Effects of mango and mint pod-based e-cigarette aerosol inhalation on inflammatory states of the brain, lung, heart, and colon in mice
- Pulmonary and Critical Care Section, VA San Diego Healthcare System, United States
- Division of Pulmonary, Critical Care and Sleep Medicine and Section of Physiology, Department of Medicine, University of California San Diego (UCSD), United States
- Department of Pharmacology, University of California San Diego (UCSD), United States
- Department of Pharmacology and Experimental Therapeutics, College of Pharmacy and Pharmaceutical Sciences, University of Toledo, United States
- Department of Pathology, University of California San Diego (UCSD), United States
- Division of Pulmonology, Department of Internal Medicine, Gangnam Severance Hospital, Yonsei University College of Medicine, United States
- Department of Medicinal and Biological Chemistry, College of Pharmacy and Pharmaceutical Sciences, University of Toledo, United States
Figures
Figure 1 with 1 supplement
Three months of JUUL aerosol inhalation leads to an increase of pro-inflammatory cytokines in different regions of the brain.
Brains were harvested at the end point and the regions for NAc-core, NAc-shell and Hippocampus were harvested and frozen. RNA was extracted and qPCR was performed to quantify the expression of Tnfa, …
Figure 1—figure supplement 1
Inflammatory gene expression changes in the central nervous system in mice exposed to JUUL Mango and JUUL Mint.
These data are graphed with each exposure type (air – blue, mango – orange, and mint – green) grouped for ease of comparison of gene expression at 1 month (white columns) and 3 months (solid …
Figure 2 with 1 supplement
Three months of JUUL aerosol inhalation leads to an increase of inflammatory mediators HMGB1 and RAGE.
Brains were harvested at the end point and the regions for NAc-core, NAc-shell and Hippocampus were sectioned. Later, protein was extracted and Western Blot was performed to quantify the expression …
Figure 2—figure supplement 1
Inflammatory protein level changes in the central nervous system in mice exposed to JUUL Mango and JUUL Mint.
These data are graphed with each exposure type (air – blue, mango – orange, and mint – green) grouped for ease of comparison of protein levels at 1 month (white columns) and 3 months (solid columns) …
Figure 3 with 1 supplement
Three months of inhalation of JUUL aerosols alters inflammatory and fibrosis associated gene expression in cardiac tissue.
Hearts were harvested, and RNA was extracted from the left ventricle and qPCR was performed to quantify the gene expression of different cytokines, chemokines and fibrosis-associated genes. …
Figure 3—figure supplement 1
Inflammatory gene expression changes in the hearts of mice exposed to JUUL Mango and JUUL Mint.
Mice exposed to JUUL Mint aerosols three times daily (60 min total) for 1 month had diminished expression of Tnfa, Il6, Col1a1, and Col3a1 relative to air controls. Data were analyzed with one-way …
Figure 4
Chronic inhalation of JUUL aerosols alters Ccl2 and Il13 levels in cardiac tissue.
Cardiac apex tissue was lysed, total protein isolated, and inflammatory proteins quantified by Bio-Plex Pro Mouse Cytokine 23-plex Assay. Both Il13 and Ccl2 levels were diminished in cardiac tissue …
Figure 5 with 1 supplement
Three months of JUUL aerosol inhalation alters pro-inflammatory markers in colon.
Inflammation was assessed in the colon at 1 and 3 months. Panels show inflammation markers in the colon in Tnfa (A) 1 month and (B) 3 months, Il6 at (C) 1 month and (D) 3 months, Il1b at (E) 1 month …
Figure 5—figure supplement 1
Inflammatory gene expression changes in the colon of mice exposed to JUUL Mango and JUUL Mint.
These data are graphed with each exposure type (air – blue, mango – orange, and mint – green) grouped for ease of comparison of gene expression at 1 month (white columns) and 3 months (solid …
Figure 6
Unique RNAseq signatures in the lungs exposed to different flavors of JUUL aerosols.
(A) Venn diagram of gene expression unique to JUUL Mango (155) and JUUL Mint (Alhaddad et al., 2014b). Gene expression changes common to both aerosols (99) suggest that they are due to chemicals …
Figure 7 with 1 supplement
JUUL exposure alters airway inflammatory responses in the setting of inhaled LPS challenge.
BAL was harvested at the endpoints, and cytokines and chemokines were quantified by ELISA. Ccl2 at (A) 1 month, and (B) 3 months, Cxcl1 at (C) 1 month and (D) 3 months, Cxcl2 at (E) 1 month and (F) …
Figure 7—figure supplement 1
Inflammatory cytokine levels in the BAL of mice exposed to JUUL Mango and JUUL Mint prior to inhaled LPS challenge.
These data are graphed with each exposure type (air – blue, mango – orange, and mint – green) grouped for ease of comparison of protein levels at 1 month (white columns) and 3 months (solid columns) …
Figure 8 with 1 supplement
Cardiac inflammation induced by inhaled LPS challenge is increased in the setting of 3 months of JUUL aerosol inhalation.
Hearts were harvested, and RNA was extracted from the left ventricle and qPCR was performed to quantify the gene expression of different cytokines, chemokines and fibrosis-associated genes. …
Figure 8—figure supplement 1
Inflammatory gene expression changes in the hearts of mice exposed to JUUL Mango and JUUL Mint and challenged with inhaled LPS.
Mice exposed to JUUL Mint aerosols three times daily (60 min total) for 1 month prior to LPS challenge had increased expression of Tnfa, Il1b, Ccl2, Ccl3, Cxcl1, and Cxcl2, and decreased Postn, …
Figure 9 with 1 supplement
Three months of JUUL aerosol inhalation does not alter inflammatory markers in the setting of by inhaled LPS challengein the gastrointestinal tract.
Inflammation was assessed in the colon at 1 and 3 months. Panels show inflammation markers in the colon in Tnf (A) 1 month and (B) 3 months, Il6 at (C) 1 month and (D) 3 months, Il1b at (E) 1 month …
Figure 9—figure supplement 1
Inflammatory gene expression in the colon of mice exposed to JUUL Mango and JUUL Mint and challenged with inhaled LPS.
These data are graphed with each exposure type (air – blue, mango – orange, and mint – green) grouped for ease of comparison of gene expression at 1 month (white columns) and 3 months (solid …
Figure 10
Overview of JUUL aerosol induced inflammatory changes across organs.
Appendix 1—figure 1
JUUL aerosol inhalation does not alter heart rate, heart rate variability or blood pressure.
Before assessment of lung function, mice underwent heart rate and blood pressure measurements using Emka non-invasive ECG Tunnels and the CODA non-invasive blood pressure system at 1 and 3 months. …
Appendix 1—figure 2
Chronic exposure of JUUL does not increase airways resistance or induce airways hyperreactivity.
At end points prior to harvest, mice underwent tracheostomy and attached to the FlexiVent mouse ventilator (SciReq). Airways resistance, lung elastance and pressure-volume (PV) loops were measured …
Appendix 1—figure 3
Chronic JUUL exposure does not affect leukocyte levels in the airways or influx into the airways and parenchyma in the setting of inhaled LPS challenge.
BAL was obtained, leukocyte counts were performed. BAL total cell counts in air versus JUUL exposed mice were no different at (A) 1 month and (B) 3 months, nor were neutrophils counts at (C) 1 month …
Appendix 1—figure 4
Chronic JUUL exposure does not affect lung parenchyma at baseline or in the setting of inhaled LPS challenge.
The left lung lobe was fixed with formalin at 25 cm3 water pressure and stained with H&E. Representative pictures from H&E staining of lung tissue are shown in A,B,C for 1 month and (D,E,F) for 3 …
Appendix 1—figure 5
Chronic exposure of JUUL for 3 months does not induce fibrosis in the liver, heart, and kidney.
Collagen deposition was quantified by image analysis (using ImageJ) of lung histological slides stained with Masson’s trichrome. Representative pictures are shown for liver tissue in (A) Air …
Tables
Table 1
Primer sequences for qRT-PCR on colonic tissues.
| qPCR primers (Mouse) | Forward primer (3’- 5’) | Reverse primer (3’- 5’) |
|---|---|---|
| Mouse 18 s | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
| Mouse Il6 | CCCCAATTTCCAATGCTCTC C | CGCACTAGGTTTGCCGAGTA |
| Mouse Il1b | GAAATGCCACCTTTTGACAG T | CTGGATGCTCTCATCAGGAC A |
| Mouse Tnfa | CCACCACGCTCTTCTGTCTA | AGGGTCTGGGCCATAGAAC T |
| Mouse Il8 | CCTGCTCTGTCACCGATG | CAGGGCAAAGAACAGGTCA G |
| Mouse Ccl2 | AAGTGCAGAGAGCCAGACG | TCAGTGAGAGTTGGCTGGTG |
Table 2
Primer sequences for qRT-PCR on brain tissues.
| Targets | Primers | Sequences | References |
|---|---|---|---|
| Gapdh | Forward (Sense) | 5′-ATGACATCAAGAAGGTGGTG-3′ | Sandhir et al., 2008 |
| Reverse (Antisense) | 5′-CATACCAGGAAATGAGSCTTG-3′ | ||
| Il1b | Forward (Sense) | CCAGCTTCAAATCTCACAGCAG | Kawane et al., 2010 |
| Reverse (Antisense) | CTTCTTTGGGTATTGCTTGGGATC | ||
| Tnfa | Forward (Sense) | CACAGAAAGCATGATCCGCGACGT | Kawane et al., 2010 |
| Reverse (Antisense) | CGGCAGAGAGGAGGTTGACTTTCT | ||
| Il6 | Forward (Sense) | TCCAGTTGCCTTCTTGGGAC | Kawane et al., 2010 |
| Reverse (Antisense) | GTACTCCAGAAGACCAGAGG |
