(A) Spontaneous voltage traces at RMP following the application of solutions with different divalent concentrations (T1.1 (upper traces), T0.2 (middle), and T1.1 recovery (lower)) recorded in three …
Action potential frequency and resting membrane potential in conventional WT, NesCre and Casr-/- neurons in T1.1 or T0.2 with no current injection.
RMP units are mV and each sub-column represents measurements from a single neuron.
Casr expression levels shown as delta delta with actin used as normalizing gene. Average values of 1.0, 0.02, and 0.65 for NesCre, Casr-/-, and conWT respectively with each genotype reflecting the …
(A) The neurons were held at RMP in T1.1 (zero basal current injection) or at the same potential in T0.2 (hyperpolarizing current injection as described in Figure 1H). The current injection is shown …
(A) Exemplary traces showing the divalent-dependent increase in neuronal excitability following the switch from T1.1 to T0.2 (change indicated by upper trace) in NesCre (blue) and Casr-/- (red) …
Action potential frequency in NesCre and Casr-/- neurons in T1.1 or T0.2 with standing currents Ia and Ib.
The action potential frequency is in log base 10 and each sub-column represents measurements from a single neuron.
(A) Exemplary traces showing VGSC currents activated by voltage steps from −80 in 10 mV increments (left), in nucleated patches isolated from NesCre (blue) and Casr-/- (red) neurons in solutions T1.1…
(A) Exemplary traces showing VGPC currents activated by voltage steps from −80 in 10 mV increments (left), in a NesCre neuron in solutions T1.1 and T0.2. The outward currents elicited by the 50 ms …
(A,B) Plots illustrating the responses of the basal currents in two WT neurons during application of T1.1 and T0.2 before and during TTX or TTX and Gd3+. Average basal currents were measured over 50 …
(A) Plot of average basal current measurements (filled circles) and individual neurons (open circles) in each solution condition in Casr-/- (n = 9) neurons. Each basal current represents the average …
(A) The response of the membrane potential in two WT neurons during application of T1.1 and T0.2 before and during TTX or TTX and Gd3+. T1.1 and T0.2 application is indicated by vertical shading …
Depolarization elicited by switch from T1.1 to T0.2 that was sensitive to TTX, Gd3+, or resistant to both blockers in conventional WT and Casr-/- neurons.
Depolarization units are volts and each sub-column represents measurements from a single neuron.
ANOVA table | SS | DF | MS | F (DFn, DFd) | P value |
---|---|---|---|---|---|
Interaction | 130.0 | 2 | 64.99 | F (2, 54)=3.193 | p=0.0489 |
[Ca2+]o on AP count | 594.4 | 1 | 594.4 | F (1, 54)=29.21 | p<0.0001 |
Genotype | 136.1 | 2 | 68.04 | F (2, 54)=3.368 | p=0.0418 |
Subjects (matching) | 1091 | 54 | 20.20 | F (54, 54)=0.9925 | p=0.5110 |
Residual | 1099 | 54 | 20.35 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | P value |
---|---|---|---|---|---|
Interaction | 14.36 | 1 | 14.36 | F (1, 37)=1.035 | p=0.3155 |
[Ca2+]o on RMP | 438.9 | 1 | 438.9 | F (1, 37)=31.65 | p<0.0001 |
Genotype | 1513 | 1 | 1513 | F (1, 37)=19.10 | p<0.0001 |
Subjects (matching) | 2930 | 37 | 79.19 | F (37, 37)=5.710 | p<0.0001 |
Residual | 513.2 | 37 | 13.87 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 0.3407 | 1 | 0.3407 | F (1, 35)=0.4758 | p=0.4949 |
[Ca2+]o at hyperpolarizing injection | 8.262 | 1 | 8.262 | F (1, 35)=11.54 | p=0.0017 |
Genotype | 0.5380 | 1 | 0.5380 | F (1, 35)=0.7309 | p=0.3984 |
Subjects (matching) | 25.76 | 35 | 0.7360 | F (35, 35)=1.028 | p=0.4679 |
Residual | 25.06 | 35 | 0.7161 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 0.6090 | 1 | 0.6090 | F (1, 35)=0.2048 | p=0.6536 |
[Ca2+]o at depolarizing injection | 45.09 | 1 | 45.09 | F (1, 35)=15.17 | p=0.0004 |
Genotype | 5.982 | 1 | 5.982 | F (1, 35)=0.9959 | p=0.3252 |
Subjects (matching) | 210.2 | 35 | 6.006 | F (35, 35)=2.020 | p=0.0204 |
Residual | 104.1 | 35 | 2.973 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 0.5225 | 1 | 0.5225 | F (1, 27)=0.07478 | p=0.7866 |
[Ca2+]o on AP threshold | 394.6 | 1 | 394.6 | F (1, 27)=56.48 | p<0.0001 |
Genotype | 54.34 | 1 | 54.34 | F (1, 27)=2.284 | p=0.1424 |
Subjects (matching) | 642.5 | 27 | 23.80 | F (27, 27)=3.406 | p=0.0011 |
Residual | 188.6 | 27 | 6.987 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 0.4305 | 3 | 0.1435 | F (3, 87)=0.3481 | p=0.7906 |
[Ca2+]o and I | 22.23 | 3 | 7.410 | F (3, 87)=17.97 | p<0.0001 |
Genotype | 0.1341 | 1 | 0.1341 | F (1, 29)=0.2005 | p=0.6577 |
Subjects (matching) | 19.41 | 29 | 0.6692 | F (29, 87)=1.623 | p=0.0445 |
Residual | 35.87 | 87 | 0.4123 |
Sidak's multiple comparisons test | Mean diff. | 95% CI of diff. | Significant? | Summary | Adjusted p value |
---|---|---|---|---|---|
T1.1 Ia vs. T0.2 Ia | −1.059 | −1.498 to −0.6200 | Yes | **** | <0.0001 |
T1.1 Ia vs. T0.2 Ib | −0.6203 | −1.059 to −0.1813 | Yes | ** | 0.0016 |
T1.1 Ia vs. T1.1 Ib | −0.1163 | −0.5554 to 0.3227 | No | ns | 0.9797 |
T0.2 Ia vs. T0.2 Ib | 0.4387 | −0.0003709 to 0.8778 | No | ns | 0.0503 |
T0.2 Ia vs. T1.1 Ib | 0.9427 | 0.5037 to 1.382 | Yes | **** | <0.0001 |
T0.2 Ib vs. T1.1 Ib | 0.5040 | 0.06496 to 0.9431 | Yes | * | 0.0160 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 131.7 | 1 | 131.7 | F (1, 29)=4.055 | p=0.0534 |
[Ca2+]o | 949.2 | 1 | 949.2 | F (1, 29)=29.22 | p<0.0001 |
Genotype | 162.7 | 1 | 162.7 | F (1, 29)=4.874 | p=0.0353 |
Subjects (matching) | 968.0 | 29 | 33.38 | F (29, 29)=1.028 | p=0.4711 |
Residual | 942.0 | 29 | 32.48 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 0.06658 | 1 | 0.06658 | F (1, 25)=0.004070 | p=0.9496 |
[Ca2+]o | 845.1 | 1 | 845.1 | F (1, 25)=51.66 | p<0.0001 |
Genotype | 391.0 | 1 | 391.0 | F (1, 25)=10.52 | p=0.0033 |
Subjects (matching) | 929.5 | 25 | 37.18 | F (25, 25)=2.273 | p=0.0225 |
Residual | 408.9 | 25 | 16.36 | ||
(B) Action potential threshold recorded at −70 mV | |||||
Interaction | 2.008e-07 | 1 | 2.008e-07 | F (1, 28)=2.800 | p=0.1054 |
[Ca2+]o | 1.415e-06 | 1 | 1.415e-06 | F (1, 28)=19.73 | p=0.0001 |
Genotype | 3.050e-07 | 1 | 3.050e-07 | F (1, 28)=0.4545 | p=0.5057 |
Subjects (matching) | 1.879e-05 | 28 | 6.710e-07 | F (28, 28)=9.358 | p<0.0001 |
Residual | 2.008e-06 | 28 | 7.170e-08 | ||
(C) Action potential threshold recorded at −70 mV | |||||
Interaction | 0.0001602 | 1 | 0.0001602 | F (1, 28)=6.758 | p=0.0147 |
[Ca2+]o | 0.0004821 | 1 | 0.0004821 | F (1, 28)=20.34 | p=0.0001 |
Genotype | 0.001193 | 1 | 0.001193 | F (1, 28)=5.891 | p=0.0219 |
Subjects (matching) | 0.005669 | 28 | 0.0002025 | F (28, 28)=8.541 | p<0.0001 |
Residual | 0.0006637 | 28 | 2.370e-005 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 12.00 | 1 | 12.00 | F (1, 18)=0.7743 | p=0.3905 |
[Ca2+]o | 3973 | 1 | 3973 | F (1, 18)=256.2 | p<0.0001 |
Genotype | 27.49 | 1 | 27.49 | F (1, 18)=0.5632 | p=0.4627 |
Subjects (matching) | 878.5 | 18 | 48.81 | F (18, 18)=3.148 | p=0.0097 |
Residual | 279.1 | 18 | 15.50 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 4.814 | 1 | 4.814 | F (1, 17)=0.5668 | p=0.4618 |
[Ca2+]o | 834.5 | 1 | 834.5 | F (1, 17)=98.24 | p<0.0001 |
Genotype | 157.6 | 1 | 157.6 | F (1, 17)=4.813 | p=0.0424 |
Subjects (matching) | 556.7 | 17 | 32.75 | F (17, 17)=3.855 | p=0.0040 |
Residual | 144.4 | 17 | 8.494 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Interaction | 1.226e-018 | 3 | 4.086e-019 | F (3, 57)=0.2271 | p=0.8772 |
[Ca2+]o and time | 7.270e-018 | 3 | 2.423e-018 | F (3, 57)=1.347 | p=0.2683 |
Genotype | 6.054e-017 | 1 | 6.054e-017 | F (1, 19)=1.231 | p=0.2811 |
Subjects (matching) | 9.345e-016 | 19 | 4.919e-017 | F (19, 57)=27.33 | p<0.0001 |
Residual | 1.026e-016 | 57 | 1.800e-018 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Treatment | 6.871e-021 | 2 | 3.435e-021 | F (1.495, 17.94)=13.30 | p=0.0007 |
Individual (between rows) | 5.669e-022 | 12 | 4.725e-023 | F (12, 24)=0.1828 | p=0.9981 |
Residual (random) | 6.201e-021 | 24 | 2.584e-022 | ||
Total | 1.364e-020 | 38 |
Sidak's multiple comparisons test | Mean diff. | 95% CI of diff. | Significant? | Summary | Adjusted p value |
---|---|---|---|---|---|
TTX sens vs. Gd3+ sens | −2.247e-011 | −4.391e-011 to −1.033e-012 | Yes | * | 0.0392 |
TTX sens vs. Rem | −3.158e-011 | −4.899e-011 to −1.418e-011 | Yes | *** | 0.0009 |
Gd3+ sens vs. Rem | −9.111e-012 | −2.146e-011 to 3.240e-012 | No | ns | 0.1789 |
ANOVA table | SS | DF | MS | F (DFn, DFd) | p Value |
---|---|---|---|---|---|
Treatment | 0.0003944 | 2 | 0.0001972 | F (1.219, 13.41)=12.83 | p=0.0022 |
Individual (between rows) | 0.0001037 | 11 | 9.423e-006 | F (11, 22)=0.6132 | p=0.7982 |
Residual (random) | 0.0003381 | 22 | 1.537e-005 | ||
Total | 0.0008361 | 35 |
Sidak's multiple comparisons test | Mean diff. | 95% CI of diff. | Significant? | Summary | Adjusted p value |
---|---|---|---|---|---|
TTX sens vs. Gd3+ sens | 0.006528 | 0.001005 to 0.01205 | Yes | * | 0.0215 |
TTX sens vs. Rem | 0.007428 | 0.002879 to 0.01198 | Yes | ** | 0.0028 |
Gd3+ sens vs. Rem | 0.0009 | −0.001301 to 0.003101 | No | ns | 0.5311 |
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (M. musculus) | Casr | GenBank | Casr | |
Strain, strain background (M. musculus) | Mouse wild-type strain C57BL/6J × 129×1 | The Jackson Laboratory | RRID:MGI:5652742 | |
Genetic reagent, strain background (M. musculus) | Mouse expressing Nestin-cre mutation | The Jackson Laboratory as used in Sun et al., 2018 | Stock No. 003771 | C57/BL6J and 129S4 background strain |
Genetic reagent, strain background (M. musculus) | Mouse with Lox mutation to delete exon 7 of Casr | Laboratory of Dr. Wenhan Chang, UCSF (Chang et al., 2008) | Casrfl/fl | C57/BL6J and 129S4 background strain |
Sequence-based reagent | Casr | Applied Biosystems | Mm00443377_m1 | Quantitative PCR Mouse probe set |
Sequence-based reagent | Actb | Applied Biosystems | Mm04394036_g1 | Quantitative PCR Mouse probe set |
Sequence-based reagent | Nes-Cre1 primer | IDT | GCAAAACAGGCTCTAGCGTTCG | |
Sequence-based reagent | Nes-Cre2 primer | IDT | CTGTTTCACTATCCAGGTTACGG | |
Sequence-based reagent | P3U primer | IDT | TGTGACGGAAAACATACTGC | |
Sequence-based reagent | Lox R primer | IDT | GCGTTTTTAGAGGGAAGCAG |