lo (University of Pittsburgh). Hoxb1 and Heyl probes were generated in house through PCR amplification. Primers for Hoxb1 probe: F-5’ TTCCTTTTTAGAGTACCCACTTTG, R-5’ GTTTCTCTTGACCTTCATCCAGTC. Primers for Heyl probe: F-5’ GCCAGGAGCATAGTCCCAAT, R-5’ GGCCCTCAACCCACTCCATGAC.
H1 hESC cell cultures and cardiomyocyte differentiation
Request a detailed protocolH1 hESC line (gift of Dr. Xin Cheng, Shanghai Institute of Biochemistry and Cell Biology) was tested negative for mycoplasma with PCR assay. Undifferentiated H1 hESC lines were maintained in a feeder-free culture system. Briefly, we precoated the well plates with Matrigel (354277; BD Biosciences), and then seeded and cultured cells with TeSR-E8 medium (05840; Stemcell). When cells reached 80% confluence, they were passaged routinely with Accutase (07920; Stemcell). For cardiomyocyte differentiation, cells were induced using a chemically defined medium consisting of three components (CDM3): the basal medium RPMI 1640 (C14065500; Gibco), L-ascorbic acid 2-phosphate (213 µg/ml, 113170-55-1; Sigma), and Oryza sativa-derived recombinant human albumin (500 µg/ml, HY100M1; Healthgen Biotechnology Corp). In brief, single-cell suspensions were prepared using Accutase and were seeded in 12-well Matrigel-coated plate at a density of 4 × 105 cells/well. When cells reached 80–90% confluence (day 0), cells were fed by 2 ml CDM3 basal medium supplemented with CHIR99021 (6 μM, 72052; Stem cell). 48 hr later (day 2), the medium was replaced with 2 ml CDM3 supplemented with Wnt-C59 (2 μM, 1248913; Peprotech Biogems). After 96 hr (day 4), the medium was replaced with CDM3 basal medium every other day until the appearance of cell beating. In the rescue experiments, 250 μg/ml recombinant Shh protein (10372-H08H1; Sinobiological) was added in shRNA-SORBS2 H1 hESCs at the beginning of D5 (when the medium was replaced with CDM3 basal medium). After 16 hr, some cells were collected for qRT-PCR. Others were left for immunofluorescent staining at D15.
Lentiviral shRNA plasmid vectors (U6-MCS-Ubiquitin-Cherry-IRES-puromycin) expressing target-specific sequences against human SORBS2 and non-target scrambled shRNA were purchased from Shanghai Genechem Co. The targeting sequences of SORBS2 shRNA-1 and shRNA-2 are 5′-TCCTTGTATCAGTCCTCTA-3′ and 5′-TCGATTCCACAGACACATA-3′, respectively. The sequence of scrambled shRNA is 5′-TTCTCCGAACGTGTCACGT-3′. Lentiviral particles were produced by transfecting human embryonic kidney (HEK) 293FT cells with shRNA, psPAX2 (12260; Addgene), and pMD2.G (12259; Addgene) plasmids. Efficiency of gene knockdown was examined using qRT-PCR.
Western blot
Request a detailed protocolCells or embryos were lysed in radioimmunoprecipitation assay buffer (P0013B; Beyotime) containing protease inhibitors (P1010; Beyotime). Protein concentrations were determined with the BCA protein assay kit (Thermo). Protein was separated via 8% sodium dodecyl sulphate–polyacrylamide gel electrophoresis and, afterwards, transferred to a polyvinylidene difluoride membrane. After blocking by 5% non-fat milk for 1 hr, primary antibodies were incubated overnight at 4℃. The membrane was washed with tris-buffered saline with Tween-20 and incubated with secondary antibodies for 0.5 hr at room temperature. Bands were detected with the Immobilon ECL Ultra Western HRP Substrate (WBULS0500; Sigma) and band intensity was analyzed by ImageJ software. Antibodies: c-ABL (1:1000, A0282; Abclonal), NOTCH1 (1:1000, 3608 s; CST), and GAPDH (1:1000, ab8245; Abcam). Goat anti-rabbit IgG H and L (HRP) (1:5000, ab6721; Abcam), goat anti-mouse IgG H and L (HRP) (1:5000, ab205719; Abcam).
Immunofluorescent staining
Request a detailed protocolCells were fixed in 4% PFA for 10 min, permeabilized in 0.5% Triton X-100/phosphate-buffered saline (PBS) for 20 min, and then blocked in 5% bovine serum albumin/PBS for 30 min. Fixed cells were stained with the following primary antibodies: TRI-1–60 (1:200, ab16288; Abcam), OCT4 (1:200, ab18976; Abcam), SOX2 (1:200, ab92494; Abcam), cTnI (1:200, ab92408; Abcam), cTnT (1:200, ab8295; Abcam), and α-actinin (1:200, A5044; Sigma). These primary antibodies were visualized with AlexaFluor 488 (1:1000, A11029; Invitrogen) or AlexaFluor 633 (1:1000, A21071; Invitrogen). TUNEL staining was performed with a commercial kit according to manufactory menu (T18120; Yeasen Biotech). GFP-SORBS2 plasmids were transfected into HEK293 cells. After 48 hr, cells were fixed with 4% PFA for 20 min and treated with 0.1% triton X-100 for 10 min. F-actin was stained with Acti-stainTM 555 Fluorescent Phalloidin (Cat. #PHDH1; Cytoskeleton). Nuclei were stained with 4′,6-diamidino-2-phenylindole. Fluorescent images were acquired using a Laser confocal microscope (Leica TCS SP8).
Flow cytometric analysis
Request a detailed protocolIn brief, D15 cells were harvested in 0.25% trypsin/EDTA at 37℃ for 15 min and subsequently neutralized by 10% fetal bovine serum in Dulbecco's modified Eagle medium. Then cells were centrifuged at 1000 rpm for 5 min and resuspended in Invitrogen FIX and PERM solution and kept at 4°C for 30 min. After washing, cells were incubated with anti-cTnT antibody (1:100, ab105439; Abcam) in washing buffer on ice in the dark for 45 min. Cells were centrifuged, washed, and resuspended for detection. Data were collected by BD FACSCanto flow cytometer and analyzed by BD FACS software.
Electron microscopy
Request a detailed protocolD30 cardiomyocytes were harvested using 0.25% trypsin/EDTA and prefixed with 2.5% glutaraldehyde in 0.2 M phosphate buffer overnight at 4°C. Samples were washed and then post-fixed with 1% osmium tetroxide for 1.5 hr. Next, cells were routinely dehydrated in an ethanol series of 30, 50, 70, 80, and 95% for 15 min each, and 100% ethanol and acetone twice for 20 min each at room temperature, and then embedded in an epoxy resin. Sections (70 nm thick) were poststained in uranyl acetate and lead citrate and visualized on Hitachi 7650 microscope.
Electrophysiological recordings
Request a detailed protocolD30 h1ESC-CMs were digested by Accutase (7920; STEMCELL Technologies, Canada), washed one time with a baseline extracellular fluid, and then moved to the stage of an inverted microscope (ECLIPSE Ti-U; Nikon, Japan) for patch-clamp recording. h1ESC-CMs were continuously perfused by an extracellular solution through a ‘Y-tube’ system with a solution exchange time of 1 min. Whole-cell patch-clamp recordings were performed using Axopatch 700B (Axon Instruments, Inc, Union City, CA, USA) amplifiers under an invert microscope at room temperature (22–25°C). Glass pipettes were prepared using borosilicate glasses with a filament (Sutter Instruments Co, Novato, CA) using the Flaming/Brown micropipette puller P97 (Sutter Instruments Co). The final resistance parameters of patch pipette tips were about 2–4 MΩ after heat polish and internal solution filling. After the formation of ‘gigaseal’ between the patch pipette and cell membranes, a gentle suction was operated to rupture the cell membrane and establish whole-cell configuration. All current signals were digitized with a sampling rate of 10 kHz and filtered at a cutoff frequency of 2 kHz (Digidata 1550A; Axon Instruments, Inc, Union City, CA). The spontaneous action potentials were recorded in a gap-free mode with a sampling rate of 1 kHz and filtered at a cutoff frequency of 0.5 kHz. If the series resistance was more than 10 MΩ or changed significantly during the experiments, the recordings were discarded from further analyses. The pipette internal solution for action potential recording contained (in mM) KCl 150, NaCl 5, CaCl2 2, EGTA 5, HEPES 10, and MgATP 5 (pH 7.2, KOH), and baseline extracellular solution and extracellular solution for action potential recording contained (in mM) NaCl 140, KCl 5, CaCl2 1, MgCl2 1, glucose 10, and HEPES 10 (pH 7.4, NaOH). Data were analyzed by using Clampfit 10.5 and Origin 8.0 (OriginLab, Northampton, MA).
Quantitative real-time PCR analysis
Request a detailed protocolTotal RNA was extracted from D0, D2, D3, D5, and D10 cells or E10.5 embryos using Trizol reagent (15596018; Thermo Fisher Scientific). Reverse transcription was accomplished with Reverse Transcription Kit (Takara; RR037A) according to the manufacturer's instructions. qPCR was performed with the SYBR Fast qPCR Mix (Takara; RR430A) in the Applied Biosystems 7900 Real-Time PCR System. Primers are listed in Supplementary file 10.
RNA-Seq
Request a detailed protocolTotal RNA of D5 cells and E10.5 embryos was isolated using TRizol reagent (Thermo Fisher Scientific; 15596018). Library preparation and transcriptome sequencing on an Illumina HiSeq platform were performed by Novogene Bioinformatics Technology Co, Ltd to generate 100-bp paired-end reads. HTSeq v0.6.0 was used to count the read numbers mapped to each gene, and fragments per kilobase of transcript per million fragments mapped (FPKM) of each gene were calculated. We used FastQC to control the quality of transcriptome sequencing data. Next, we compared the sequencing data to the human reference genome (hg19) by STAR. The expression level of each gene under different treatment conditions is obtained by HTSeq-count after standardization. The differentially expressed genes were analyzed by DESeq2 package. Functional enrichment of differentially expressed genes was analyzed on Toppgene website.
GSE126128 and GSE131181 datasets were retrieved from Gene Expression Omnibus (GEO) database. Seurat (version 3.0) toolkit was used for scRNA-seq analysis. After data integration, batch effect elimination, normalization, and scaling, different cell populations were identified based on existing references. Gene expression was plotted using normalized read counts.
Network and GO analysis
Request a detailed protocolFrom ENCODE database (Gerstein et al., 2012), 316 human fetal heart-specific genes including SORBS2 were selected and their expression coefficients were computed. The highly co-regulated transcriptional networks (correlation coefficient ≥0.8) were constructed and visualized with BioLayout Express3D. The interconnected gene clusters were detected using the MCL (Markov Cluster) algorithm and illustrated with different colors.
Patient samples
Request a detailed protocolA total of 300 children with complex CHD, including ASD, conotruncal defect, and so on, were enrolled in our study from November, 2011 to January, 2014 in Shanghai Children’s Medical Center (Supplementary file 11). Patients carrying 22q11.2 deletion and gross chromosomal aberrations were excluded from our study. The mean age of included probands was 10 months with a range of 3 days to 17 years. 188 (62.7%) were boys and 112 (37.3%) were girls. CHD diagnosis was confirmed by reviewing patient history, physical examinations, and medical records. Patients carrying 22q11.2 deletion and gross chromosomal aberrations (e.g., trisomy 21, trisomy 13, and trisomy 18) were excluded from our study. The study conformed to the principles outlined in the Declaration of Helsinki, and approval for human subject research was obtained from the Institutional Review Board of Shanghai Children's Medical Center (SCMC-201015). Written informed consents were obtained from parents or legal guardians of all patients.
Control cohort
Request a detailed protocolExome sequences for 220 control subjects of Han Chinese descent were derived from the 1000 genome project (http://www.internationalgenome.org/data). Raw sequence data in the form of fastq files were re-aligned and re-analyzed with the same bioinformatic pipelines with CHD patients. The ethnicity of cases and controls was investigated by performing PCA with single nucleotide polymorphism (SNP) genotype data from all the participants of this study.
Gene selection and targeted sequencing
Request a detailed protocolWe used a customized capture panel of 104 targeted genes, which included 81 known CHD genes (Supplementary file 12) and 23 CHD candidate genes (Supplementary file 13). The CHD genes were selected through a comprehensive literature search and had been reported by other research groups to be associated with CHD in either human patients or mouse models (Andersen et al., 2014; Barriot et al., 2010; Fahed et al., 2013). CHD candidate genes were prioritized from pathogenic CNVs and likely pathogenic CNVs identified in CHD patients in our previous study (Geng et al., 2014). The coding regions of selected genes and their flanking sequences were covered by the Agilent SureSelect Capture panel and sequenced on the Illumina Genome Analyzer IIx platform according to the protocols recommended by the manufacturers.
Variant calling and quality control
Request a detailed protocolWe used the best practice pipeline of Broad Institute’s genome analysis toolkit (GATK) 3.7 to obtain genetic variants from the target sequencing data of 300 CHD cases together with the raw data of 220 Han Chinese control samples. Briefly, Burrows-Wheeler Aligner (BWA, version 0.7.17) was used to align the Fastq format sequences to human genome reference (hg38). De-duplication was performed using Picard, and the base quality score recalibration (BQSR) was performed to generate analysis-ready reads. HaplotypeCaller implemented in GATK was used for variant calling in genomic variant call format (GVCF) mode. All samples were then genotyped jointly. We then excluded the variants based on the following rules: (1) >2 alternative alleles; (2) low genotype call rate <90%; (3) deviation from Hardy-Weinberg Equilibrium in control samples (p<10−7); (4) differential missingness between cases and controls (p<10−6). After alignment and variant calling, we removed two subjects with low-quality data, leaving a total of 298 cases and 220 controls.
Variant enrichment analysis
Request a detailed protocolGiven that severe mutations are generally present at low frequencies in the population, we set the relevant variants filtering criteria as follows: (1) variants that located in exonic region, (2) excluding synonymous variants, (3) variants with an MAF below 1% according to the public control database (Exome Aggregation Consortium, ExAC), and (4) damaging missense variants predicted to be deleterious by at least two algorithms (Polyphen2 ≥0.95/MutationTaster_pred:D/SIFT ≤0.05). All relevant variants following these criteria were hereafter called ‘rare damaging’ variants. The number of rare damaging variant carriers in each gene was counted in CHD patients and controls. We hypothesized that rare damaging variants should be enriched in CHD patients, hence the carrier and non-carrier groups were compared between CHD patients and controls using a one-tailed Fisher’s exact test. The odds ratio (OR) was calculated. Only genes with at least two variants were retained, and multiple testing correction was performed using Benjamini-Hochberg procedure (q-value, adjusted p-value after Benjamini-Hochberg testing).
Statistical analysis
Request a detailed protocolStatistical significance was performed using a two-tailed Student’s t test, χ2 test, or Fisher’s exact test as appropriate. The combined difference of Notch and Shh signaling was tested by non-parametric PERMANOVA. Statistical significance is indicated by *p<0.05 and **p<0.01.
Data availability
Targeted sequencing raw data of CHD patients have been deposited in NCBI's Sequence Read Archive (PRJNA579193). RNA-seq data have been deposited in NCBI's Gene Expression Omnibus (GSE137090).
-
NCBI Sequence Read ArchiveID PRJNA579193. Targeted sequencing of children with congenital heart disease.
-
NCBI Gene Expression OmnibusID GSE137090. RNA-Sequencing analyses of control and SORBS2 knockdown cardiac progenitor cells derived from human stem cells in vitro and E10.5 wild-type and Sorbs2 knockout embryos.
-
NCBI Gene Expression OmnibusID GSE131181. A cellular atlas of Pitx2-dependent cardiac development.
-
NCBI Gene Expression OmnibusID GSE126128. Single-cell analysis of cardiogenesis reveals basis for organ level developmental defects.
References
-
Of mice and men: molecular genetics of congenital heart diseaseCellular and Molecular Life Sciences 71:1327–1352.https://doi.org/10.1007/s00018-013-1430-1
-
Precardiac organoids form two heart fields via Bmp/Wnt signalingNature Communications 9:3140.https://doi.org/10.1038/s41467-018-05604-8
-
Advances in the Genetics of Congenital Heart Disease: A Clinician's GuideJournal of the American College of Cardiology 69:859–870.https://doi.org/10.1016/j.jacc.2016.11.060
-
A coronary embolus originating from the interatrial septumEuropean Heart Journal 27:2745.https://doi.org/10.1093/eurheartj/ehl051
-
Chemically defined generation of human cardiomyocytesNature Methods 11:855–860.https://doi.org/10.1038/nmeth.2999
-
Knockout of SORBS2 Protein Disrupts the Structural Integrity of Intercalated Disc and Manifests Features of Arrhythmogenic CardiomyopathyJournal of the American Heart Association 9:e017055.https://doi.org/10.1161/JAHA.119.017055
-
Genetics of congenital heart disease: the glass half emptyCirculation Research 112:707–720.https://doi.org/10.1161/CIRCRESAHA.112.300853
-
A cellular atlas of Pitx2-dependent cardiac developmentDevelopment 146:dev180398.https://doi.org/10.1242/dev.180398
-
The second heart fieldCurrent Topics in Developmental Biology 100:33–65.https://doi.org/10.1016/B978-0-12-387786-4.00002-6
-
Interstitial and terminal deletions of the long arm of chromosome 4: further delineation of phenotypesAmerican Journal of Medical Genetics 31:533–548.https://doi.org/10.1002/ajmg.1320310308
-
Different Cardiac Anomalies in Mother and Son with 4q-SyndromeCase Reports in Genetics 2015:932651.https://doi.org/10.1155/2015/932651
-
Helt, a novel basic-helix-loop-helix transcriptional repressor expressed in the developing central nervous systemJournal of Biological Chemistry 279:16356–16367.https://doi.org/10.1074/jbc.M311740200
-
Molecular regulation of cardiomyocyte differentiationCirculation Research 116:341–353.https://doi.org/10.1161/CIRCRESAHA.116.302752
-
Double atrial septum with persistent interatrial space: echocardiographic features of a rare atrial septal malformationJournal of the American Society of Echocardiography 19:1175–1181.https://doi.org/10.1016/j.echo.2006.04.001
-
NIH image to ImageJ: 25 years of image analysisNature Methods 9:671–675.https://doi.org/10.1038/nmeth.2089
-
Cbl-ArgBP2 complex mediates ubiquitination and degradation of c-AblBiochemical Journal 370:29–34.https://doi.org/10.1042/bj20021539
-
Genotype-phenotype analysis of 4q deletion syndrome: proposal of a critical regionAmerican Journal of Medical Genetics Part A 158A:2139–2151.https://doi.org/10.1002/ajmg.a.35502
-
Subdivided left atrium: an expanded concept of cor triatriatum sinistrumThe American Journal of Cardiology 37:743–752.https://doi.org/10.1016/0002-9149(76)90369-6
-
Chromosome 4q deletion syndrome: narrowing the cardiovascular critical region to 4q32.2-q34.3American Journal of Medical Genetics Part A 158A:635–640.https://doi.org/10.1002/ajmg.a.34425
-
Impaired Dendritic Development and Memory in Sorbs2 Knock-Out MiceThe Journal of Neuroscience 36:2247–2260.https://doi.org/10.1523/JNEUROSCI.2528-15.2016
Decision letter
-
Antonio BaldiniReviewing Editor; University Federico II, Italy
-
Didier YR StainierSenior Editor; Max Planck Institute for Heart and Lung Research, Germany
-
Stephane ZaffranReviewer; Aix Marseille University, France
In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.
Acceptance summary:
Fei Liang et al., have identified the deletion of the gene SORBS2 as a contributor to the congenital heart disease phenotype in the 4q deletion syndrome. They have shown that the gene is required for the development of the dorsal mesenchyme protrusion, a structure necessary for septation of the atria. To reach these conclusions, the team has used human genetics data, an in vitro differentiation model of human embryonic stem cells, and a mouse model of Sorbs2 loss of function. The data presented indicate that Sorbs2 is important for atrial septation by supporting Tbx5 expression as well as NOTCH and SHH signalling. The work supports a role for Sorbs2 in heart development and adds novel information to the genetics of 4q deletion syndrome.
Decision letter after peer review:
[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]
Thank you for submitting your work entitled "SORBS2 is a genetic factor contributing to cardiac malformation of 4q deletion syndrome" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The reviewers have opted to remain anonymous.
Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.
Your study addresses the genetic basis of an interesting, and as yet unclear human condition. The strength of your work is in the use of both mouse and human systems. However, the reviewers have underlined insufficient depth in the datasets from both systems, thus preventing a robust support for your conclusions.
Hoping to help you to increase the strength of your work, I summarize the issues that have been raised:
1. Mouse data need to be expanded significantly to better define the phenotype and to identify a developmental mechanism.
This work should also include validation of the proposed mechanism c-ABL/NOTCH/SHH.
2. Is there a haploinsufficiency phenotype in the mouse? While there may be species-specific differences in sensitivity to gene dosage, the authors should make an effort to investigate this question. There could be, for example a molecular phenotype (rather than a morphogenetic one) in the heterozygous mutant.
3. The human genetics data should be extended: a) correlate more directly variants and ASD; b) validate variants to demonstrate their functional significance.
Reviewer #1:
The manuscript describes the identification of the gene SORBS2 as a likely contributor to the congenital heart disease (CHD) phenotype in patients with 4q deletions. The support for the implication of the SORBS2 gene derives from the phenotype of Sorbs2-/- embryos, from human genetics studies, and from analysis of differentiated human ES cells in which this gene has been knocked down using siRNAs. The authors conclude that SORBS2 has at least two "functions" in the cardiogenic lineage. One is related to the sarcomere structure of the cardiomyocyte, a role to a certain extent predicted by previous studies of the SORBS2 protein, which is localized in the Z line and is a multi-domain scaffolding protein involved in cytoskeletal organization. The other, more novel role and more related to heart development, would be "… that SORBS2 is a critical regulator to maintain the balance between FHF and SHF cells during differentiation". The support for the latter role is much more speculative and requires more extensive studies, which would considerably increase the competitiveness of this manuscript.
– The cardiac development phenotype of Sorbs2-/- embryos should be investigated in greater detail, also with the aid of regional and lineage marker analyses, to corroborate the conclusions drawn by the hES cell culture experiments. Without these studies, the conclusion that Sorbs2 is involved in fate specification of SHF progenitors is not supported.
For example, RNA-seq data of differentiated hES cells suggest that knock-down of Sorbs2 reduces the expression of anterior SHF markers, such as Tbx1, and increases the expression of posterior SHF markers such as Tbx5, thus, the imbalance could be between aSHF and pSHF, rather than between FHF and SHF as suggested by the authors. Thus, is TBX5 expression altered in the pSHF of mutant embryos? How is the expression of other pSHF markers? Where is Sorbs2 expressed?
It is virtually impossible to predict mechanisms leading to cardiac structural defects using hES differentiation data. Even though the mouse phenotype is incompletely penetrant, it should still be possible to analyse it in more details and validate the proposed c-ABL/NOTCH/SHH pathway in vivo.
– Human genetics studies were performed on a relatively small number of patients; nevertheless they provided some suggestion that SORBS2 may have a role in CHD. The authors should show a map of the gene model or predicted protein with the location of the variants and list the actual variants that they found.
Also, did the 20 patients that carried "rare damaging variants" of SORBS2 also have variants in other CHD genes?
Reviewer #2:
In this manuscript, the authors present their study on the identification of SORBS2 as regulator of cardiac defects associated to Chr 4q deletion syndrome. The aim of this study was to identify the role of SORBS2, as a candidate gene for CHD of terminal 4q deletion syndrome, during cardiac development. The authors found that Sorbs2-/- mouse hearts have atrial septal defects (ASD) including rare double atrial septum. The authors used human ES cell lines as in vitro model to examine the requirement of SORBS2 during cardiomyocyte differentiation. Thus, they knockdown SORBS2 expression with 2 different shRNAs. Video shown that differentiated SORBS2-knockdown cardiomyocytes contracted much weaker than controls. Quantification of cTnT+ cells confirmed the later observation. Myofibril structure examination showed abnormal sarcomeric structure when SORBS2 expression is reduced whereas electrical activity seemed normal. The authors hypothesized that SORBS2 had an early role in cardiomyocyte differentiation. Expression of progenitor but not mesodermal markers was disturbed in SORBS2-knockdown hES cells. Based on expression analysis, the authors claimed that expression of first heart field (FHF) genes was increased whereas second heart field (SHF) markers were reduced. The authors concluded that SORBS2 is a critical regulator to maintain the balance between FHF and SHF cells. To understand how SORBS2 regulates SHF progenitor commitment, the authors performed RNA-seq experiments. RNA-seq analysis showed that the NOTCH signaling target genes were reduced in SORBS2-knockdown cardiomyocytes. Finally, in this study the authors used rare variant association to identify genes within CNVs responsible for CHD. Hence, the authors sequenced 300 complex CHD cases. Among genes with a p-value lower than 0.05, they found SORBS2. The authors identified missense mutations in SORBS2 suggesting that rare variants in this gene could be associated to ASD.
Although the basic insight regarding the identification of atrial septal defects in SORBS2 mutant mice and the reduction of cardiomyocyte differentiation in hES cells when SORBS2 is reduced are interesting, there are some weaknesses in the arguments and data reported in this study.
– My main concern is related to the arguments used to claim a role of SORBS2 in SHF development through c-ABL/NOTCH/SHH axis.
– It is clear that Sorbs2-null mice have ASD. However, the authors did not find the origin of this defect. The authors should show how dorsal mesenchymal protrusion is formed in these mutant embryos.
– The use of shRNA has some limitations that the authors did not discuss. Reduction of SORBS2 expression resulted in reduction of cTnT-positive cells. However, the authors should show whether apoptosis is normal in shRNA treated cells.
– The expression of sarcomeric genes is reduced in SORBS2-KD cells. How do the authors explain this result?
– In this study the qPCR is used to examine transcriptional levels of FHF and SHF genes during cardiomyocyte differentiation. Increase of TBX5, HAND1 and HCN4 is observed at D5 but clearly significant at D10. I'm wondering whether these markers signed the FHF or the atrial identity? The authors should validate this observation using other FHF markers.
– qPCR shows a decrease of three SHF genes. However, there is no SHF markers (except FGF8) listed in TableS2 (downregulated genes at D5 from RNA-seq analysis). The authors should discuss this point.
– I do not understand why the authors focused on the c-ABL/NOTCH/SHH axis to explain the role of SORBS2 in SHF development. The arguments that link NOTCH to SHH signaling pathways in this context are very weak. The mechanism is incomplete and here again the mouse model should have been used to validate these observations.
– The authors sequenced 300 CHD cases and found several missense variants in SORBS2 gene. TableS6 shows heart phenotype in patients. "The majority of patients with rare SORBS2 variants had ASD". The authors should show whether there is any correlation between SORBS2 mutation and ASD phenotype.
Reviewer #3:In this study, the Authors have attempted to use a mouse model to link the cardiac malformations observed in patients with the 4q deletion to defects in the SORBS2 locus. It is interesting to see that 40% of Sorbs2-/- hearts had ASD, and that some of them have an absence/hypoplasia of the primary septum and/or double atrial septum with an incomplete penetrance. However, while the ratio of cardiac defects in embryos is similar to the percentage of reported postnatal lethality, in general ASD hardly causes 100% postnatal lethality and likely cannot provide an adequate explanation as the sole cause of the early postnatal death. In addition, ASDs were only seen in the case of null genotypes (Sorbs2-/-), and the authors didn't report ASDs in the case of Sorbs2+/- genotypes. This is crucial because in 4q-, SORBS2 is going to be haploinsufficient, and not a null genotype.The major fault of the study is, if the authors feel that SORBS2+/- haploinsufficiency is the cause for cardiac defects, patient samples (from 4q- or SORBS2 VUCS) should be used to derive iPSCs instead of the hRNA knockdown ESCs for all subsequent studies.
SORBS2-knockdown iPSCs were used for cardiomyocyte differentiation, which cannot be directly linked to cardiac defects such as ASD. Since Sorbs2-/- is available, the molecular mechanisms should be tested with an in vivo model or primary cell cultures derived from Sorbs2-/- or Sorbs2+/- models.
Finally, while the Authors found that rare SORBS2 variants are significantly enriched in CHD patients, there is no evidence to support that these variants CAUSE cardiac defects.
[Editors’ note: further revisions were suggested prior to acceptance, as described below.]
Thank you for submitting your article "SORBS2 is a genetic factor contributing to cardiac malformation of 4q deletion syndrome" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Didier Stainier as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Stephane Zaffran (Reviewer #3).
The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.
Essential Revisions:
There are two sets of experiments that are deemed critical (please see details in the individual reviews):
1. A rescue experiment using recombinant NOTCH or SHH in the cell culture model.
2. Test additional pSHF markers by in situ hybridization on the DMP or pSHF of mutant embryos to validate and regionalize at least some of the expression changes revealed by whole-embryo RNA-seq.
Reviewer #1:
The resubmitted version has addressed the issues raised by the previous round of review, albeit some questions remain.
I have 3 recommendations for authors:
1. Phenotypic analysis in the mouse mutant has been extended, but it is still limited. However, the authors did find developmental abnormalities with the DMP, which is interesting (albeit predictable). Phenotyping would benefit from testing additional pSHF markers and perhaps by testing basic mechanisms such as cell proliferation and cell death
2. Mechanisms: the focus of the authors in a so called c-Abl-Notch1-Shh "axis" remains speculative and based on gene (and in some cases protein) expression assays in differentiated hES cells and in whole embryo RNA-seq. These results are insufficient to draw conclusions about the pSHF or whatever it is happening in the DMP. Claims to the effect that Sorbs2 specifies "the fate of second heart field (SHF) progenitors through c-ABL/NOTCH/SHH axis" are unsubstantiated and should be removed (in the abstract, subheading of results, discussion), or be proposed as a speculative hypothesis in the discussion. In addition, the authors show no evidence that Sorbs2 specifies the fate of SHF progenitors. On the other hand, new data added to the resubmission clearly show a downregulation of Tbx5 in the DMP/pSHF region of mutants. It is unclear whether this is due to hypoplasia of the DMP or to reduced expression of the gene. In any case, this could be a valuable clue to understand mechanisms as Tbx5 is a critical factor in DMP development (e.g. Xie et al., 2012, Moskowitz group, which has also shown interaction between Tbx5 and SHH signalling), thus it could be part of the pathogenesis of ASD in this mutant. This should be discussed and contrasted with the NOTCH hypothesis.
3. The authors should discuss the apparently inconsistent findings of increased expression of Tbx5 in the hES cell model, and the decreased expression of the same gene in the pSHF of mutant embryos.
Reviewer #2:
Authors have done an incredible job to revise the manuscript. The data is convincing that SORBS2 contributes to the cardiac phenotypes in 4q deletion syndrome.
It is interested to see the gene expression profile of heterozygous mutant is closer to that of homozygous mutants than to wild type.
Correlation of the SORBS2 variants with ASD and finding the enrichment of SORBS2 variants in patients with ASD added the value to the manuscript.
Reviewer #3:
The authors have replied to several of my concerns such as the arguments that SORBS2 specifies SHF progenitors through c-ABL/NOTCH/SHH. They used PCR, RNA-seq and in situ hybridization to validate their hypothesis. Thus, they showed that Notch1 protein expression level is significantly decreased whereas c-ABL is increased in Sorbs2-/- mutant embryos. In this revised version, they better used their in vivo model to support their hypothesis. The phenotype of the DMP is now examined which is consistent with ASD observed at E18.5. Control quality of shRNA KD hES cells is now performed and no apoptosis is detected. Expression of pSHF markers is now shown including Hoxb1, Hoxa1, Aldh1a2 and Tbx5 which confirms the previous statement. The rational to examine NOTCH and SHH signals is now better explained. Finally, human genetics data is improved and detection of significant enrichment of SORBS2 rare damaging variant in patients with ASD vs non-ASD is great. However, I agree with reviewer#3 that hiPS cells model rather than hESC would have been better to support their hypothesis. In addition, a rescue experiment using recombinant NOTCH or SHH treatment in the in vitro culture would have been important to perform in order to support the main finding of this study.
https://doi.org/10.7554/eLife.67481.sa1Author response
[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]
Your study addresses the genetic basis of an interesting, and as yet unclear human condition. The strength of your work is in the use of both mouse and human systems. However, the reviewers have underlined insufficient depth in the datasets from both systems, thus preventing a robust support for your conclusions.
Hoping to help you to increase the strength of your work, I summarize the issues that have been raised:
1. Mouse data need to be expanded significantly to better define the phenotype and to identify a developmental mechanism.
This work should also include validation of the proposed mechanism c-ABL/NOTCH/SHH.
As per reviewers’ suggestion, we have analyzed early embryos and identified two types of DMP malformations that matches with E18.5 phenotypes. We have also validated our in vitro molecular findings in mouse embryos. Please check details in the following responses to reviewers.
2. Is there a haploinsufficiency phenotype in the mouse? While there may be species-specific differences in sensitivity to gene dosage, the authors should make an effort to investigate this question. There could be, for example a molecular phenotype (rather than a morphogenetic one) in the heterozygous mutant.
We have used RNA-seq to check transcriptome of wild type, heterozygous and homozygous mutants. Although heterozygous mutant is phenotypically similar to wild type, the gene expression profile of heterozygous mutant is more similar to that of homozygous mutant. GO analysis showed that the affected biological processes and pathways are also similar to those affected in homozygous mutant
3. The human genetics data should be extended: a) correlate more directly variants and ASD; b) validate variants to demonstrate their functional significance.
We have checked SORBS2 frequency difference between patients with ASD and without ASD in our cohort. Indeed, we noted a significant enrichment of SORBS2 variants in patients with ASD. We also over-expressed two of SORBS2 variants in HEK293 cells and found these mutations could alter cellular distribution of SORBS2 protein. Please check details in the following responses to reviewers.
Reviewer #1:
The manuscript describes the identification of the gene SORBS2 as a likely contributor to the congenital heart disease (CHD) phenotype in patients with 4q deletions. The support for the implication of the SORBS2 gene derives from the phenotype of -/-Sorbs2-/- embryos, from human genetics studies, and from analysis of differentiated human ES cells in which this gene has been knocked down using siRNAs. The authors conclude that SORBS2 has at least two "functions" in the cardiogenic lineage. One is related to the sarcomere structure of the cardiomyocyte, a role to a certain extent predicted by previous studies of the SORBS2 protein, which is localized in the Z line and is a multi-domain scaffolding protein involved in cytoskeletal organization. The other, more novel role and more related to heart development, would be "… that SORBS2 is a critical regulator to maintain the balance between FHF and SHF cells during differentiation". The support for the latter role is much more speculative and requires more extensive studies, which would considerably increase the competitiveness of this manuscript.
TBX5 is generally considered as a FHF marker in in vitro cardiomyocyte differentiation model. In our in vitro differentiation data, we observed up-regulation of several FHF marker genes, including TBX5. As the reviewer mentioned, Tbx5 is also considered as a posterior SHF marker in in vivo context. In regarding to the mouse phenotype, it is more important to establish the role of Sorbs2 in promoting SHF development rather than a role in maintaining the balance between FHF and SHF. Therefore, we have removed this hypothetical statement in the text. We respectfully request reviewers and editors not to ask these data.
– The cardiac development phenotype of -/-Sorbs2-/- embryos should be investigated in greater detail, also with the aid of regional and lineage marker analyses, to corroborate the conclusions drawn by the hES cell culture experiments. Without these studies, the conclusion that Sorbs2 is involved in fate specification of SHF progenitors is not supported.
For example, RNA-seq data of differentiated hES cells suggest that knock-down of Sorbs2 reduces the expression of anterior SHF markers, such as Tbx1, and increases the expression of posterior SHF markers such as Tbx5, thus, the imbalance could be between aSHF and pSHF, rather than between FHF and SHF as suggested by the authors. Thus, is TBX5 expression altered in the pSHF of mutant embryos? How is the expression of other pSHF markers? Where is Sorbs2 expressed?
As per reviewer’s suggestion, we have done analysis on -/-Sorbs2-/- embryos. First, we checked DMP formation in E10.5 -/-Sorbs2-/- embryos. Consistent with E18.5 phenotype, we observed two types of DMP malformations.
Excerpt from result section:
“We also noted DMP malformation in 5 out of 15 E10.5 Sorbs2-/- embryos. Themajority of them had DMP aplasia/hypoplasia (n=4), whereas one of them had duplicated DMP (Figure 2D). The dichotomy of DMP morphology is consistent with two opposite ASD phenotypes seen in E18.5 embryos.”
As per reviewer’s suggestion, we did RNA-seq with Sorbs2-/- embryos. Data have shown decreased pSHF markers (Figure 3F and 3G).
Excerpt from result section:
“The decrease of posterior SHF marker genes were less general but still clearlydown-regulated in the majority of Sorbs2-/- embryos (Figure 3F). Decreased Tbx5 expression in posterior SHF of Sorbs2-/- embryos was validated by RNA in situ hybridization (n=3, Figure 3G).”
As per reviewer’s suggestion, we examined Sorbs2 expression with published datasets.
Excerpt from result section:
“To examine Sorbs2 expression pattern in early mouse embryos, we pooled publiclyavailable single-cell transcriptomic profiles from E9.25 to 10.5 mouse embryonic hearts(17, 18). We identified 9 subgroups as cardiac progenitors or myocardium and noted that Sorbs2 is highly expressed in cardiomyocytes and in a subgroup of cardiac progenitors that also express Isl1 and Tbx1 (Figure S5).”
It is virtually impossible to predict mechanisms leading to cardiac structural defects using hES differentiation data. Even though the mouse phenotype is incompletely penetrant, it should still be possible to analyse it in more details and validate the proposed c-ABL/NOTCH/SHH pathway in vivo.
As per reviewer’s suggestion, we validated in vitro findings in mouse embryos. Mouse embryo data are consistent with in vitro results.
Excerpt from result section:
“We used qPCR to validate molecular findings of hESCs in E10.5 mouse embryos.Since the penetrance of cardiac phenotype is about 40%, we increased the number of Sorbs2-/- embryos according to this ratio. Consistent with hESC differentiation results, we detected significantly down-regulated expression in 3 out of 4 Notch and Shh signaling target genes (Hey1, Heyl and Ptch1) (Figure 3A). Multivariate PERMANOVA (permutational multivariate analysis of variance) analysis revealed a significant combined difference in Notch and Shh signaling target expression between wild type and Sorbs2-/- embryos (p<0.009).”
Excerpt from result section:
“A portion of embryos had obvious down-regulation of Notch and Shh signalingtargets (Figure 3H), which is consistent with a low penetrance of ASD in homozygous mutants. RNA in situ hybridization confirmed decreased Heyl expression in posterior SHF of Sorbs2-/- embryos (n=1, Figure 3I). Next, we verified the upstream molecular changes of Notch signaling found in hESCs differentiation model. Indeed, we noted that Notch1 expression level significantly decreased whereas c-ABL significantly increased in Sorbs2-/- embryos (Figure 3I-3J).”
– Human genetics studies were performed on a relatively small number of patients; nevertheless they provided some suggestion that SORBS2 may have a role in CHD. The authors should show a map of the gene model or predicted protein with the location of the variants and list the actual variants that they found.
Also, did the 20 patients that carried "rare damaging variants" of SORBS2 also have variants in other CHD genes?
We have listed the location of variants in gene and protein in Figure 4C.
The majority of patients with rare SORBS2 variants also have other CHD gene variants. They are listed in Table S6.
Reviewer #2:
– My main concern is related to the arguments used to claim a role of SORBS2 in SHF development through c-ABL/NOTCH/SHH axis.
As per reviewer’s suggestion, we have validated our in vitro findings in mouse embryos.
Excerpt from result section:
“We used qPCR to validate molecular findings of hESCs in E10.5 mouse embryos.Since the penetrance of cardiac phenotype is about 40%, we increased the number of Sorbs2-/- embryos according to this ratio. Consistent with hESC differentiation results, we detected significantly down-regulated expression in 3 out of 4 Notch and Shh signaling target genes (Hey1, Heyl and Ptch1) (Figure 3A). Multivariate PERMANOVA (permutational multivariate analysis of variance) analysis revealed a significant combined difference in Notch and Shh signaling target expression between wild type and Sorbs2-/- embryos (p<0.009).
To have a view of transcriptomic changes in Sorbs2 mutants, we performed RNA-seq on wild type, Sorbs2+/- and Sorbs2-/- embryos. PCA analysis indicates that wild type embryos are clustered together, whereas Sorbs2-/- embryos are more scattered (Figure 3B), which is consistent with diverged cardiac phenotypes of Sorbs2-/- embryos. Interestingly, the majority of Sorbs2+/- samples are juxtaposed more closely to Sorbs2-/- embryos in PCA plot, indicating a molecular phenotype in heterozygous mutants. We selected genes significantly down-regulated in heterozygous mutants (log2(fold change)>0.25, p<0.05) to perform GO analysis and found that these genes are enriched in pathways involved in muscle development and embryonic morphogenesis (Figure 3C, Table S4). Using the same threshold, we selected genes significantly down-regulated in homozygous mutants to perform GO analysis. These genes are enriched in pathways regulating heart development, myofibril assembly and cardiac septum development (Figure 3D, Table S5). Particularly, the Notch signaling pathway was also in the enrichment list. Looking closer, we noted that genes involved in cardiac development, myofibril assembly and contraction force were down-regulated in nearly all the homozygous mutants (Figure 3E). The decrease of posterior SHF marker genes were less general but still clearly down-regulated in the majority of Sorbs2-/- embryos (Figure 3F). Decreased Tbx5 expression in posterior SHF of Sorbs2-/- embryos was validated by RNA in situ hybridization (n=3, Figure 3G). A portion of embryos had obvious down-regulation of Notch and Shh signaling targets (Figure 3H), which is consistent with a low penetrance of ASD in homozygous mutants. RNA in situ hybridization confirmed decreased Heyl expression in posterior SHF of Sorbs2-/- embryos (n=1, Figure 3I). Next, we verified the upstream molecular changes of Notch signaling found in hESCs differentiation model. Indeed, we noted that Notch1 expression level significantly decreased whereas c-ABL significantly increased in Sorbs2-/- embryos (Figure 3J-3K).”
– It is clear that Sorbs2-null mice have ASD. However, the authors did not find the origin of this defect. The authors should show how dorsal mesenchymal protrusion is formed in these mutant embryos.
As per reviewer’s suggestion, we have done morphological analysis on E10.5 embryos. Results indicate that, indeed, there are two types of DMP malformation in E10.5 Sorbs2-/- embryos (Figure 2D), which is consistent with E18.5 phenotypes.
Excerpt from result section:
“We also noted DMP malformation in 5 out of 15 E10.5 Sorbs2-/- embryos. Themajority of them had DMP aplasia/hypoplasia (n=4), whereas one of them had duplicated DMP (Figure 2D). The dichotomy of DMP morphology is consistent with two opposite ASD phenotypes seen in E18.5 embryos.”
– The use of shRNA has some limitations that the authors did not discuss. Reduction of SORBS2 expression resulted in reduction of cTnT-positive cells. However, the authors should show whether apoptosis is normal in shRNA treated cells.
As per reviewer’s suggestion, we have done TUNEL staining on our cell lines. We didn’t detect difference in apoptosis between control and shRNA knockdown ES cells (Figure S1F).
Excerpt from result section:
“SORBS2-knockdown did not affect clone morphology, pluripotency markerexpression and apoptosis of hESCs (Figure S1B-S1F).”
– The expression of sarcomeric genes is reduced in SORBS2-KD cells. How do the authors explain this result?
Other than the reduced differentiation efficiency in SORBS2 KD cells, the impaired maturation of differentiated cardiomyocytes due to abnormal sarcomere assembly may also contribute to reduced sarcomeric gene expression. We observed the same outcome in Sorbs2 mouse mutants.
– In this study the qPCR is used to examine transcriptional levels of FHF and SHF genes during cardiomyocyte differentiation. Increase of TBX5, HAND1 and HCN4 is observed at D5 but clearly significant at D10. I'm wondering whether these markers signed the FHF or the atrial identity? The authors should validate this observation using other FHF markers.
As per reviewer’s suggestion, we looked the expression of other FHF markers, such as GATA4 and TBX2, in RNA-seq data. Both genes were significantly up-regulated in D5 SORBS2-knockdown cells.
Author response table 1
| Gene name | Base Mean | Log2FoldChange | LfcSE | Stat | pvalue | padj |
|---|---|---|---|---|---|---|
| GATA4 | 7197.309 | 0.330043 | 0.078422 | 4.208528 | 2.57E-05 | 0.000904 |
| TBX2 | 1295.333 | 0.58354 | 0.122726 | 4.754828 | 1.99E-06 | 0.000111 |
The current work is to establish the role of Sorbs2 in promoting SHF development rather than a role in maintaining the balance between FHF and SHF. We have removed this hypothetical statement, ”…suggesting that SORBS2 is a critical regulator to maintain the balance between FHF and SHF cells during differentiation”. As a short report, we have used all the space for this major aim. We respectfully request reviewers and editors not to ask these data.
– qPCR shows a decrease of three SHF genes. However, there is no SHF markers (except FGF8) listed in TableS2 (downregulated genes at D5 from RNA-seq analysis). The authors should discuss this point.
DEGs in Table S2 are genes used for GO analysis. Since we had a large number of DEGs between D5 control and SORBS2-knockdown cells. We used very stringent criteria to select genes (padj. < 0.05, |log2(fold change)| > 1) for GO analysis. Actually, other SHF markers were also significantly down-regulated in RNA-seq data. Since they are below the threshold, they were not included in Table S2. The Author response table 2 lists the data on other SHF markers.
Author response table 2
| Gene name | Base Mean | Log2FoldChange | LfcSE | Stat | pvalue | padj |
|---|---|---|---|---|---|---|
| TBX1 | 721.4109 | -0.99858 | 0.116671 | -8.55897 | 1.14E-17 | 1.15E-14 |
| ISL1 | 2401.652 | -0.38996 | 0.091506 | -4.26157 | 2.03E-05 | 0.000749 |
| CXCR4 | 145.2801 | -0.91179 | 0.213437 | -4.27194 | 1.94E-05 | 0.000723 |
| MEF2C | 1242.792 | -0.22804 | 0.107697 | -2.11741 | 0.034225 | 0.216401 |
– I do not understand why the authors focused on the c-ABL/NOTCH/SHH axis to explain the role of SORBS2 in SHF development. The arguments that link NOTCH to SHH signaling pathways in this context are very weak. The mechanism is incomplete and here again the mouse model should have been used to validate these observations.
Notch signaling pathway is the only signal pathway that shows up in both GO analyses with cardiomyocyte differentiation and mouse embryo RNA-seq data. Existing literature indicates that Sorbs2 can regulate Notch protein level in cell and fly models (refs. 11-13). Our work validated that similar regulation exists in both cardiomyocyte differentiation and mouse embryo models.
Notching signaling is essential for SHF development (Chien-Jung L. etc. Development; 139: 3277-3299). Alagille syndrome patients have both outflow and inflow defects. Mouse mutants with genetic defects in Notch signaling components recapitulate cardiac defects of Alagille syndrome patients. In addition, we detected decreased expression of Shh signaling targets. Shh signaling is also essential for DMP formation (Goddeeris MM etc. Development; 135:1887-1895, Hoffmann AD etc. Development; 136: 1761-1770). Since Notch signaling is a known molecular mechanism promoting Smo accumulation in cilia and enhancing cellular response to Shh (ref.14), we proposed the current working model. We believe that both Notch and Shh signaling defects contribute to ASD pathogenesis. More important, we validated the molecular mechanism in mouse embryos (Figure 3, Table S4 and S5).
Certainly, there might have other molecular changes that contribute to ASD pathogenesis. For example, the decreased Tbx1 expression may contribute to ASD as well. Tbx1 deficiency also leads to DMP malformation and ASD (Rana MS etc. Circ.Res; 115:790–799).
– The authors sequenced 300 CHD cases and found several missense variants in SORBS2 gene. TableS6 shows heart phenotype in patients. "The majority of patients with rare SORBS2 variants had ASD". The authors should show whether there is any correlation between SORBS2 mutation and ASD phenotype.
Thanks for the reviewer’s insight. We did detect a significant enrichment of SORBS2 variants in patients with ASD.
Excerpt from result section:
“In our CHD cohort, we noted a significant enrichment of SORBS2 rare damaging variants in patients with ASD (17 out of 183 ASD patients versus 3 out of 117 non-ASD patients, p=0.0306, Fisher's exact test).”
Reviewer #3:
In this study, the Authors have attempted to use a mouse model to link the cardiac malformations observed in patients with the 4q deletion to defects in the SORBS2 locus. It is interesting to see that 40% of -/-Sorbs2-/- hearts had ASD, and that some of them have an absence/hypoplasia of the primary septum and/or double atrial septum with an incomplete penetrance. However, while the ratio of cardiac defects in embryos is similar to the percentage of reported postnatal lethality, in general ASD hardly causes 100% postnatal lethality and likely cannot provide an adequate explanation as the sole cause of the early postnatal death. In addition, ASDs were only seen in the case of null genotypes (Sorbs2-/-), and the authors didn't report ASDs in the case of Sorbs2+/- genotypes. This is crucial because in 4q-, SORBS2 is going to be haploinsufficient, and not a null genotype.
We have changed the lethality statement from “…may cause the early postnatal death” to “…might contribute to the early postnatal death”.
Excerpt from result section:
“The penetrance of ASD is similar to the ratio of reported postnatal lethality,indicating that ASD might contribute to the early postnatal death.”
The reason we didn’t detect ASD in heterozygous mutant might be due to different dosage sensitivity between different species. Indeed, we found that the gene expression profile of heterozygous mutant is closer to that of homozygous mutants than to wild type. It indicates similar molecular defects in heterozygous mutants (Figure 3B-3C, Table S4). Besides, human population has very heterogenous genetic background. other 4q interval gene haploinsufficiency and genetic modifiers in other loci may work together with SORBS2 haploinsufficiency to cause defects in human population, in other words, increase the penetrance of SORBS2 haploinsufficiency.
The major fault of the study is, if the authors feel that SORBS2+/- haploinsufficiency is the cause for cardiac defects, patient samples (from 4q- or SORBS2 VUCS) should be used to derive iPSCs instead of the hRNA knockdown ESCs for all subsequent studies.
This work is to dissect the role of SORBS2 in CHD pathogenesis of 4q deletion syndrome. Since SORBS2 is entirely deleted in 4q deletion. It would be nicer if we could have patients with heterozygous SORBS2 null allele. Unfortunately, we haven’t identified such patient. We respectfully request reviewers and editors not to ask this data. Instead, we used shRNA knockdown cell lines that express SORBS2 at ~40% of wild type level.
SORBS2-knockdown iPSCs were used for cardiomyocyte differentiation, which cannot be directly linked to cardiac defects such as ASD. Since Sorbs2-/- is available, the molecular mechanisms should be tested with an in vivo model or primary cell cultures derived from Sorbs2-/- or Sorbs2+/- models.
As per reviewer’s suggestion, we have validated our in vitro findings with mouse embryos.
Excerpt from result section:
“We used qPCR to validate molecular findings of hESCs in E10.5 mouse embryos.Since the penetrance of cardiac phenotype is about 40%, we increased the number of Sorbs2-/- embryos according to this ratio. Consistent with hESC differentiation results, we detected significantly down-regulated expression in 3 out of 4 Notch and Shh signaling target genes (Hey1, Heyl and Ptch1) (Figure 3A). Multivariate PERMANOVA (permutational multivariate analysis of variance) analysis revealed a significant combined difference in Notch and Shh signaling target expression between wild type and Sorbs2-/- embryos (p<0.009).
To have a view of transcriptomic changes in Sorbs2 mutants, we performed RNA-seq on wild type, Sorbs2+/- and Sorbs2-/- embryos. PCA analysis indicates that wild type embryos are clustered together, whereas Sorbs2-/- embryos are more scattered (Figure 3B), which is consistent with diverged cardiac phenotypes of Sorbs2-/- embryos.
Interestingly, the majority of Sorbs2+/- samples are juxtaposed more closely to Sorbs2-/- embryos in PCA plot, indicating a molecular phenotype in heterozygous mutants. We selected genes significantly down-regulated in heterozygous mutants (log2(fold change)>0.25, p<0.05) to perform GO analysis and found that these genes are enriched in pathways involved in muscle development and embryonic morphogenesis (Figure 3C, Table S4). Using the same threshold, we selected genes significantly down-regulated in homozygous mutants to perform GO analysis. These genes are enriched in pathways regulating heart development, myofibril assembly and cardiac septum development (Figure 3D, Table S5). Particularly, the Notch signaling pathway was also in the enrichment list. Looking closer, we noted that genes involved in cardiac development, myofibril assembly and contraction force were down-regulated in nearly all the homozygous mutants (Figure 3E). The decrease of posterior SHF marker genes were less general but still clearly down-regulated in the majority of Sorbs2-/- embryos (Figure 3F). Decreased Tbx5 expression in posterior SHF of Sorbs2-/- embryos was validated by RNA in situ hybridization (n=3, Figure 3G). A portion of embryos had obvious down-regulation of Notch and Shh signaling targets (Figure 3H), which is consistent with a low penetrance of ASD in homozygous mutants. RNA in situ hybridization confirmed decreased Heyl expression in posterior SHF of Sorbs2-/- embryos (n=1, Figure 3I). Next, we verified the upstream molecular changes of Notch signaling found in hESCs differentiation model. Indeed, we noted that Notch1 expression level significantly decreased whereas c-ABL significantly increased in Sorbs2-/- embryos (Figure 3J-3K).”
[Editors’ note: what follows is the authors’ response to the second round of review.]
Essential Revisions:
There are two sets of experiments that are deemed critical (please see details in the individual reviews):
1. A rescue experiment using recombinant NOTCH or SHH in the cell culture model.
2. Test additional pSHF markers by in situ hybridization on the DMP or pSHF of mutant embryos to validate and regionalize at least some of the expression changes revealed by whole-embryo RNA-seq.
We thank the editors and reviewers for taking the time to evaluate our manuscript. As per suggestion, we have performed rescued experiment with recombinant Shh protein in in vitro cardiomyocyte differentiation model and performed in situ hybridization with an additional pSHF marker. Please check details in the following responses to reviewers.
eLife's editorial process also produces an assessment by peers designed to be posted alongside a preprint for the benefit of readers.
Reviewer #1:
The resubmitted version has addressed the issues raised by the previous round of review, albeit some questions remain.
I have 3 recommendations for authors:
1. Phenotypic analysis in the mouse mutant has been extended, but it is still limited. However, the authors did find developmental abnormalities with the DMP, which is interesting (albeit predictable). Phenotyping would benefit from testing additional pSHF markers and perhaps by testing basic mechanisms such as cell proliferation and cell death
As per reviewer’s suggestion, we have tested an additional pSHF marker Hoxb1 and found that it was downregulated in pSHF (3 out of 4 embryos).
Excerpt from Results
“Decreased Tbx5 (n=3) and Hoxb1 (n=3 out of 4) expression in posterior SHF of Sorbs2-/- embryos was validated by RNA in situ hybridization (Figure 3G and 3H).”
2. Mechanisms: the focus of the authors in a so called c-Abl-Notch1-Shh "axis" remains speculative and based on gene (and in some cases protein) expression assays in differentiated hES cells and in whole embryo RNA-seq. These results are insufficient to draw conclusions about the pSHF or whatever it is happening in the DMP. Claims to the effect that Sorbs2 specifies "the fate of second heart field (SHF) progenitors through c-ABL/NOTCH/SHH axis" are unsubstantiated and should be removed (in the abstract, subheading of results, discussion), or be proposed as a speculative hypothesis in the discussion. In addition, the authors show no evidence that Sorbs2 specifies the fate of SHF progenitors. On the other hand, new data added to the resubmission clearly show a downregulation of Tbx5 in the DMP/pSHF region of mutants. It is unclear whether this is due to hypoplasia of the DMP or to reduced expression of the gene. In any case, this could be a valuable clue to understand mechanisms as Tbx5 is a critical factor in DMP development (e.g. Xie et al., 2012, Moskowitz group, which has also shown interaction between Tbx5 and SHH signalling), thus it could be part of the pathogenesis of ASD in this mutant. This should be discussed and contrasted with the NOTCH hypothesis.
We agree with Reviewer 1 that our work lacks of embryonic evidence to substantiate our previous claim. As per reviewer’s suggestion, we have removed the statement, “specifying the fate of SHF through c-ABL/NOTCH/SHH axis”, from the Abstract and subheading of Results. We state it as a hypothesis in discussion.
We thank the reviewer for drawing our attention to the important Tbx5 works and point out additional molecular explanation for the pathogenesis of Sorbs2 mutants. Now we have cited this article and discussed the possible role of Tbx5 in the pathogenesis of Sorbs2 mutants.
Excerpt from Discussion
“In both models, we detected increased protein level of NOTCH1 endocytosis facilitator c-ABL, decreased NOTCH1 protein level and impaired SHH signaling. Notch and Shh signaling are essential for SHF development(24). Notch signaling promotes Smo accumulation in cilia and enhancing cellular response to Shh, placing Notch upstream of Shh signaling (16, 25). Therefore, SORBS2 might promote SHF progenitor fate through c-ABL/NOTCH/SHH axis. In addition, Tbx5 was also significantly downregulated in posterior SHF of Sorb2 mutants. Tbx5-Hh molecular network is an essential regulatory mechanism in SHF for atrial septation(26). It is likely that Tbx5 downregulation also contributes to the pathogenesis of ASD through its effect on Hh signaling. Consistently, adding recombinant SHH protein is sufficient to rescue SHF marker gene expression and cardiomyocyte differentiation efficiency.”
3. The authors should discuss the apparently inconsistent findings of increased expression of Tbx5 in the hES cell model, and the decreased expression of the same gene in the pSHF of mutant embryos.
As per reviewer’s suggestion, we have added the relevant discussion about the discrepancy between in vitro and in vivo model. Based on literature, Tbx5 mainly functions as a FHF regulator in in vitro cardiogenesis (Anderson etc. Nat. Commun. 2018; 9: 3140). The simplified in vitro model may not fully recapitulate the multiple roles of Tbx5 in regulating cardiogenesis in vivo.
Excerpt from Discussion
“However, TBX5 was upregulated in D5 SORBS2 knockdown cells. It is likely that in vitro cardiomyocyte differentiation is a simplified model that can not fully recapitulate the in vivo spatial and temporal information of various cardiac progenitors and therefore has less regulatory layers in which TBX5 may predominantly function as a FHF regulator. Indeed, Tbx5 knockdown reduces FHF progenitors and has no effect on SHF progenitors in an in vitro cardiogenesis model(27).”
Reviewer #3:
The authors have replied to several of my concerns such as the arguments that SORBS2 specifies SHF progenitors through c-ABL/NOTCH/SHH. They used PCR, RNA-seq and in situ hybridization to validate their hypothesis. Thus, they showed that Notch1 protein expression level is significantly decreased whereas c-ABL is increased in -/-Sorbs2-/- mutant embryos. In this revised version, they better used their in vivo model to support their hypothesis. The phenotype of the DMP is now examined which is consistent with ASD observed at E18.5. Control quality of shRNA KD hES cells is now performed and no apoptosis is detected. Expression of pSHF markers is now shown including Hoxb1, Hoxa1, Aldh1a2 and Tbx5 which confirms the previous statement. The rational to examine NOTCH and SHH signals is now better explained. Finally, human genetics data is improved and detection of significant enrichment of SORBS2 rare damaging variant in patients with ASD vs non-ASD is great. However, I agree with reviewer#3 that hiPS cells model rather than hESC would have been better to support their hypothesis. In addition, a rescue experiment using recombinant NOTCH or SHH treatment in the in vitro culture would have been important to perform in order to support the main finding of this study.
We thank the reviewer’s constructive suggestion that would strengthen our conclusion. We have performed rescue experiment with recombinant SHH protein. Results showed that it was sufficient to upregulate SHF markers gene expression and improve the efficiency of cardiomyocyte differentiation, suggesting that SORBS2’s function is mediated through SHH signaling.
Excerpt from Results
“We applied recombinant SHH protein to check whether it can rescue defects caused by SORBS2 knockdown. As expected, exogenous SHH activated PTCH1 and GLI1 expression (Figure 1O). It also upregulated the expression of SHF marker ISL1 and MEF2C in D5 SORBS2-shRNA1 cells (Figure 1O) and rescued cardiomyocyte differentiation efficiency with more cells presenting a polygonal or spindle-like shape (Figure 1P and 1Q).”
https://doi.org/10.7554/eLife.67481.sa2Article and author information
Author details
Funding
Science and Technology Commission of Shanghai Municipality (20JC1418500)
- Qihua Fu
Collaborative Innovation Program of Shanghai Municipal Health Commission (2020CXJQ01)
- Zhen Zhang
National Natural Science Foundation of China (81371893)
- Qihua Fu
National Natural Science Foundation of China (31371465)
- Zhen Zhang
Shanghai Municipal Education Commission-Gaofeng Clinical Medicine Grant Support (20171925)
- Zhen Zhang
Shanghai Sailing Program (18YF1414800)
- Xiaoqing Zhang
Innovative Research Team of High-level Local Universities in Shanghai (SSMU-ZDCX20180200)
- Zhen Zhang
Science and Technology Commission of Shanghai Municipality (20DZ2260900)
- Qihua Fu
National Natural Science Foundation of China (81741031)
- Qihua Fu
National Natural Science Foundation of China (81871717)
- Qihua Fu
National Natural Science Foundation of China (81672090)
- Qihua Fu
National Natural Science Foundation of China (31771612)
- Zhen Zhang
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank Dr. Guoping Feng at Massachusetts Institute of Technology for Sorbs2flox/flox mice, Dr. Xin Cheng at Shanghai Institute of Biochemistry and Cell Biology for H1 ES cell line, and Dr. Bingshan Li at Vanderbilt University and Dr. Hao Mei at University of Mississippi Medical Center for advice on genetic data analyses.
Ethics
Human subjects: The study conformed to the principles outlined in the Declaration of Helsinki and approval for human subject research was obtained from the Institutional Review Board of Shanghai Children's Medical Center (SCMC-201015). Written informed consents were obtained from parents or legal guardians of all patients.
Animal experimentation: Animal care and use were in accordance with the NIH guidelines for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee of Shanghai Children's Medical Center (SCMC-LAWEC-2017006).
Senior Editor
- Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany
Reviewing Editor
- Antonio Baldini, University Federico II, Italy
Reviewer
- Stephane Zaffran, Aix Marseille University, France
Publication history
- Received: February 12, 2021
- Accepted: May 16, 2021
- Version of Record published: June 8, 2021 (version 1)
Copyright
© 2021, Liang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 1,248
- Page views
-
- 114
- Downloads
-
- 4
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
SORBS2 is a genetic factor contributing to cardiac malformation of 4q deletion syndrome patients
eLife 10:e67481.
https://doi.org/10.7554/eLife.67481
Further reading
-
- Developmental Biology
- Stem Cells and Regenerative Medicine
Cell-free DNA (cfDNA) present in the bloodstream or other bodily fluids holds potential as a non-invasive diagnostic for early disease detection. However, it remains unclear what cfDNA markers might be produced in response to specific tissue-level events. Organoid systems present a tractable and efficient method for screening cfDNA markers. However, research investigating the release of cfDNA from organoids is limited. Here, we present a scalable method for high-throughput screening of cfDNA from cardiac organoids. We demonstrate that cfDNA is recoverable from cardiac organoids, and that cfDNA release is highest early in differentiation. Intriguingly, we observed that the fraction of cell-free mitochondrial DNA appeared to decrease as the organoids developed, suggesting a possible signature of cardiac organoid maturation, or other cardiac growth-related tissue-level events. We also observe alterations in the prevalence of specific genomic regions in cardiac organoid-derived cfDNA at different timepoints during growth. In addition, we identify cfDNA markers that were increased upon addition of cardiotoxic drugs, prior to the onset of tissue demise. Together, these results indicate that cardiac organoids may be a useful system towards the identification of candidate predictive cfDNA markers of cardiac tissue development and demise.
-
- Developmental Biology
- Neuroscience
Fenestrated and blood-brain barrier (BBB)-forming endothelial cells constitute major brain capillaries, and this vascular heterogeneity is crucial for region-specific neural function and brain homeostasis. How these capillary types emerge in a brain region-specific manner and subsequently establish intra-brain vascular heterogeneity remains unclear. Here, we performed a comparative analysis of vascularization across the zebrafish choroid plexuses (CPs), circumventricular organs (CVOs), and retinal choroid, and show common angiogenic mechanisms critical for fenestrated brain capillary formation. We found that zebrafish deficient for Gpr124, Reck, or Wnt7aa exhibit severely impaired BBB angiogenesis without any apparent defect in fenestrated capillary formation in the CPs, CVOs, and retinal choroid. Conversely, genetic loss of various Vegf combinations caused significant disruptions in Wnt7/Gpr124/Reck signaling-independent vascularization of these organs. The phenotypic variation and specificity revealed heterogeneous endothelial requirements for Vegfs-dependent angiogenesis during CP and CVO vascularization, identifying unexpected interplay of Vegfc/d and Vegfa in this process. Mechanistically, expression analysis and paracrine activity-deficient vegfc mutant characterization suggest that endothelial cells and non-neuronal specialized cell types present in the CPs and CVOs are major sources of Vegfs responsible for regionally restricted angiogenic interplay. Thus, brain region-specific presentations and interplay of Vegfc/d and Vegfa control emergence of fenestrated capillaries, providing insight into the mechanisms driving intra-brain vascular heterogeneity and fenestrated vessel formation in other organs.
