Traumatic injury compromises nucleocytoplasmic transport and leads to TDP-43 pathology
- Department of Pediatrics, Children's Hospital of Pittsburgh, University of Pittsburgh Medical Center, United States
- Department of Chemistry and Biochemistry, University of Arizona, United States
- Department of Pathology and Laboratory Medicine, Boston University School of Medicine, United States
- Boston VA Healthcare System, United States
- Department of Neurobiology, University of Pittsburgh School of Medicine, United States
- LiveLike Lou Center for ALS Research, Brain Institute, University of Pittsburgh School of Medicine, United States
- Molecular, Cellular & Developmental Biology, University of Colorado, United States
- Physical Medicine & Rehabilitation; Safar Center for Resuscitation Research, University of Pittsburgh, United States
- Center for Neuroscience; Center for the Neural Basis of Cognition; Critical Care Medicine, University of Pittsburgh, United States
- Department of Pathology, University of Pittsburgh, United States
- Department of Human Genetics, University of Pittsburgh School of Public Health, United States
Figures
Figure 1 with 1 supplement
Proteomic analysis of Drosophila brains identifies novel components of the nucleocytoplasmic transport machinery that are disrupted in response to TBI.
(A) Schematic flow of Drosophila larval brain traumatic injury, dissection, and proteomics analysis. (B) Volcano plot showing fold-change and p-values for all detected proteins (student’s t-test, …
Figure 1—figure supplement 1
Proteomic analysis of other altered proteins in response to traumatic injury.
(A–E) Volcano plots showing fold-change and p-values of altered pathways. (F) p-Values for gene ontology (GO) association of proteins detected during mass spectrometry and using the Bonferroni …
Figure 2 with 2 supplements
Nuclear pore complex morphology and RanGAP1 distribution defects as well as TBPH/NPC coaggregation after traumatic injury in vivo.
(A) Immunofluorescence images of the ventral nerve cord (VNC) of trauma brain injury (Trauma) and non-TBI control w1118 Drosophila larvae stained with the nuclear pore complex (NPC) marker (Mab414, …
Figure 2—figure supplement 1
Repeated traumatic injury does not lead to cell death immediately following injury.
(A) TUNEL assay of apoptotic cells (green) in w1118 Drosophila brains with or without trauma. Scale bar = 25 µM. (B) Quantification of TUNEL-positive cells in Drosophila brains immediately after TBI …
Figure 2—figure supplement 2
RanGAP1 and NUP62 distribution is mildly altered in the contralateral hemisphere in a CCI trauma rat model.
(A) Immunohistochemical staining of RanGAP1 in rat hippocampal region contralateral hemisphere of trauma and control (sham) animals from Figure 2G. Inset box corresponds to ×40 magnification. Scale …
Figure 3 with 1 supplement
Pharmacological suppression of nuclear export rescues trauma-mediated nucleocytoplasmic transport defects and lethality in vivo.
(A) Representative immunofluorescence images of larval ventral nerve cord (VNC) cells expressing NLS-NES-GFP or NLS-ΔNES-GFP in motor neurons (OK371-gal4) exposed to traumatic brain injury (TBI) or …
Figure 3—figure supplement 1
Pharmacological suppression of nuclear export rescues trauma mediated Tbph aggregation.
(A) Representative immunofluorescence images of w1118 adult Drosophila exposed to traumatic injury and treated with DMSO or KPT-350 (0.05 mM or 0.5 mM) for 10 days and untreated (no trauma control) …
Figure 4 with 6 supplements
Nup62 expression promotes TDP-43 mislocalization and aggregation in vivo and in vitro.
(A) Drosophila larval brain overexpressing Nup62 (Nup62 OE) in motor neurons (Ok371-gal4) and controls (eGFP) stained for the Drosophila homolog of TDP-43, TAR DNA-binding protein-43 homolog (Tbph), …
Figure 4—figure supplement 1
Nup62 expression modulates TBPH and TDP-43 aggregation as well as mislocalization.
(A) Representative immunofluorescence images of adult Drosophila brain overexpressing Nup62 (Nup62 OE) in motor neurons show Tbph (red) aggregation compared to eGFP controls. Lamin was used as a …
Figure 4—figure supplement 2
Expression of Nup62 but not Nup214 or Nup43 leads to NPC/TBPH coaggregation.
(A) Larval VNCs overexpressing Nup62, Nup214, or eGFP control in motor neurons stained with Tbph (red) and NPC/Mab414 (green). Tbph colocalized with NPC/Mab414 (merge) in Nup62 OE but not Nup214 …
Figure 4—figure supplement 3
Increased Nup93-2 but not Nup44A expression partially leads to TBPH mislocalization and aggregation in vivo.
(A) Larval brains expressing Nup93-2 or Nup44A and w1118 control stained for Tbph and the nuclear envelope marker Lamin show Tbph accumulation. Scale bar = 25 µM. Inset box corresponds with zoom …
Figure 4—figure supplement 4
Nup214 and Nup43 expression leads TDP-43 mislocalization and aggregation.
(A) Drosophila larval brain overexpressing Nup214 (Nup214 OE), HA-tagged Nup43 (Nup43 OE), or eGFP controls (controls) in motor neurons (OK371-gal4) stained for the Tbph (red), and the nuclear …
Figure 4—figure supplement 5
NUP54 expression does not alter TDP-43 localization.
Representative immunofluorescence images of HEK293T cells expressing HA-eGFP or NUP54-HA-EGFP and stained for endogenous TDP-43 (red). Inset box corresponds to zoom image. Scale bar = 25 µM.
Figure 4—figure supplement 6
Expression of other upregulated proteins in the top five categories does not alter TDP-43 localization.
Representative immunofluorescence images of HEK293T cells expressing: (A) nucleoside diphosphate kinase 1 (NME1, green), the human homolog of Drosophila awd; (B) heat-shock protein family B (small) …
Figure 5 with 1 supplement
Nups expression reduces motor function and lifespan, and knockdown partially rescues trauma-mediated motor dysfunction in Drosophila.
(A) Percentage of flies that climbed 4 cm in 20 seconds for Nup62, Nup214, and Nup43-overexpressing (Nup62 OE, Nup214 OE and Nup43 OE) animals compared to eGFP control (n = 3 trials, 10 animals per …
Figure 5—figure supplement 1
Knockdown of Nup62/Nup214 together extends lifespan.
(A, B) Kaplan-Meier survival curve of Nup62 RNAi (A) or Nup214 RNAi (B) exposed to repeated traumatic brain injury (TBI) were raised on RU486 (+ RU486) or ethanol (-RU486) showed no change (n = …
Figure 6 with 1 supplement
NUP62 pathology is present in brain tissue of patients with mild and severe CTE and coaggregates with pTDP-43 inclusion.
(A) NUP62 immunohistochemical staining in human frontal cortex tissue from a control individual without neurodegenerative disease, showing faint perinuclear staining for NUP62 (arrow). (B) NUP62 …
Figure 6—figure supplement 1
Control NUP62 immunohistochemistry cases.
(A, B) NUP62 immunohistochemical staining in human frontal cortex tissue from two control individual without neurodegenerative disease.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | w1118 | Bloomington Drosophila Stock Center | BDSC:3605; FLYB: FBst000360; RRID:BDSC_3605 | w[1,118] |
| Genetic reagent (D. melanogaster) | w1118; P{UAS-NLS-NES+-GFP}5A | Bloomington Drosophila Stock Center | BDSC:7032; FLYB: FBst0007032; RRID:BDSC_7032 | w[1,118]; P{w[+ mC] = UAS-NLS-NES[+]-GFP}5A |
| Genetic reagent (D. melanogaster) | y1 w*; P{UAS-NLS-NESP12-GFP}2A | Bloomington Drosophila Stock Center | BDSC:7033; FLYB: FBst0007033; RRID:BDSC_7033 | y (Amador-Ortiz et al., 2007) w[*]; P{w[+ mC] = UAS-NLS-NES[P12]-GFP}2A |
| Genetic reagent (D. melanogaster) | w1118; P{EP}Nup44AEP2417 | Bloomington Drosophila Stock Center | BDSC:17053; FLYB: FBst0017053; RRID:BDSC_17053 | w[1,118]; P{w[+ mC] = EP}Nup44A[EP2417] |
| Genetic reagent (D. melanogaster) | w1118; P{EPg}Nup93-2HP35056 | Bloomington Drosophila Stock Center | BDSC:21975; FLYB: FBst0021975; RRID:BDSC_21975 | w[1,118]; P{w[+ mC] = EPg}Nup93-2[HP35056] |
| Genetic reagent (D. melanogaster) | P{VSH330104}attP40 | Vienna Drosophila Resource Center | VDRC:v330104; FLYB: FBst0491076; RRID:FlyBase_FBst0491076 | P{VSH330104}attP40 |
| Genetic reagent (D. melanogaster) | P{KK108318}VIE-260B | Vienna Drosophila Resource Center | VDRC: v100588; FLYB: FBst0472461; RRID:FlyBase_FBst0472461 | P{KK108318}VIE-260B |
| Genetic reagent (D. melanogaster) | UAS-Nup62 | This paper | Created at BestGene | |
| Genetic reagent (D. melanogaster) | M{UAS-Nup214.ORF}ZH-86Fb | FLYORF | FLYORF: F001467; FLYB: FBst0500182; RRID:FlyBase_FBst0500182 | M{UAS-Nup214.ORF}ZH-86Fb |
| Genetic reagent (D. melanogaster) | M{UAS-Nup43.ORF.3xHA.GW}ZH-86Fb | FLYORF | FLYORF: F003133; FLYB: FBst0502466; RRID:FlyBase_FBst050246 | M{UAS-Nup43.ORF.3xHA.GW}ZH-86Fb |
| Genetic reagent (D. melanogaster) | CRISPR/Cas9 hTDP43-WT | Gift from David B. Morton Chang and Morton, 2017 | ||
| Cell line (Homo sapiens) | Human Embryonic Kidney cells (HEK 293T) | ATCC | RRID:CVCL_0063 | |
| Transfected construct (human) | mRFP-FKBP1A Plasmid | Addgene | (Cat #: 67514); RRID:Addgene_67514 | transfected construct (human) |
| Transfected construct (human) | Frt-V5-HspB2 Plasmid | Addgene | (Cat #: 63103); RRID:Addgene_63103 | transfected construct (human) |
| Transfected construct (human) | FLAG NM23-H1/NME1 Plasmid | Addgene | (Cat #: 25000); RRID:Addgene_25000 | transfected construct (human) |
| Transfected construct (human) | pEGFP SF2/SRSF1 Plasmid | Addgene | (Cat #: 17990); RRID:Addgene_17990 | transfected construct (human) |
| Transfected construct (human) | Nup54-HA-eGFP Plasmid | VectorBuilder | This paper | transfected construct (human) |
| Transfected construct (human) | HA-eGFP Plasmid | VectorBuilder | This paper | transfected construct (human) |
| Transfected construct (human) | mRuby Plasmid | Gift from Dr. Christopher Donnelly | This paper | transfected construct (human) |
| Transfected construct (human) | NUP62-mRuby Plasmid | Gift from Dr. Christopher Donnelly | This paper | transfected construct (human) |
| Antibody | anti-Nup214 (Guinea Pig polyclonal) | Gift from Dr. Christos Samakovlis Roth et al., 2003 | WB (1:5000) | |
| Antibody | Anti-Lamin Dm0 (Mouse monoclonal) | DSHB | Cat# ADL84.12; RRID:AB_528338 | IF(1:200)WB (1:1000) |
| Antibody | anti-α-Tubulin (Mouse monoclonal) | Sigma-Aldrich | Cat#: T5168; RRID:AB_477579 | WB (1:10,000) |
| Antibody | anti-Tbph (Rabbit polyclonal) | Gift from Dr. Frank Hirth Diaper et al., 2013 | IF (1:1500)WB (1:3000) | |
| Antibody | anti-FLAG (Mouse monoclonal) | Sigma-Aldrich | Cat#: F1804; RRID:AB_259529 | IF (1:1000) |
| Antibody | anti-GFP (Chicken polyclonal) | Abcam | Cat#: ab13970; RRID:AB_300798 | IF (1:1000) |
| Antibody | anti-TDP43 (Rabbit polyclonal) | Proteintech | Cat#: 10782–2-AP; RRID:AB_615042 | IF (1:1000) |
| Antibody | anti-phospho-TDP43 (Rat monoclonal) | Millipore SIGMA | Cat#: MABN14; RRID:AB_11212279 | IF (1:1000) |
| Antibody | anti-Mab414 (Mouse monoclonal) | Abcam | Cat#: ab24609; RRID:AB_448181 | IF (1:1000) |
| Antibody | anti-RanGAP1 (Rabbit polyclonal) | Millipore SIGMA | Cat#: ABN1674 | IF (1:200) |
| Antibody | anti-Nup62 (Mouse polyclonal) | BD Transduction Laboratories | Cat#: 610497; RRID:AB_397863 | IHC/IF (1:500) |
| Antibody | anti-pTDP-43 (Rabbit polyclonal) | Cosmo Bio | Cat#:NC0877946; RRID:AB_1961899 | IF (1:1000) |
| Antibody | anti-Nup62 (Mouse polyclonal) | Roche Applied Science | Cat#: 610497; RRID:AB_397863 | IHC (1:400) |
| Antibody | anti-RanGAP1 (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat#: sc-28322; RRID:AB_2176987 | IHC (1:1000) |
| Sequence-based reagent | Futsch | This paper | PCR primers (5'–3'): | Forward: CAAAGCCCACTCACCTTTCReverse: CTGCTCCTGCCAACATCTProbe: AGTCTCTGGAAATGCAGCACCACT |
| Sequenced-based reagent | dNup93-2 | This paper | PCR primers (5'–3'): | Forward: ACACCGTCCGCGAAATACReverse: ACTCAACCGCCACCTTAACProbe: ATGGCCGCTGGTTTACTACGGATT |
| Sequenced-based reagent | dNup214 | This paper | PCR primers (5'–3'): | Forward: CCTAAGTGAGGACAAGGATGAGReverse: GGCATAGTCTGCAGCTTCTTProbe: TGCCTTCGACACTTCTACAACGCA |
| Sequenced-based reagent | dNup54 | This paper | PCR primers (5'–3'): | Forward: GAGTGAGCTGACAGAACTCAAGReverse: CTCGGCCAGTTTCCGTTTATProbe: CCACTGCCACAGCGAAGATACTTGA |
| Sequenced-based reagent | dNup44A | This paper | PCR primers (5'–3'): | Forward: AAGGTATCCTCCACCAATACCCReverse: TTGGGTGCAAACTCCACATCProbe: TTGTAGACTCGCGGACCAGTGTCA |
| Sequenced-based reagent | dNup62 | This paper | PCR primers (5'–3'): | Forward: CTTGCTGTTGTCTGCATCTCReverse: CAGCACCAGCTTCAGGAProbe: ACATTCTCTTTCGGAACACCGGCA |
| Sequenced-based reagent | Emb (Exportin) | This paper | PCR primers (5'–3'): | Forward: GGTCACGCGTATGTCATTCAReverse: GTTCACATTGACGCCATTCACProbe: AGCATGTCCAGATATATGCGGCCC |
| Sequenced-based reagent | dNup43 | This paper | PCR primers (5'–3'): | Forward: TTGCATCTGATCCTCCTCCACReverse: ACCGCCATGGAGTTCGTProbe: TGGACGTTAAACACGCTGAGATGACC |
| Sequenced-based reagent | dGapdh | This paper | PCR primers (5'–3'): | Forward: CAACAGTGATTCCCGACCAGReverse: TTCGTCAAGCTAATCTCGTGGProbe: CCAAAACTATCGTACAAACCCGGCG |
| Commercial assay or kit | 3,3'-diaminobenzidine (DAB) | Vector Laboratories | Cat: #SK-4100; RRID:AB_2336382 | |
| Commercial assay or kit | NE-PER nuclear-cytoplasmic extraction kit | ThermoFisher Scientific | Cat #: 78,833 | |
| Commercial assay or kit | Nup62 ELISA | LSBio | Cat #: LS-F22196 | |
| Chemical compound, drug | KPT-350 | Karyopharm | ||
| Chemical compound, drug | KPT-276 | Selleck Chem | Cat #: S7251 | |
| Software, algorithm | GraphPad Prism 6 | GraphPad Prism 6 | RRID:SCR_002798 |
Additional files
-
Supplementary file 1
Table summary of the proteomic analysis and GO association of approximately 2000 proteins identified in TBI and control (non-TBI) condition including the fold changes and statistical significance.
- https://cdn.elifesciences.org/articles/67587/elife-67587-supp1-v1.xlsx
-
Supplementary file 2
Summary of neuropathology cases (severe CTE and mild CTE) and controls.
Table reports all relevant information for the human sample used in the study including age, sex, phosphor TDP-43, dementia, sports played, number of years played, Braak stage (0–6), consortium to establish a registry for Alzheimer’s disease (CERAD) score (0–3), and CAA score (0–3).
- https://cdn.elifesciences.org/articles/67587/elife-67587-supp2-v1.xlsx
-
Supplementary file 3
GO-ID and p-Values as well as GO associations for genes whose protein levels increase or decrease > 1.6-fold.
- https://cdn.elifesciences.org/articles/67587/elife-67587-supp3-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/67587/elife-67587-transrepform1-v1.docx
