1. Cell Biology
  2. Neuroscience

Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development

  1. Maryam Izadi
  2. Eric Seemann
  3. Dirk Schlobinski
  4. Lukas Schwintzer
  5. Britta Qualmann  Is a corresponding author
  6. Michael M Kessels  Is a corresponding author
  1. Institute of Biochemistry I, Jena University Hospital/Friedrich-Schiller-University Jena, Germany
https://doi.org/10.7554/eLife.67718
Share this article
Cite this article
  1. Maryam Izadi
  2. Eric Seemann
  3. Dirk Schlobinski
  4. Lukas Schwintzer
  5. Britta Qualmann
  6. Michael M Kessels
(2021)
Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development
eLife 10:e67718.
https://doi.org/10.7554/eLife.67718
  2. Download BibTeX
  3. Download .RIS
10 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
Cobl-like and the actin nucleator Cobl work at the same dendritic branching sites and show functional interdependence in dendritic arbor formation.

(A,B) Maximum intensity projections (MIPs) of GFP-Cobl-like and Flag-mCherry-Cobl in dendrites of developing hippocampal neurons (DIV6) in standard colors (A) and as heat map representation (B), respectively. Arrows, examples of putative, nascent dendritic branch induction sites with accumulations of both Cobl and Cobl-like. Bar, 5 µm. (C–F) MIPs of neurons showing the suppression of the Cobl-like gain-of-function phenotype (cotransfection at DIV4; fixation 34 hr thereafter) (D; GFP-Cobl-like+Scr. RNAi) by mCherryF-reported RNAi plasmids directed against Cobl (E; GFP-Cobl-like+Cobl RNAi) in comparison to control neurons (C; GFP+Scr. RNAi) and Cobl RNAi neurons (F; GFP+Cobl RNAi). (G–I) Quantitative determinations of indicated dendritic arborization parameters unveiling a full suppression of all Cobl-like functions in dendritic arbor formation by a lack of Cobl. (J–P) Related images (J–M) and quantitative data (N–P) of experiments revealing a functional dependence of Cobl on Cobl-like. Asterisks, transfected neurons. Bars, 10 µm. Data, mean ± SEM. One-way ANOVA+Tukey. Also see Figure 1—source data 1 and 2.

Figure 1—source data 1

Raw data and numerical data graphically presented in Figure 1G–I.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig1-data1-v1.xlsx
Figure 1—source data 2

Raw data and numerical data graphically presented in Figure 1N–P.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig1-data2-v1.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Comparison of domain structures and alignment of Cobl-like with the actin nucleator Cobl.

(A) Scheme of Cobl-like with its domains in comparison to the actin nucleator Cobl with its domains. Abbreviations: PRD, proline-rich domain (PRD next to the Cobl Homology domain is an Abp1- and PRMT2-binding site and therefore colored in light green reminiscent of the RD, that is, the Abp1-binding repeat domain in Cobl-like); WH2, WH2 domain. (B) Amino acid sequence alignment of murine Cobl-like (gi:74201419) and Cobl (gi:162135965) using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/). Marked are the Cobl Homology domains of both proteins (boxed in light blue) and the ‘KRAP’ motifs (boxed in red) of both proteins. Furthermore, the single C terminal WH2 domain of Cobl-like and the three WH2 domains of Cobl are marked by orange letters. The CaM-binding region of Cobl in the Cobl Homology domain and in the C terminal CaM-binding regions in Cobl and Cobl-like are boxed in yellow, the Abp1- and PRMT2-binding PRD of Cobl is boxed in light green. The Abp1-binding repeat domain of Cobl-like is boxed in green and the proline-rich region located N terminal of the Abp1-binding area is boxed in purple. Note that although Cobl-like is considered as evolutionary ancestor of Cobl, the sequence conservation between both proteins in general is very low (*, identity; ‘:’, high similarity; ‘.’, moderate similarity). Even in the most-conserved part, the so-called Cobl Homology domain, the similarity is limited to the central core of this proposed domain and to the ‘KRAP’ motifs.

Figure 1—figure supplement 2
Download asset Open asset
Cobl-like and the actin nucleator Cobl work at the same dendritic branching sites and largely phenocopy each other in their critical role in dendritic arborization.

(A–D) Maximum intensity projections (MIPs) of anti-MAP2 immunostained developing primary hippocampal neurons transfected as indicated at DIV4 and fixed 46 hr after transfection (A,C,D) and 2D representative of the 3D reconstruction of the morphology of the example neuron in A using IMARIS software (B). For detailed software parameters, see the Materials and methods section. Shown is the filament representing dendritic tracts (white lines) with branch points (magenta dots placed on the filament) and terminal points (turquoise dots placed on the filament) marked. Asterisks, transfected neurons. Bars, 20 µm. (E–H) Quantitative comparative Cobl-like and Cobl loss-of-function analyses of indicated dendritic parameters. Data, mean ± SEM. One-way ANOVA+Tukey (E–G) and two-way ANOVA+Bonferroni (H).

Figure 1—figure supplement 2—source data 1

Raw data and numerical data graphically presented in Figure 1—figure supplement 2 A-D.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig1-figsupp2-data1-v1.xlsx
Figure 1—figure supplement 2—source data 2

Raw data and numerical data graphically presented in Figure 1—figure supplement 2E-G.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig1-figsupp2-data2-v1.xlsx
Figure 2 with 1 supplement
Download asset Open asset
Cobl-like associates with syndapins.

(A) Coprecipitation analyses of GFP-tagged Cobl-like and deletion mutants thereof with immobilized syndapin I SH3 domain (GST-SdpISH3). (B) Related coprecipitation studies with the SH3 domains of syndapin I, syndapin II (SdpIISH3), and syndapin III (SdpIIISH3), respectively. (C) Reconstitution of the association of TrxHis-Cobl-like1-411 with purified GST-syndapin I and GST-syndapin I SH3 domain but not with GST. (D) Scheme of Cobl-like with its domains (PRD, proline-rich domain; RD, Abp1-binding repeat domain; WH2, WH2 domain) and deletion mutants used (red, not binding syndapins; green, binding). Red in the Cobl Homology domain, ‘KRAP’ motifs (not drawn to scale). (E) Coprecipitation assays with Cobl-like deletion mutants mapping Cobl-like’s syndapin binding sites. (F) Coimmunoprecipitations unveiling a specific association of GFP-Cobl-like1-741 with Flag-syndapin I. (G–I) Reconstitution and visualization of Cobl-like/syndapin I complexes in COS-7 cells using mitochondrially targeted syndapin I (G,H) as well as a mutant lacking the SH3 domain (Mito-mCherry-SdpI∆SH3) (I) with GFP-Cobl-like (G) and GFP-Cobl-like1-741 (H,I). Boxed areas are shown at higher magnification as insets. Line scans of fluorescence intensities of both channels are along the respective line indicated in the merged insets in G–I. Bars, 10 µm. (J) Coprecipitation of endogenous syndapin I from mouse brain lysates by TrxHis-Cobl-like1-411. (K) Endogenous coimmunoprecipitation of Cobl-like and syndapin I from mouse brain lysates.

Figure 2—figure supplement 1
Download asset Open asset
Cobl-like associates with syndapins.

(A,B) Anti-GFP immunoblotting analyses of supernatants of coprecipitation analyses of GFP-tagged Cobl-like and deletion mutants thereof with immobilized syndapin I SH3 domain (GST-SdpISH3) and GST (control) (A) and of related coprecipitation studies with the SH3 domains of syndapin I, syndapin II (SdpIISH3), and syndapin III (SdpIIISH3), respectively (B). For eluate analyses, see Figure 2A,B. (C) More complete immunoblotting analyses of the reconstitution of the association of TrxHis-Cobl-like1-411 with purified GST-syndapin I and GST-syndapin I SH3 domain but not with GST shown in Figure 2C containing a characterization of the input and both the anti-TrxHis and anti-GST immunoblotting analyses of the eluates. (D) Immunoblot analyses of a reconstitution of the association of TrxHis-Cobl-like1-411 with recombinant, purified GST-syndapin I and GST-syndapin I SH3 domain but not with a mutated syndapin I SH3 domain (P434L; SdpISH3mut). (E) Anti-GFP immunoblotting of the cell lysates and of the GST controls of the syndapin I coprecipitation assays with Cobl-like deletion mutants shown in Figure 2E. (F,G) Immunoblotting analyses of specific coimmunoprecipitations of GFP-Cobl-like1-741 but not GFP with Flag-tagged syndapin II-s (short splice variant, SdpII-s) and syndapin III (SdpIII). (H,I) Maximum intensity projections (MIPs) showing control experiments accompanying the protein complex reconstitutions between GFP-Cobl-like and GFP-Cobl-like1-741 and mitochondrially targeted syndapin I (Mito-mCherry-SdpI) shown in Figure 2G–I. (H) GFP is not recruited to Mito-mCherry-SdpI-enriched sites. (I) GFP-Cobl-like is not recruited to mitochondria when a Mito-mCherry-SdpI lacking the SH3 domain (Mito-mCherry-SdpI∆SH3) is coexpressed. Boxed areas are shown at higher magnification as insets. Line scans of fluorescence intensities of both channels are along the respective line indicated in the merged insets of H and I. Bars, 10 µm.

Figure 3
Download asset Open asset
Cobl-like functions in dendritic arbor formation rely on syndapin I.

(A–C) Maximum intensity projections (MIPs) of DIV5.5 neurons transfected as indicated. Asterisks, transfected neurons. Bars, 20 µm. (D–G) Quantitative determinations of key dendritic arborization aspects promoted by Cobl-like for their dependence on syndapin I (cotransfection at DIV4; fixation 34 hr thereafter). Data, mean ± SEM. One-way ANOVA+Tukey (D–F) and two-way ANOVA+Bonferroni (G). Also see Figure 3—source data 1 and 2.

Figure 3—source data 1

Raw data and numerical data graphically presented in Figure 3D–F.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig3-data1-v1.xlsx
Figure 3—source data 2

Raw data and numerical data graphically presented in Figure 3G.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig3-data2-v1.xlsx
Figure 4 with 1 supplement
Download asset Open asset
Cobl-like is physically linked to Cobl via syndapin I acting as a bridging component.

(A,B) Coprecipitation analyses unveiling specific and syndapin-dependent formation of complexes composed of immobilized GST-Cobl-like, syndapin I (A) and syndapin III (B), respectively, as well as GFP-Cobl1-713. White lines indicate omitted blot lanes. (C–E) Reconstitution and visualization of Cobl-like/syndapin I/Cobl protein complexes in COS-7 cells. Mito-GFP-Cobl1-713 (C,D) but not Mito-GFP (E) recruited mCherry-Cobl-like1-741 in the presence of Xpress-syndapin I (C) but not in its absence (D). Boxes in C–E areas presented as magnified insets (C,D, fourfold; E, threefold). Arrows, examples of colocalization of all three channels. Boxed areas are shown at higher magnification as insets. (F–H) Line scans of fluorescence intensities of all three channels are along the respective line indicated in the insets of C–E. Bars, 10 µm.

Figure 4—figure supplement 1
Download asset Open asset
Recruitment of syndapin I to mitochondrial surfaces in intact cells by Mito-GFP-Cobl1-713.

Reconstitution and visualization of Cobl/syndapin I protein complexes inside of intact COS-7 cells. Mitochondrially targeted Cobl1-713 (green in merge) recruits Xpress-tagged syndapin I (red in merge; anti-Xpress immunolabeling) to mitochondria (blue in merge; visualized by MitoTracker). Boxes mark the area presented as magnified inset (fourfold enlargement). Colocalization of all three channels appears in whitish colors (white, beige, turquoise, rosé) in the merge. The line scan of fluorescence intensities of all three channels is along the line indicated in the merged inset. Bar, 10 µm.

Figure 5
Download asset Open asset
Cobl-like and syndapin I coincide at nascent dendritic branch sites.

(A) Maximum intensity projections (MIPs) of individual frames of a 3D time-lapse recording of a dendrite segment of a DIV7 rat hippocampal neuron coexpressing GFP-Cobl-like and syndapin I (SdpI)-mRubyRFP. Arrows, GFP-Cobl-like and syndapin I enrichments prior to protrusion initiation from these dendritic sites; *, tips of growing dendritic protrusions; (*), abandoned protrusions. (B) Heat map representations. Bars, 2.5 µm. (C) Quantitation of maximal intensities of fluorescent syndapin I, Cobl-like, Cobl and CaM fusion proteins as well as of mCherry as control at dendritic branch induction sites prior to protrusion formation (time frame: the six 10 s frames prior to protrusion start) in relation to a control ROI at the same dendrite at a position neighboring the branch induction site (shown as % above this control ROI). Data, mean ± SEM. Bar/dot plot overlay of individual data points averaged. (D) Temporal analyses of the maximal fluorescence intensities of syndapin I, Cobl-like, Cobl, and CaM occurring at dendritic branch induction sites prior to protrusion formation. Data, mean (black dot) ± SD (light blue) and ± SEM (dark blue). One-way-ANOVA (C). Also see Figure 5—source data 1.

Figure 5—source data 1

Raw data and numerical data graphically presented in Figure 5C,D.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig5-data1-v1.xlsx
Figure 6
Download asset Open asset
Syndapin I nanoclusters are enriched at sites of dendritic protrusion.

(A,A’,A’’) Transmission electron microscopy (TEM) images of anti-syndapin I immunogold-labeled freeze-fracture replica of developing neurons (DIV7). Red lines highlight membrane topologies protruding from regular cylindrical topology. Arrowheads, abundant and clustered anti-syndapin I immunogold labeling (10 nm) at protrusive sites. Arrows, sparse and rarely clustered anti-syndapin immunogold labeling at regular, cylindrical membrane structures. Bars, 200 nm. (B) Quantitative evaluations of anti-syndapin I labeling densities at protrusive and cylindrical membrane topologies. (C) Quantitative analysis of the relative abundance of differently clustered syndapin I labels (ROIs, 35 nm radius). In total, 335 (protrusive) and 130 (cylindrical) labels were evaluated. (D) Quantitative analysis of the density of anti-syndapin I nanoclusters (≥3 anti-syndapin I immunogold labels/ROI) at regular cylindrical membrane surfaces and at those with protrusive topology. Data (B,D), mean ± SEM. One-way ANOVA (B); two-tailed Student’s t-test (D). Also see Figure 6—source data 1.

Figure 6—source data 1

Raw data and numerical data graphically presented in Figure 6B–D.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig6-data1-v1.xlsx
Figure 7
Download asset Open asset
Ca2+/CaM associates with the N terminus of Cobl-like and positively regulates Cobl-like’s syndapin I association.

(A) Scheme of Cobl-like and deletion mutants used for CaM-binding studies (B) (red, no Ca2+-dependent binding; green, Ca2+-dependent binding). (B) Coprecipitations with immobilized CaM in presence (500 µM) and absence of Ca2+ and different Cobl-like deletion mutants. Green arrowheads, increased CaM interactions in the presence of Ca2+. White lines, lanes omitted from blots. (C) Coprecipitation analyses with immobilized CaM and purified TrxHis-Cobl-like1-411 and GST-syndapin I (GST-SdpI) showing direct and simultaneous interactions of Cobl-like1-411 with both CaM and syndapin I. (D,E) Quantitative coimmunoprecipitation analyses demonstrating that Ca2+/CaM signaling leads to increased syndapin I coimmunoprecipitation with Cobl-like1-741. Blue arrowhead, position of the only faintly detected GFP-Cobl-like1-741 in the lysates (D). Green arrowhead, increase of coimmunoprecipitated syndapin I (D). (E) Anti-syndapin I signal per immunoprecipitated Cobl-like (expressed as change from conditions without Ca2+). Data, bar/dot plot overlays with mean ± SEM. Unpaired Student’s t-test. Also see Figure 7—source data 1.

Figure 7—source data 1

Raw data and numerical data graphically presented in Figure 7E.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig7-data1-v1.xlsx
Figure 8
Download asset Open asset
The N terminal CaM-binding site of Cobl-like is indispensable for all critical functions of Cobl-like in dendritic arbor formation.

(A) Coprecipitation analyses of Cobl-like1-741, Cobl-like1-741∆CaM NT (∆11–45), and GFP with immobilized CaM in Ca2+ presence and absence. Arrowhead, increased CaM interaction of Cobl-like1-741 upon Ca2+ (disrupted in Cobl-like1-741∆CaM NT). (B,C) Functional analyses in primary hippocampal neurons (transfection at DIV4; fixation 37 hr thereafter) unveiling that an RNAi-insensitive (*) Cobl-like mutant lacking the N terminal CaM-binding site (GFP-Cobl-like*∆CaM NT) failed to rescue the Cobl-like loss-of-function phenotypes. Red asterisks, transfected neurons (transfection, DIV4; analyses, DIV5.5). Bars, 10 µm. (D–G) Quantitative evaluations of indicated dendritic parameters. Data, mean ± SEM. One-way ANOVA+Tukey (D–F); two-way ANOVA+Bonferroni (G). Also see Figure 8—source data 1 and 2.

Figure 8—source data 1

Raw data and numerical data graphically presented in Figure 8D–F.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig8-data1-v1.xlsx
Figure 8—source data 2

Raw data and numerical data graphically presented in Figure 8G.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig8-data2-v1.xlsx
Figure 9 with 1 supplement
Download asset Open asset
Ca2+/CaM signaling exclusively promotes the syndapin I association with the first of the three ‘KRAP’ motifs and this single Ca2+/CaM-regulated motif is crucial for Cobl-like’s functions.

(A) Coprecipitations with immobilized syndapin I SH3 domain (SdpISH3) and Cobl-like and ∆KRAP mutants thereof. (B,C) Quantitative coimmunoprecipitation analyses with GFP-Cobl-like1-457 (B) in comparison to a corresponding mutant solely lacking the first ‘KRAP’ motif (GFP-Cobl-like1-457∆KRAP1) in the presence and absence of Ca2+, respectively (C). Arrowhead, increase of coimmunoprecipitated Flag-syndapin I with GFP-Cobl-like1-457 upon Ca2+. (D) Quantitation of anti-syndapin I coimmunoprecipitation upon Ca2+ presence normalized to immunoprecipitated GFP-Cobl-like1-457 and GFP-Cobl-like1-457∆KRAP1, respectively (as deviation from conditions without Ca2+). (E,F) Side-by-side comparison of syndapin I coimmunoprecipitations with GFP-Cobl-like1-457 and GFP-Cobl-like1-457∆KRAP1 (E) and quantitative analysis thereof (F). White line, lanes omitted from blot. (G,H) Images of Apotome sections showing the cortical localization of GFP-Cobl-like expressed in Cobl-like-deficient background (Cobl-like RNAi/GFP-Cobl-like*) in primary hippocampal neurons transfected at DIV4 and imaged 37 hr later (G) compared to the subcellular distribution of GFP-Cobl-like*∆KRAP1 in the same background (H). Lines indicate positions of line scans shown. Bars, 10 µm. (I) Quantitative assessment of cortical GFP intensities (marked with arrowheads in the line scans) normalized to the GFP intensity of an internal ROI in the same cell. (J–K) Functional analyses of the importance of Cobl-like’s CaM-regulated syndapin I binding site (KRAP1) by loss-of-function rescue experiments evaluating the indicated dendritic arbor parameters of developing neurons (transfection, DIV4; analysis, DIV5.5). Note that neither a Cobl-like mutant lacking the entire N terminal part (GFP-Cobl-like*∆1-412) nor GFP-Cobl-like*∆KRAP1 was able to rescue Cobl-like’s loss-of-function phenotypes. Data, bar/dot plot overlays with mean ± SEM (D,I) and mean ± absolute error (F) as well as bar plots with mean ± SEM (J–L). Unpaired Student’s t-test (D,F,I); one-way ANOVA+Tukey (J–L). Also see Figure 9—source data 1–4.

Figure 9—source data 1

Raw data and numerical data graphically presented in Figure 9D.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig9-data1-v1.xlsx
Figure 9—source data 2

Raw data and numerical data graphically presented in Figure 9F.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig9-data2-v1.xlsx
Figure 9—source data 3

Raw data and numerical data graphically presented in Figure 9I.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig9-data3-v1.xlsx
Figure 9—source data 4

Raw data and numerical data graphically presented in Figure 9J–L.

https://cdn.elifesciences.org/articles/67718/elife-67718-fig9-data4-v1.xlsx
Figure 9—figure supplement 1
Download asset Open asset
The three ‘KRAP’ motifs are critical for Cobl-like’s association with syndapin I.

(A) Anti-GFP immunoblotting of control experiments of the coprecipitation analyses shown in Figure 10A demonstrating that neither Cobl-like nor any of the Cobl-like mutants associated with GST. (B–D) Maximum intensity projections (MIPs) of COS-7 cells transfected with Mito-mCherry-syndapin I and GFP-Cobl-like∆KRAP (B), Mito-mCherry-syndapin I and GFP-Cobl-like1-741 (C), and a GFP-Cobl-like mutant lacking the regions with the three ‘KRAP’ motifs (GFP-Cobl-like1-741∆KRAP) (D), respectively. Note the successful recruitment of GFP-Cobl-like1-741 to syndapin I-decorated mitochondria (C; colocalization of all three channels shown appears white in merge; examples are marked by arrowheads), whereas GFP-Cobl-like∆KRAP and GFP-Cobl-like1-741∆KRAP were not recruited to mitochondria (colocalization of only Mito-mCherry-syndapin I [red in merge] and MitoTracker [blue in merge] appears purple in merge; B,D). Boxed areas are shown at higher magnification as insets. Line scans of fluorescence intensities of all three channels are shown along the respective line indicated in the merged insets of B–D. Bars, 10 µm.

Figure 10
Download asset Open asset
Model depicting how Cobl and Cobl-like functions in dendritic branch initiation are joined, coordinated, and controlled.

Cobl and Cobl-like functions are not only both critical for dendritic branch formation but both factors promoting the formation of actin filaments were found to act in an interdependent manner. The underlying mechanisms of coordination and control are depicted and include physical linkage of Cobl and Cobl-like by syndapin I forming dimers and multimeric clusters at the convexly bent membrane areas at the base of nascent branch sites. The newly identified interaction of syndapin I with Cobl-like is mediated by three independent KRAP motifs (red), the most N terminal of which (marked by white asterisk) is regulated by a newly discovered CaM association to Cobl-like’s N terminus. All mechanistic aspects unveiled in this study are depicted in detail and the corresponding functional evaluations conducted are listed in brief. The WH2 domains of Cobl and Cobl-like are shown to indicate the C terminal domains of both proteins and their cytoskeletal functions.

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene
(Mus musculus)		Cobl-like
(Cobll1)		Izadi et al., 2018AK144943.1,
GI: 74201418
Gene
(Mus musculus)		Cordon-Bleu
(Cobl)		Ahuja et al., 2007NM_172496.3,
GI: 162135965		The common abbreviation of Cordon-Bleu is Cobl
Gene
(Rattus norvegicus)		Syndapin I
(Pacsin1)		Braun et al., 2005AF104402.1,
GI: 4324451		Syndapin is used as gene name in most model organisms, such as rat, worms, flies
Gene
(Rattus norvegicus)		Calmodulin
(Calm1)		SenGupta et al., 1987M19312.1,
GI: 203255		The common abbreviation of calmodulin is CaM
Strain, background
(Escherichia coli)		E. coli commercial strain BL21-CodonPlus(DE3)-RIPLAgilentCat#230280
Strain, background
(Escherichia coli)		E. coli commercial strain XL10-GoldAgilentCat#200314
Cell line (African green monkey)COS-7Cell Lines Services GmbHRRID:CVCL_0224
Cell line (human)HEK293Cell Lines Services GmbHRRID:CVCL_0045
Biological sample
(Rattus norvegicus)		Primary hippocampal neurons (Wistar rat; Crl:WI; mixed sex)Charles RiverRRID:RGD_68115Primary neurons isolated from E18 rat embryos (sex undetermined)
Biological sample
(Mus musculus)		Isolated brains (Mouse strain C57BL/6J, female)Jackson LabsRRID:IMSR_JAX:000664Brain material processed for protein biochemical examinations
AntibodyAnti-Cobl-like
(Rabbit polyclonal)		Izadi et al., 2018N/AWB (1:1000)
AntibodyAnti-syndapin I
(Guinea pig polyclonal)		Braun et al., 2005N/AWB (1:500)
EM (1:50)
AntibodyAnti-syndapin III
(Guinea pig polyclonal)		Koch et al., 2011N/AWB (1:500)
AntibodyAnti-TrxHis
(Rabbit polyclonal)		This paperN/AWB (1:1000)
AntibodyAnti-GST
(Rabbit polyclonal)		Qualmann and Kelly, 2000N/AWB (1:1000)
AntibodyAnti-TrxHis
(Guinea pig polyclonal)		Schwintzer et al., 2011N/AWB (1:2000)
AntibodyAnti-GST
(Guinea pig polyclonal)		Braun et al., 2005N/AWB (1:1000)
AntibodyAnti-GFP (ab290)
(Rabbit polyclonal)		AbcamCat#ab290
RRID:AB_303395		WB (1:2000)
AntibodyAnti-GFP (JL-8)
(Mouse monoclonal)		ClontechCat#632380 RRID:AB_10013427WB (1:4000)
AntibodyAnti-Flag antibody (M2)
(Mouse monoclonal)		Sigma-AldrichCat#F3165
RRID:AB_259529		WB (1:500)
AntibodyAnti-MAP2 (HM-2)
(Mouse monoclonal)		Sigma-AldrichCat#M4403
RRID:AB_477193		IF (1:500)
AntibodyAnti-Flag antibody
(Rabbit polyclonal)		Sigma-AldrichCat#F7425
RRID:AB_439687		WB (1:1000)
AntibodyAnti-Xpress antibody
(Mouse monoclonal)		InvitrogenCat#R910-25;
RRID:AB_2556552		IF (1:500)
AntibodyAlexa Fluor488-labeled goat anti-guinea pig
(Goat polyclonal)		Molecular ProbesCat#A-11073 RRID:AB_142018IF (1:1000)
AntibodyAlexa Fluor568-labeled goat anti-guinea pig
(Goat polyclonal)		Molecular ProbesCat#A-11075 RRID:AB_141954IF (1:1000)
AntibodyAlexa Fluor488-labeled donkey anti-mouse
(Donkey polyclonal)		Molecular ProbesCat#A-21202 RRID:AB_141607IF (1:1000)
AntibodyAlexa Fluor568-labeled donkey anti-mouse
(Donkey polyclonal)		Molecular ProbesCat#A10037 RRID:AB_2534013IF (1:1000)
AntibodyAlexa Fluor647-labeled goat anti-mouse
(Goat polyclonal)		Molecular ProbesCat#A-21236 RRID:AB_141725IF (1:1000)
AntibodyAlexa Fluor488-labeled donkey anti-rabbit
(Donkey polyclonal)		Molecular ProbesCat#A-21206 RRID:AB_141708IF (1:1000)
AntibodyAlexa Fluor568-labeled goat anti-rabbit
(Goat polyclonal)		Molecular ProbesCat#A-11036 RRID:AB_143011IF (1:1000)
AntibodyAlexa Fluor647-labeled goat anti-rabbit
(Goat polyclonal)		Molecular ProbesCat#A-21245 RRID:AB_141775IF (1:1000)
AntibodyAlexa Fluor680-labeled goat-anti-rabbit
(Goat polyclonal)		Molecular ProbesCat#A-21109 RRID:AB_2535758WB (1:10000)
AntibodyAlexa Fluor680-labeled goat-anti-mouse
(Goat polyclonal)		Molecular ProbesCat#35519 RRID:AB_1965956WB (1:10000)
AntibodyDyLight800-conjugated goat anti-rabbit
(Goat polyclonal)		Thermo Fisher ScientificCat#SA5-35571 RRID:AB_2556775WB (1:10000)
AntibodyDyLight800-conjugated goat anti-mouse
(Goat polyclonal)		Thermo Fisher ScientificCat#SA5-35521 RRID:AB_2556774WB (1:10000)
AntibodyIRDye680-conjugated donkey anti-guinea pig
(Donkey polyclonal)		LI-COR BioscienceCat#926–68077 RRID:AB_10956079WB (1:10000)
AntibodyIRDye800-conjugated donkey anti-guinea pig
(Donkey polyclonal)		LI-COR BioscienceCat#926–32411 RRID:AB_1850024WB (1:10000)
AntibodyPeroxidase-AffiniPure donkey anti-rabbit antibody
(Donkey polyclonal)		Jackson ImmunoResearch LabsCat#711-035-152
RRID:AB_10015282		WB (1:5000)
AntibodyPeroxidase-AffiniPure goat anti-guinea pig antibody
(Goat polyclonal)		Jackson ImmunoResearch LabsCat#106-036-003
RRID:AB_2337405		WB (1:5000)
AntibodyPeroxidase-goat F(ab')2 anti-mouse
(Goat polyclonal)		DianovaCat#115-036-003
RRID:AB_2617176		WB (1:5000)
AntibodyGoat anti-guinea pig IgG 10 nm gold
(Goat polyclonal)		BBI SolutionsCat#EM.GAG10
RRID:AB_2892072		EM (1:50)
Recombinant DNA reagentFlag-mCherry Cobl (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like (Plasmid)Izadi et al., 2018N/A
Recombinant DNA reagentScr. RNAi in pRNAT-H1.1 (Plasmid)Pinyol et al., 2007N/A
Recombinant DNA reagentScr. RNAi in pRNAT-mCherryF (Plasmid)Schneider et al., 2014N/A
Recombinant DNA reagentCobl-RNAi in pRNAT-mCherryF (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentCobl-like RNAi (#1) in pRNAT-H1.1 (Plasmid)Izadi et al., 2018N/A
Recombinant DNA reagentCobl-like RNAi (#1) in pRNAT-mCherryF (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl (Plasmid)Hou et al., 2015N/A
Recombinant DNA reagentGFP-Cobl1-713 (Plasmid)Hou et al., 2015N/A
Recombinant DNA reagentMito-GFP-Cobl1-713 (Plasmid)This paperN/A
Recombinant DNA reagentGFP-Cobl-like1-741 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like740-1273 (Plasmid)Izadi et al., 2018N/A
Recombinant DNA reagentGFP-Cobl-like1-538 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-411 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-380 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like376-540 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like261-380 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like111-262 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-111 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like537-740 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like182-272 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-58 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentCobl-like RNAi/GFP-Cobl-like* in pRNAT H1.1 (Plasmid)Izadi et al., 2018N/A
Recombinant DNA reagentCobl-like RNAi/GFP-Cobl-like*∆CaM NT in pRNAT H1.1 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentmCherry-Cobl-like1-711This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-741∆CaM NT (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like∆KRAP (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-741∆KRAP (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-457∆KRAP1 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-Cobl-like1-457 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentCobl-like RNAi/GFP-Cobl-like*∆KRAP1 in pRNAT H1.1 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentCobl-like RNAi/GFP-Cobl-like*∆1-412 in pRNAT H1.1 (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentFlag-syndapin I (SdpI) (Plasmid)Qualmann and Kelly, 2000N/A
Recombinant DNA reagentFlag-syndapin II-s (SdpII) (Plasmid)Dharmalingam et al., 2009N/A
Recombinant DNA reagentFlag-syndapin III (SdpIII) (Plasmid)Braun et al., 2005N/A
Recombinant DNA reagentXpress-syndapin I (SdpI) (Plasmid)Qualmann et al., 1999N/A
Recombinant DNA reagentSyndapin I–mRubyRFP (Plasmid)This paperN/ASee Materials and methods
Recombinant DNA reagentGFP-syndapin I (Plasmid)Kessels and Qualmann, 2006N/A
Recombinant DNA reagentMito-mCherry-SdpI (Plasmid)Kessels and Qualmann, 2002N/A
Recombinant DNA reagentMito-mCherry-SdpI∆SH3 (Plasmid)Braun et al., 2005N/A
Recombinant DNA reagentMito-mCherry (Plasmid)Dharmalingam et al., 2009N/A
Recombinant DNA reagentSdpI-RNAi in pRNAT-mCherryF (Plasmid)Dharmalingam et al., 2009
Schneider et al., 2014		N/A
Recombinant DNA reagentGFP-CaM (Plasmid)This paperN/ASee Materials and methods
Sequence-based reagentCobl-like aa1 fwThis paperPCR primer5’-AATTAGATCTATGGACCGCAGCGTCCCCGATCC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa261 fwThis paperPCR primer5’-AAAGATCTGATATCAGCAGAGAG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa537 fwThis paperPCR primer5’-AAAGATCTAAGGATCCTGATTCAGC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa740 fwThis paperPCR primer5’-GCCTCAAGAGAATTCAGG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa376 fwThis paperPCR primerfw: 5’-TTGAATTCTTAAACCATGATCGCTTC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa182 fwThis paperPCR primer5’- TTAGATCTCCTACACCTATAATC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa457 rvThis paperPCR primer5’- AACTCGAGCCCGGGACCAAGGGAGC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa741 rvThis paperPCR primer5’-TCCTGAATTCTCTTGAGG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa540 rvThis paperPCR primer5’-TTCTCGAGTTAATCAGGATCCTTCTC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa411 rvThis paperPCR primer5’-GCAAGCTTGGTTTTCGAAGGTGG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa272 rvThis paperPCR primer5’-AAGAATTCTCAGTTGTGTGATATTTG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa380 rvThis paperPCR primer5’-TTGAATTCGAAGCGATCATGGTG-3’
(see Materials and methods)
Sequence-based reagentCobl-like∆CaM NT aa1-10+46–51 fwThis paperPCR primer5’-AAAGATCTATGGACCGCAGCGT
CCCGGATCCCGTACCCAAGAATCAC
AAATTCCTG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa413 fwThis paperPCR primer5’-TTAAGCTTCTGGCTCAGAC
TGATG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa58 rvThis paperPCR primer5’-TTAAGCTTGCTCTGACAAATATG-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa70 fwThis paperPCR primer5’-TTAAGCTTGCCGAGACGAAGGGC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa333 rvThis paperPCR primer5’-TTAAGCTTTGCATCCGAGGGC-3’
(see Materials and methods)
Sequence-based reagentCobl-like aa411 rv Sal IThis paperPCR primer5’-GGGTCGACGGTTTTCGAAGGTGG-3’
(see Materials and methods)
Recombinant proteinTrxHisHou et al., 2015N/A
Recombinant proteinTrxHis-Cobl-like1-411This paperN/A
Recombinant proteinGST-Cobl-like1-411This paperN/A
Recombinant proteinGST-SdpISH3Qualmann et al., 1999N/A
Recombinant proteinGST-SdpIISH3Qualmann and Kelly, 2000N/A
Recombinant proteinGST-SdpIIISH3Seemann et al., 2017N/A
Recombinant proteinGST-SdpIQualmann et al., 1999N/A
Recombinant proteinGST-SdpISH3mutQualmann and Kelly, 2000N/A
Commercial assay or kitNucleoSpin PlasmidMacherey-NagelCat#740588.50
Commercial assay or kitNucleoBond Xtra MidiMacherey-NagelCat#740410.50
Commercial assay or kitLipofectamine 2000 transfection reagentInvitrogenCat#11668019
Commercial assay or kitTurbofect transfection reagentsThermo Fisher ScientificCat#R0532
Commercial assay or kitCalmodulin Sepharose 4BGE HealthcareCat#GE17-0529-01
Commercial assay or kitPreScission proteaseGE HealthcareCat#27-0843-01
Chemical compound, drugMitoTracker Deep Red Alexa Fluor633Molecular ProbesCat#M22426
Software, algorithmZEN2012ZeissRRID:SCR_013672
Software, algorithmPrism5, Prism6GraphPad PrismRRID:SCR_002798
Software, algorithmImageJOtherRRID:SCR_003070Open source software
Software, algorithmIMARIS 7.6BitplaneRRID:SCR_007370
Software, algorithmAdobe PhotoshopAdobeRRID:SCR_014199

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/67718/elife-67718-transrepform-v1.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Maryam Izadi
  2. Eric Seemann
  3. Dirk Schlobinski
  4. Lukas Schwintzer
  5. Britta Qualmann
  6. Michael M Kessels
(2021)
Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development
eLife 10:e67718.
https://doi.org/10.7554/eLife.67718