1. Neuroscience
Download icon

Enhanced excitability of cortical neurons in low-divalent solutions is primarily mediated by altered voltage-dependence of voltage-gated sodium channels

  1. Briana J Martiszus
  2. Timur Tsintsadze
  3. Wenhan Chang
  4. Stephen M Smith  Is a corresponding author
  1. Section of Pulmonary & Critical Care Medicine, VA Portland Health Care System, United States
  2. Department of Medicine, Division of Pulmonary & Critical Care Medicine, Oregon Health & Science University, United States
  3. Endocrine Research Unit, Veterans Affairs Medical Center and University of California, San Francisco, United States
Research Article
  • Cited 0
  • Views 764
  • Annotations
Cite this article as: eLife 2021;10:e67914 doi: 10.7554/eLife.67914

Abstract

Increasing extracellular [Ca2+] ([Ca2+]o) strongly decreases intrinsic excitability in neurons but the mechanism is unclear. By one hypothesis, [Ca2+]o screens surface charge, reducing voltage-gated sodium channel (VGSC) activation and by another [Ca2+]o activates Calcium-sensing receptor (CaSR) closing the sodium-leak channel (NALCN). Here we report that neocortical neurons from CaSR-deficient (Casr-/-) mice had more negative resting potentials and did not fire spontaneously in reduced divalent-containing solution (T0.2) in contrast with wild-type (WT). However, after setting membrane potential to −70 mV, T0.2 application similarly depolarized and increased action potential firing in Casr-/- and WT neurons. Enhanced activation of VGSCs was the dominant contributor to the depolarization and increase in excitability by T0.2 and occurred due to hyperpolarizing shifts in VGSC window currents. CaSR deletion depolarized VGSC window currents but did not affect NALCN activation. Regulation of VGSC gating by external divalents is the key mechanism mediating divalent-dependent changes in neocortical neuron excitability.

Introduction

Excitable tissues are strongly regulated by extracellular [Ca2+] ([Ca2+]o) (Neher and Sakaba, 2008; Ma et al., 2014; Jackman and Regehr, 2017). Movement of extracellular Ca2+, through voltage-activated Ca2+ channels (VACC), to the intracellular space is central to many of these processes (Ma et al., 2012a; Nanou and Catterall, 2018). However, a distinct, extracellular mechanism that is independent of synaptic transmission also contributes to [Ca2+]o-dependent regulation of nerve and muscle function (Adrian and Gelfan, 1933; Weidmann, 1955; Frankenhaeuser, 1957; Frankenhaeuser and Hodgkin, 1957). Decreases in [Ca2+]o and [Mg2+]o substantially facilitate spontaneous and evoked action potential generation which represents increased intrinsic excitability (Weidmann, 1955; Frankenhaeuser, 1957; Frankenhaeuser and Hodgkin, 1957). In the brain, physiological neuronal activity decreases [Ca2+]o (Nicholson et al., 1978) leading to further increases in action potential firing in neighboring neurons (Anderson et al., 2013). The firing patterns and computational properties of local circuits are impacted substantially by this positive feedback leading to changes in brain behaviors (Titley et al., 2019). Furthermore, under pathological conditions, larger decreases in [Ca2+]o occur, resulting in even greater changes in circuit activity, and implicating [Ca2+]o-dependent excitability in the pathogenesis of brain injury (Ayata and Lauritzen, 2015).

Classical studies proposed that the mechanism underlying [Ca2+]o-dependent excitability centers on voltage-gated sodium channel (VGSC) sensitivity to extracellular Ca2+. Reduced [Ca2+]o was proposed to shift the effective voltage-dependent gating of the sodium conductance in the hyperpolarizing direction by reducing the screening of local negative charges on the extracellular face of the membrane or channel by external Ca2+ (Frankenhaeuser and Hodgkin, 1957; Hille, 1968). This surface potential screening model accounted for [Ca2+]o-dependent excitability in nerves and muscle without a need for additional molecular players and was widely accepted (Hille, 2001), although direct binding of Ca2+ to the VGSC was also proposed as contributing (Armstrong and Cota, 1991). However, this theory was challenged by new data demonstrating that activation of the sodium leak channel (NALCN), a non-selective cation channel, by the intracellular proteins, UNC79 and UNC80 (Lu et al., 2009; Lu et al., 2010) was necessary for [Ca2+]o-dependent excitability to occur in hippocampal neurons. Following the deletion of NALCN or UNC79, [Ca2+]o-dependent excitability was completely lost suggesting the increased excitability resulted from the activation of the non-rectifying NALCN which depolarized neurons and increased the likelihood of action potential generation independent of changes in VGSC function (Lu et al., 2010). The calcium-sensing receptor (CaSR), a G-protein-coupled receptor (GPCR), was hypothesized to detect and transduce the [Ca2+]o changes and signal to the downstream multistep pathway (Lu et al., 2010). CaSR is well-positioned as a candidate [Ca2+]o detector because at nerve terminals it detects [Ca2+]o and regulates a non-selective cation channel (Smith et al., 2004; Chen et al., 2010) and because it transduces changes in [Ca2+]o into NALCN activity following heterologous co-expression of CaSR, NALCN, UNC79, and UNC80 (Lu et al., 2010). Interest in the UNC79-UNC80-NALCN pathway has also risen, due to its essential role in the maintenance of respiration (Lu et al., 2007), the regulation of circadian rhythms (Lear et al., 2013; Flourakis et al., 2015), and because mutations of UNC80 and NALCN cause neurodevelopmental disorders, characterized by development delay and hypotonia (Al-Sayed et al., 2013; Perez et al., 2016).

Here, we address the question of whether the G-protein mediated NALCN pathway or VGSCs transduce the [Ca2+]o-dependent effects on excitability. We test if CaSR is a modulator of neuronal excitability via its action on a nonselective cation channel, determine the impact of CaSR expression on factors of intrinsic neuronal excitability, and examine the relative contributions of [Ca2+]o-regulated changes on VGSC and NALCN gating. In recordings from neocortical neurons, isolated by pharmacological block of excitatory and inhibitory inputs, we determine that neuronal firing is increased by decreasing external divalent concentrations and that this is almost entirely attributable to [Ca2+]o-dependent shifts in VGSC gating. Surprisingly, CaSR deletion substantially shifted VGSC gating, but had no effect on NALCN sensitivity to [Ca2+]o. Taken together our experiments indicate that acute [Ca2+]o-dependent increases in neuronal excitability result from changes in VGSC and NALCN gating and that CaSR contributes by an, as yet, uncharacterized action on VGSCs.

Results

CaSR and divalent-dependent neuronal excitability

Increased excitability following the reduction of [Ca2+]o ([Ca2+]o-dependent excitability) was eliminated by deletion of UNC79 or NALCN in neurons, challenging the long-standing hypothesis that local or diffuse surface charge screening of VGSCs mediated these effects (Lu et al., 2010). But how were changes in external divalent ion concentrations transduced to UNC79 and NALCN? We tested if CaSR provided the link, by comparing excitability in wild-type (WT) and nestin Cre-recombinase expressing CaSR null-mutant (NesCreCasrfl/fl abbreviated as Casr-/-) neurons that were genotyped by PCR (see Materials and methods; Chang et al., 2008). Quantification by RT-qPCR indicated >98% reduction in the Casr expression levels in neocortical cultures produced from Casr-/- mice compared to Cre-positive WT (NesCre; Figure 1—figure supplement 1). Current clamp recordings were performed to measure the intrinsic, spontaneous action potential firing rate from cultured, neocortical neurons. The cells were also pharmacologically isolated to prevent the confounding influence on action potential firing of changes in synaptic transmission following alterations of [Ca2+]o and [Mg2+]o (glutamatergic and GABAergic activity blocked by 10 µM CNQX, 50 µM APV, and 10 µM Gabazine). After establishing the whole-cell configuration, we measured the spontaneous action potential firing rates of conventional WT (conWT), NesCre, and Casr-/- neurons in physiological Tyrode solution (T1.1; containing 1.1 mM) at the resting membrane potential (RMP) and then in reduced Ca2+- and Mg2+-containing Tyrode (T0.2; containing 0.2 mM [Ca2+] and [Mg2+]). CaSR and sodium conductance gating are both sensitive to Ca2+ and Mg2+, with Ca2+ being two to three times more potent in both processes (Frankenhaeuser and Hodgkin, 1957; Brown et al., 1993). Consequently, we modified the concentrations of both divalents to utilize a greater fraction of the dynamic range of the phenomenon under study. The reduction in [Ca2+]o and [Mg2+]o caused an increase in spontaneous action potential firing in both types of WT (conventional and NesCre) neurons within 15 s of the solution change that was substantially attenuated in the Casr-/- neuron (Figure 1A, middle row). This divalent-dependent neuronal excitability was reversed within 10 s by changing the bath solution back to physiological external divalent concentrations (Figure 1A, lower row). The pooled data from repeat experiments indicated that on average the conWT and NesCre neurons were equally sensitive to decreased extracellular divalent concentration and had similarly low spontaneous basal levels of activity (<0.1 Hz, Figure 1B–D). Two-way repeated measures (RM) ANOVA confirmed a significant interaction indicating the response to changes of external divalent concentration were dependent on genotype (F (2,54)=3.193, p=0.049, Table 1). Post-hoc tests confirmed that the reduction in [Ca2+]o and [Mg2+]o substantially increased action potential frequency in conWT and NesCre but not Casr-/- neurons (Sidak compensated for multiple comparisons here and in all later tests, Figure 1B, p=0.0009,<0.0001, and = 0.6697, respectively). Having confirmed that the conWT and NesCre neurons responded quantitatively the same to decreases in external divalents we used NesCre neurons alone as controls in subsequent experiments examining CaSR function. These data indicate that CaSR deletion substantially attenuates the increase in spontaneous firing at the RMP produced by reductions in external divalent concentrations in neurons.

Figure 1 with 2 supplements see all
CaSR deletion reduces divalent-dependent excitability.

(A) Spontaneous voltage traces at RMP following the application of solutions with different divalent concentrations (T1.1 (upper traces), T0.2 (middle), and T1.1 recovery (lower)) recorded in three individual neurons with or without CaSR (conWT (black), NesCre (blue) and Casr-/- (red)). Each trace depicts 150 s of continuous acquisition. (B) Histograms of average action potential (AP) frequency (Hz) recorded using the same solutions: T1.1, T0.2, and T1.1 recovery. Individual recordings represented by open circles linked with lines and average is represented with a bar. From left to right graphs depict conWT (n = 18), NesCre (n = 21), and Casr-/- (n = 18). ANOVA: Post-hoc tests (Sidak compensated for multiple comparisons here and in all later figures) showed that action potential frequency increased in conWT (p=0.0009) and NesCre (P, 0.0001), but not Casr-/- (p=0.6697) neurons when changing from T1.1 to T0.2 (Figure 1—source data 1). (C) Baseline average action potential frequency in T1.1. was unaffected by genotype (p>0.999). (D) Average action potential frequency with T0.2 application was the same in conWT and NesCre (p=0.9831) and higher than in Casr-/- neurons (p=0.013 and 0.0033, respectively). (E) Plot of effect of external divalent concentration and CaSR on RMP. Two-way RM ANOVA indicates that increasing [Ca2+]o (F (1, 37)=31.65, p<0.0001) and CaSR deletion (F (1, 37)=19.1, p<0.0001) hyperpolarized the RMP without an interaction (F (1, 37)=1.035, p=0.3155). Post-hoc testing indicated RMP was depolarized with the switch to T0.2 in both NesCre and Casr-/-neurons (p<0.0001 and p=0.0066 for 21 and 18 recordings respectively; Figure 1—source data 1). (F) Plot of average action potential threshold in T1.1 and T0.2 in NesCre and Casr-/- neurons elicited as per panel G. Two-way RM ANOVA indicates that reducing [Ca2+]o hyperpolarized the action potential threshold (F (1, 27)=56.48, p<0.0001) but that genotype had no effect (F (1, 27)=2.284, p=0.1424). [Ca2+]o was highly effective in both NesCre and Casr-/-neurons (p<0.0001 and p=0.0003 for 19 and 10 recordings, respectively). Individual neuron values are represented by open circles linked by lines and averages by filled circles. (G) Exemplar action potentials elicited by current injection in a NesCre (blue) and a Casr-/- neuon (red) in T1.1 (unbroken) and T0.2 (broken). Action potential threshold is indicated by +for the first action potential elicited by current injection (50–200 pA) under the same conditions as panel E. (H) Histogram summarizing effects of divalents on action potential frequency in NesCre and Casr-/- neurons after a current injection to counter divalent-dependent depolarization following T0.2 application. Two-way RM ANOVA indicates that reducing [Ca2+]o increases the action potential frequency (F (1, 35)=11.54, p=0.0017) and that this is significant in the NesCre but not Casr-/-neurons (p=0.0075 and 0.1555 for 21 and 16 recordings, respectively). Inset shows average membrane potential after the current injection. (I) Histogram summarizing effects of divalents on action potential frequency in NesCre and Casr-/- neurons after current injection in T1.1 to depolarize membrane potential to value recorded in T0.2. Two-way RM ANOVA indicates that reducing [Ca2+]o increases the action potential frequency (F (1, 35)=45.09, p=0.0004) and that this is significant in the NesCre but not Casr-/-neurons (p=0.0044 and 0.056 for 21 and 16 recordings, respectively). Inset shows average membrane potential after the current injection.

Figure 1—source data 1

Action potential frequency and resting membrane potential in conventional WT, NesCre and Casr-/- neurons in T1.1 or T0.2 with no current injection.

RMP units are mV and each sub-column represents measurements from a single neuron.

https://cdn.elifesciences.org/articles/67914/elife-67914-fig1-data1-v2.xlsx
Table 1
Action potential frequency.
ANOVA tableSSDFMSF (DFn, DFd)P value
Interaction130.0264.99F (2, 54)=3.193p=0.0489
[Ca2+]o on AP count594.41594.4F (1, 54)=29.21p<0.0001
Genotype136.1268.04F (2, 54)=3.368p=0.0418
Subjects (matching)10915420.20F (54, 54)=0.9925p=0.5110
Residual10995420.35

Does CaSR modulate RMP and divalent-dependent depolarization?

If CaSR-mediated NALCN-dependent depolarization is sufficient to account for the response to external divalent reduction, then NesCre, but not Casr-/-, neurons should depolarize in response to the switch to T0.2. However, the presence of CaSR and external divalent concentrations were both significant determinants of RMP (zero current injection; two-way RM ANOVA, Table 2, F (1,37)=19.1, p<0.0001 and F (1,37)=31.65, p<0.0001, respectively). In fact, the RMP of NesCre and Casr-/- neurons both depolarized similarly (Figure 1E; 5.6 ± 1.1 mV, p<0.0001 and 3.9 ± 1.2 mV, p=0.0066 respectively) when T0.2 was applied indicating the existence of a divalent-sensitive pathway in Casr-/- neurons.

Table 2
RMP.
ANOVA tableSSDFMSF (DFn, DFd)P value
Interaction14.36114.36F (1, 37)=1.035p=0.3155
[Ca2+]o on RMP438.91438.9F (1, 37)=31.65p<0.0001
Genotype151311513F (1, 37)=19.10p<0.0001
Subjects (matching)29303779.19F (37, 37)=5.710p<0.0001
Residual513.23713.87

Divalent-dependent firing persists after hyperpolarization

If NALCN-dependent depolarization is entirely responsible for the extracellular divalent-sensitive changes in neuronal excitability then reversal of this depolarization should prevent (or block) the increase in excitability seen in T0.2. To test this prediction, we measured spontaneous action potential frequency in T0.2 after adjusting the membrane potential to match the RMP observed in T1.1 (current injected to match the membrane potential was unique for each neuron). Action potential frequency in T0.2 was reduced by the hyperpolarization, but neurons remained sensitive to reduced divalent concentrations, although not CaSR deletion, indicating mechanisms besides NALCN were involved (Figure 1H, Table 3; F (1,35)=11.54, p=0.0017, 2-way RM ANOVA). Similarly, in the reciprocal experiment in which the membrane potential in T1.1 was depolarized to match that measured at low divalent concentration, the decrease in external divalent concentration increased action potential frequency (Figure 1I, Table 4; F (1,35)=15.17, p=0.0004, two-way RM ANOVA), and this was significant in NesCre but not Casr-/- neurons (Figure 1I, p=0.004). Ineffective matching of the membrane potential following solution changes did not account for the persistence of divalent-dependent excitability (insets, Figure 1H,I). The sustained sensitivity of spontaneous firing to reduced external divalent concentrations following hyperpolarization of the membrane potential indicated another mechanism, other than NALCN-mediated depolarization, was contributing to the extracellular divalent-sensitive changes in neuronal excitability. Divalent-dependent excitability was also evident in response to transient depolarizing currents (300 ms), with T0.2 increasing action potential count over a range of current injections in NesCre, and to a lesser degree in Casr-/- neurons (Figure 1—figure supplement 2). This was observed despite hyperpolarization of the neuron while in T0.2 to the resting membrane potential measured in T1.1, consistent with it occurring independent of any NALCN-mediated depolarization.

Table 3
Action potential frequency.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction0.340710.3407F (1, 35)=0.4758p=0.4949
[Ca2+]o at hyperpolarizing injection8.26218.262F (1, 35)=11.54p=0.0017
Genotype0.538010.5380F (1, 35)=0.7309p=0.3984
Subjects (matching)25.76350.7360F (35, 35)=1.028p=0.4679
Residual25.06350.7161
Table 4
Action potential frequency.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction0.609010.6090F (1, 35)=0.2048p=0.6536
[Ca2+]o at depolarizing injection45.09145.09F (1, 35)=15.17p=0.0004
Genotype5.98215.982F (1, 35)=0.9959p=0.3252
Subjects (matching)210.2356.006F (35, 35)=2.020p=0.0204
Residual104.1352.973

The action potential threshold was measured to determine if there was a difference in the apparent excitability of NesCre and Casr-/- neurons. Action potentials were elicited in T1.1 and T0.2 using minimal current injection (50–250 pA) and the threshold measured as the point at which dV/dt reached 20 mV/ms (Figure 1G, membrane potential-corrected as in Figure 1H to minimize the effect of the depolarization itself). The action potential threshold was hyperpolarized from −48.6 ± 0.7 mV to −54.3 ± 1.1 mV with the switch from T1.1 to T0.2 in NesCre neurons (Figure 1F) which would have increased excitability. However, the same effect was observed in Casr-/- neurons (−50.9 ± 0.86 mV to −55.4 ± 2.1 mV; F (1,27)=56.48, p<0.0001, two-way RM ANOVA,Table 5). As CaSR deletion did not affect action potential threshold under these conditions (Figure 1F), spike generation presumably occurred more frequently in the NesCre neurons due to the relatively depolarized membrane potential (8 mV positive than Casr-/- neurons, Figure 1E). The lack of effect of CaSR on spike threshold (F (1, 27)=2.284, p=0.142) in these experiments, indicated the reduced divalent sensitivity of Casr-/- (Figure 1E,F) was not simply due to altered action potential threshold.

Table 5
Action potential threshold.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction0.522510.5225F (1, 27)=0.07478p=0.7866
[Ca2+]o on AP threshold394.61394.6F (1, 27)=56.48p<0.0001
Genotype54.34154.34F (1, 27)=2.284p=0.1424
Subjects (matching)642.52723.80F (27, 27)=3.406p=0.0011
Residual188.6276.987

Overall these data support the idea that CaSR played a role in mediating divalent dependent changes in excitability, but that neurons also possessed CaSR-independent mechanisms to fully account for the divalent-dependent excitability.

CaSR effects on divalent-dependent excitability attenuated by matching membrane potential

Further mechanistic complexity was suggested by the effects of CaSR and [Ca2+]o on RMP. This lead to a number of additional questions including: does the difference in RMP contribute to the difference in divalent-dependent excitability between NesCre and Casr-/- neurons, how do decreases in [Ca2+]o depolarize Casr-/- neurons, and is this pathway present in NesCre neurons? To address the first of these questions, we compared the response of NesCre and Casr-/- neurons to changes in extracellular divalent concentrations after removing the confounding variation in RMP. After establishing a stable current-clamp recording in T1.1 we injected a standing current (Ia) until the resting membrane potential was −70 mV. We then recorded for 50 s before switching the bath solution to T0.2. As before, there was a small depolarization followed by an increase in action potential frequency in NesCre neurons (Figure 2A,B). To test if this increase in excitability was fully attributable to divalent-dependent depolarization we adjusted the standing current (Ib) until the membrane potential was −70 mV and then measured the action potential frequency (Figure 2C). In the exemplar, action potential firing was reduced by the hyperpolarization but remained higher in T0.2 at −70 mV than in T1.1 at −70 mV (Figure 2A–C) confirming CaSR-mediated depolarization was not acting alone to increase the excitability. The Casr-/- neurons responded similarly to T0.2 and hyperpolarization (Figure 2A–C) indicating the effect was not mediated by CaSR. We compared the average effects of T1.1 at −70 mV with Ia, T0.2 with Ia, and T0.2 at −70 mV with Ib on NesCre and Casr-/- genotypes (Figure 2D, Table 6) using a 2-way RM ANOVA. Extracellular divalent concentration and current injection substantially affected action potential frequency (F (3, 87)=17.97, p<0.0001). CaSR deletion did not impact the response to extracellular divalent concentration when NesCre and Casr-/- neuron recordings were started at a membrane potential of −70 mV l (F (1, 29)=0.2005, p=0.6577). Post-hoc testing showed that excitability was increased in T0.2 compared with T1.1 regardless which of the two holding currents were used (Figure 2D; Table 7). After injection of Ia to set the membrane potential to −70 mV, the switch from T1.1 to T0.2 still significantly depolarized the membrane potential (Figure 2E; Table 8, Two-way RM ANOVA, F (1, 29)=29.22, p<0.0001) as did CaSR deletion (F (1, 29)=4.874, p=0.0353). Post-hoc testing indicate that the membrane potential in T0.2 was more depolarized in the Casr-/- than in NesCre neurons (Figure 2B,E; −65.6 ± 1.6 mV vs −59.4 ± 2.4 mV, p=0.0083). Taken together, these experiments indicate CaSR-NALCN signaling was not contributing to the difference in divalent-dependent excitability between NesCre and Casr-/- neurons but that these differences may be due to genotype-dependent differences in RMP or intrinsic excitability.

CaSR deletion does not affect divalent-dependent excitability at equivalent membrane potential.

(A) Exemplary traces showing the divalent-dependent increase in neuronal excitability following the switch from T1.1 to T0.2 (change indicated by upper trace) in NesCre (blue) and Casr-/- (red) neurons when initial membrane potentials matched at −70 mV (broken line). (B) Expanded view of the final 5 s of traces in A illustrating sustained depolarization from following T0.2 application. (C) Exemplary traces showing the divalent-dependent decrease in neuronal excitability following the switch from T0.2 to T1.1 (change indicated by upper trace) in NesCre (blue) and Casr-/- (red) neurons when initial membrane potentials matched at −70 mV. Same recordings as A. (D) Histogram of average divalent-dependent changes in action potential frequency (Hz) in NesCre (blue) and Casr-/- (red) neurons when initial voltage is −70 mV in T1.1 (Ia) or T0.2 (Ib). Two-way RM ANOVA performed after logarithmic transformation indicates that reducing [Ca2+]o increases the action potential frequency (F (3, 87)=17.97, p<0.0001) similarly in NesCre and Casr-/- neurons (F (1, 29)=0.2005, p=0.6577; Figure 2—source data 1). Post-hoc tests indicate significant differences between action potential frequency in T1.1 and T0.2 regardless of the holding current but not between action potential frequency recorded at different holding currents and the same solutions (Ia or Ib; Table 7). (E) Membrane potential depolarization following the switch to T0.2 from T1.1. Two-way RM ANOVA indicates that reducing [Ca2+]o (F (1, 29)=29.22, p<0.0001) and CaSR deletion (F (1, 29)=4.874, p=0.0353) significantly depolarized the membrane potential but that there was no interaction (F (1, 29)=4.055, p=0.0534). Post-hoc testing indicate that membrane potentials were matched using current injection in T1.1 (-70.5 ± 0.4 mV and −70.2 ± 0.2 mV for NesCre and Casr-/- neurons respectively, p=0.985) but different in T0.2 (-65.6 ± 1.6 mV and –59.4 ± 2.4 mV, p=0.0083). (F) Exemplar action potentials elicited by current injection from −70 mV in a NesCre (blue) and a Casr-/- neuron (red) in solutions T1.1 (unbroken) and T0.2 (broken). Action potential threshold is indicated by +symbol for the first action potential elicited by current injection (50 to 200 pA). (G) Plot of average action potential threshold in T1.1 and T0.2 in NesCre and Casr-/- neurons, elicited as per panel F here and in subsequent panels. Two-way RM ANOVA indicates that reducing [Ca2+]o hyperpolarized the action potential threshold (F (1, 25)=51.66, p<0.0001), whereas CaSR deletion had the opposite effect (F (1, 25)=10.52, p=0.0033). There was no interaction (Table 9A). Post-hoc tests indicate that the action potential thresholds in solutions T1.1 and T0.2 were depolarized similarly by CaSR deletion (5.3 ± 2.0 mV and 5.5 ± 2.0 mV, p=0.020 and 0.017) in NesCre and Casr-/- neurons, respectively. (H) Plot of average action potential half-duration in T1.1 and T0.2 in NesCre and Casr-/- neurons. Two-way RM ANOVA indicates that reducing [Ca2+]o prolonged the action potential half-duration (F (1, 28)=19.73, p=0.0001). (I) Plot of average action potential peak in T1.1 and T0.2 in NesCre and Casr-/- neurons. The action potential peaks were higher in T1.1 and in Casr-/- neurons (Table 9C).

Figure 2—source data 1

Action potential frequency in NesCre and Casr-/- neurons in T1.1 or T0.2 with standing currents Ia and Ib.

The action potential frequency is in log base 10 and each sub-column represents measurements from a single neuron.

https://cdn.elifesciences.org/articles/67914/elife-67914-fig2-data1-v2.xlsx
Table 6
Action potential frequency.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction0.430530.1435F (3, 87)=0.3481p=0.7906
[Ca2+]o and I22.2337.410F (3, 87)=17.97p<0.0001
Genotype0.134110.1341F (1, 29)=0.2005p=0.6577
Subjects (matching)19.41290.6692F (29, 87)=1.623p=0.0445
Residual35.87870.4123
Table 7
Action potential frequency.
Sidak's multiple comparisons testMean diff.95% CI of diff.Significant?SummaryAdjusted p value
T1.1 Ia vs. T0.2 Ia−1.059−1.498 to −0.6200Yes****<0.0001
T1.1 Ia vs. T0.2 Ib−0.6203−1.059 to −0.1813Yes**0.0016
T1.1 Ia vs. T1.1 Ib−0.1163−0.5554 to 0.3227Nons0.9797
T0.2 Ia vs. T0.2 Ib0.4387−0.0003709 to 0.8778Nons0.0503
T0.2 Ia vs. T1.1 Ib0.94270.5037 to 1.382Yes****<0.0001
T0.2 Ib vs. T1.1 Ib0.50400.06496 to 0.9431Yes*0.0160
Table 8
Membrane potential with Ia.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction131.71131.7F (1, 29)=4.055p=0.0534
[Ca2+]o949.21949.2F (1, 29)=29.22p<0.0001
Genotype162.71162.7F (1, 29)=4.874p=0.0353
Subjects (matching)968.02933.38F (29, 29)=1.028p=0.4711
Residual942.02932.48

Voltage-gated sodium channels contribute to divalent-dependent excitability

Reversal of the divalent-dependent depolarization did not completely block the increased excitability associated with the switch to T0.2 (Figures 1E, F and 2D) indicating another mechanism other than NALCN was responsible. We tested if voltage-gated channels were contributing by to divalent-dependent excitability by examining action potential threshold in neurons held at a membrane potential of −70 mV. Action potential threshold was hyperpolarized by 8 mV on average following the change from T1.1 to T0.2 in NesCre and Casr-/- neurons (Figure 2F,G, Table 9A; F (1, 25)=51.66, p<0.0001). Furthermore, the action potential threshold was relatively depolarized in the Casr-/- neurons in T1.1 and T0.2 (5.3 ± 2.0 mV (p=0.020) and 5.5 ± 2.0 mV (p=0.017) respectively), indicating NesCre neurons possessed increased excitability and increased sensitivity to decreases in external divalent concentration (Figure 2F,G). The action potential half-width recorded under the same conditions, was also sensitive to the reduction of divalent concentration but unaffected by CaSR deletion (Figure 2H,I Table 9B). ANOVA indicated that the switch to T0.2 from T1.1 broadened action potential half-width (F (1,28)=19.7, p=0.0001). The genotype and [Ca2+]o interacted to both affect action potential peak voltage (Figure 2I, Table 9C; F (1, 28)=6.76, p=0.015) with the peak potential being reduced by T0.2 in the NesCre (p<0.0001) but not Casr-/- neurons (p=0.34).

Table 9
Action potential threshold recorded at −70 mV.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction0.0665810.06658F (1, 25)=0.004070p=0.9496
[Ca2+]o845.11845.1F (1, 25)=51.66p<0.0001
Genotype391.01391.0F (1, 25)=10.52p=0.0033
Subjects (matching)929.52537.18F (25, 25)=2.273p=0.0225
Residual408.92516.36
(B) Action potential threshold recorded at −70 mV
Interaction2.008e-0712.008e-07F (1, 28)=2.800p=0.1054
[Ca2+]o1.415e-0611.415e-06F (1, 28)=19.73p=0.0001
Genotype3.050e-0713.050e-07F (1, 28)=0.4545p=0.5057
Subjects (matching)1.879e-05286.710e-07F (28, 28)=9.358p<0.0001
Residual2.008e-06287.170e-08
(C) Action potential threshold recorded at −70 mV
Interaction0.000160210.0001602F (1, 28)=6.758p=0.0147
[Ca2+]o0.000482110.0004821F (1, 28)=20.34p=0.0001
Genotype0.00119310.001193F (1, 28)=5.891p=0.0219
Subjects (matching)0.005669280.0002025F (28, 28)=8.541p<0.0001
Residual0.0006637282.370e-005

We examined the properties of VGSCs and voltage-gated potassium channels (VGPCs) to determine the reason for the altered action potential threshold. VGSCs were isolated in neocortical neurons and the current-voltage characteristics examined. Families of VGSC currents were activated in neurons after 2–4 weeks in culture. Maximum VGSC currents were elicited at −30 mV and averaged −8.0 ± 0.8 nA (n = 7) and −8.8 ± 2.8 nA (n = 6) in NesCre and Casr-/- neurons, respectively. The current-voltage curve shifted in a hyperpolarizing direction with the switch from T1.1 to T0.2 but extensive neuronal processes limited the quality of the voltage-clamp and prevented useful analysis. We examined VGSC gating in nucleated outside-out patches (Sather et al., 1992; Almog et al., 2018) to ensure better voltage control. VGSC currents were elicited by voltage steps from −80 mV (10 mV increments to 40 mV). In T0.2, the VGSC inactivation (see below) resulted in smaller currents that were more sensitive to depolarization (bold traces elicited by steps to −50 mV, Figure 3A) as previously observed (Frankenhaeuser and Hodgkin, 1957; Campbell and Hille, 1976; Armstrong and Cota, 1991). Divalent sensitivity was confirmed in the normalized current-voltage plot for both NesCre (blue, n = 8) and Casr-/- (red, n = 11) neurons (Figure 3A,C). VGSC current inactivation was studied using a test pulse to −20 mV, each of which was preceded by a conditioning step (100 ms) to between −140 mV and −20 mV. In T1.1 we observed less inactivation than in T0.2 (Figure 3B, bold traces show currents elicited following prepulse to −80 mV). We compared the effects of [Ca2+]o and CaSR deletion on VGSC current inactivation using plots of normalized conductance and measuring the half maximal voltage (V0.5; circles, Figure 3D,E). The reduction in divalent concentration left-shifted V0.5 (F (1, 18)=56, p<0.0001, 2-way RM ANOVA, Table 10) but CaSR deletion did not (F (1, 18)=0.563, p=0.463). The switch from T1.1 to T0.2 shifted V0.5 by −20 and −21 mV in NesCre and Casr-/-, respectively (−72 ± 2 to −92 ± 2 mV and −73 ± 1 to −94 ± 2 mV).

CaSR deletion and external divalent concentration affect VGSC current gating.

(A) Exemplary traces showing VGSC currents activated by voltage steps from −80 in 10 mV increments (left), in nucleated patches isolated from NesCre (blue) and Casr-/- (red) neurons in solutions T1.1 and T0.2. The VGSC currents elicited by 10 ms depolarizations to −50 mV (bold) were greater following the switch to T0.2. (B) Exemplary traces showing VGSC currents activated by voltage steps to −20 mV following a 100 ms conditioning step (left), in the same patches as (A) using solutions T1.1 and T0.2. The VGSC currents elicited following conditioning steps to −80 mV (bold) were smaller following the switch to T0.2. (C) Current-voltage plots of average normalized VGSC currents in nucleated patches from NesCre (n = 8) and Casr-/- (n = 11) neurons in T1.1 (filled circles) and T0.2 (open circles). Currents were normalized using the maximum VGSC current in each recording. (D) Plot of average normalized conductance versus voltage in patches from NesCre neurons for activation (square, n = 8) and inactivation (circle, n = 8) in solutions T1.1 (filled) and T0.2 (open). Boltzmannn curves are drawn using average values from individual fits and gray broken lines indicate V0.5 values for each condition. (E) Plot of average normalized conductance versus voltage in patches from Casr-/- neurons for activation (square, n = 11) and inactivation (circle, n = 12) in solutions T1.1 (filled) and T0.2 (open). Boltzmannn curves are drawn using average values from individual fits and gray broken lines indicate V0.5 values for each condition. Inset shows plot expanded to emphasize voltage dependence of the window currents. (F and G) represent the plots of D and E expanded to emphasize the voltage dependence of the window currents. (H) Histogram showing V0.5 for VGSC inactivation in T1.1 and T0.2 in patches from NesCre and Casr-/- neurons. (I) Histogram showing V0.5 for VGSC activation in T1.1 and T0.2 in patches from NesCre and Casr-/- neurons.

Table 10
Voltage-gated sodium channel current V0.5 for inactivation.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction12.00112.00F (1, 18)=0.7743p=0.3905
[Ca2+]o397313973F (1, 18)=256.2p<0.0001
Genotype27.49127.49F (1, 18)=0.5632p=0.4627
Subjects (matching)878.51848.81F (18, 18)=3.148p=0.0097
Residual279.11815.50

We also tested how the VGSC activation was affected by CaSR and [Ca2+]o. The peak inward VGSC currents (Figure 3B,D) were divided by the driving voltage and then plotted as conductance-voltage plots. The normalized conductance plots (squares, Figure 3E,F) indicate that the switch from T1.1 to T0.2 significantly facilitated VGSC activation consistent with VGSCs in other excitable cells (V0.5 was hyperpolarized by 10 mV; F (1, 17)=98, p<0.0001; two-way RM ANOVA, Table 11; Hille, 2001). Switching from T1.1 to T0.2 shifted V0.5 by −11 mV and −9 mV in NesCre and Casr-/- neurons respectively (−46 ± 2 to −57 ± 2 mV and −43 ± 1 to −52 ± 1 mV). The unexpected shift in V0.5 for VGSC activation in Casr-/- neurons will reduce the likelihood of VGSC activation (F (1, 17)=4.8, p=0.04) in these cells (Figure 3I). Overlap of the inactivation and activation conductance plots represents the voltage range over which persistent VGSC currents, or window currents, are likely to occur (Chadda et al., 2017). Divalent reduction hyperpolarized this region of overlap toward the RMP (Figure 3F,G insets) increasing the likelihood that persistent VGSC currents were activated at resting membrane potential and therefore contributing to divalent-dependent excitability. The depolarization of VGSC activation gating that resulted from CaSR deletion (Figure 3I), shifted the area of conductance curve overlap for T0.2 in a depolarizing direction (Figure 3G). This effect would reduce the fraction of VGSCs available for activation by T0.2 at the more hyperpolarized RMPs and explain the reduced the likelihood of spontaneous action potential generation in Casr-/- neurons (Figure 1).

Table 11
Voltage-gated sodium channel current V0.5 for activation.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction4.81414.814F (1, 17)=0.5668p=0.4618
[Ca2+]o834.51834.5F (1, 17)=98.24p<0.0001
Genotype157.61157.6F (1, 17)=4.813p=0.0424
Subjects (matching)556.71732.75F (17, 17)=3.855p=0.0040
Residual144.4178.494

VGPC currents were isolated and recorded in NesCre and Casr-/- neurons in T1.1 and T0.2 solutions after blocking contaminating currents. Currents were elicited by a series of 60 ms steps from −70 mV to 60 mV in 10 mV increments (Figure 4). The VGPC current amplitudes were measured at the peak and at the end of the depolarizing step (normalized to the value at 60 mV in T1.1). Neither the peak nor end current were affected by reduction of the external divalent concentration or by deletion of CaSR (Figure 4) over the range of voltages. The currents activated at 60 mV were similarly unaffected (Figure 4, Two-way RM ANOVA [(3, 57)=1.347, p=0.2683 and (1, 19)=1.231, p=0.2811, Table 12]). These data indicate that VGPCs are not involved in divalent-dependent excitability in neocortical neurons.

CaSR deletion and external divalent concentration do not significantly affect VGPC current gating.

(A) Exemplary traces showing VGPC currents activated by voltage steps from −80 in 10 mV increments (left), in a NesCre neuron in solutions T1.1 and T0.2. The outward currents elicited by the 50 ms voltage step were measured at peak and at the end of the step (average of last 5 ms indicated by gray bar). (B) Current voltage-plot of average normalized VGPC currents (n = 10) in NesCre neurons in T1.1 (filled circles) and T0.2 (open circles) at peak or end of step. Currents were normalized using the maximum outward current in each condition here and below. (C) Peak and end outward currents at 60 mV elicited in same neurons as B. Two-way RM ANOVA indicates that peak and outward currents were not different in T1.1 or T0.2 ((3, 57)=1.347), p=0.2683 nor were they affected by CaSR deletion (data from E, (1, 19)=1.231, p=0.2811). (D) Current voltage-plot of average normalized VGPC currents (n = 11) in Casr-/- neurons in T1.1 (filled circles) and T0.2 (open circles) at peak or end of step. (E) Peak and end outward currents at 60 mV elicited in same neurons as D.

Table 12
Voltage-gated potassium channel currents at 60 mV.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Interaction1.226e-01834.086e-019F (3, 57)=0.2271p=0.8772
[Ca2+]o and time7.270e-01832.423e-018F (3, 57)=1.347p=0.2683
Genotype6.054e-01716.054e-017F (1, 19)=1.231p=0.2811
Subjects (matching)9.345e-016194.919e-017F (19, 57)=27.33p<0.0001
Residual1.026e-016571.800e-018

VGSCs are the dominant contributor to divalent-dependent currents

To compare the contributions of VGSCs and NALCN to the divalent-dependent depolarization seen in neocortical neurons (Figure 2), we measured the size of the currents elicited at −70 mV in neurons following the switch from T1.1 to T0.2. We used conWT neurons to avoid potential confounding Cre-dependent effects (Qiu et al., 2011). Since NALCN is resistant to the VGSC blocker tetrodotoxin (TTX) (Lu et al., 2007; Swayne et al., 2009) but Gd3+ (10 µM) inhibits NALCN and VGSCs (Elinder and Arhem, 1994; Li and Baumgarten, 2001; Lu et al., 2009), we were able to pharmacologically separate the contributions of VGSCs and NALCN to the basal current following the switch from T1.1 to T0.2 (-31 ± 3 pA, n = 13; Figure 5A–C). Addition of a saturating concentration of TTX (1 µM) in T0.2 inhibited a persistent inward current within a few seconds in all but one of the recordings (Figure 5A–C), consistent with VGSCs contributing to the inward current elicited by T0.2. Switching to T1.1 plus TTX produced minimal change in the basal current on average (Figure 5C). However, in some neurons, T1.1 elicited an outward current (Figure 5A,C), whereas in others there was an inward current (Figure 5B,C) indicating the presence of two types of TTX resistant divalent-sensitive pathways. Presumably, NALCN was contributing to the divalent-dependent TTX-resistant effect observed in Figure 5A. Co-application of Gd3+ (10 µM) following block of VGSCs with TTX, resulted in a small inward deflection of the average basal current in solution T1.1 and largely inhibited sensitivity to concomitant decreases in [Ca2+]o (Figure 5A–C). The reduced sensitivity of neurons to the reduction of [Ca2+]o in the presence of TTX, suggests that VGSCs are a major contributor to the depolarizing current elicited by low [Ca2+]o. Using serial subtraction of the basal currents (Figure 5C), we compared the size of the TTX-sensitive (−28.2 ± 5.3 pA), Gd3+-sensitive (−5.7 ± 3.4 pA) and remaining (3.4 ± 2.0 pA) divalent-dependent currents (Figure 5D; RM-ANOVA, F (1.495, 17.94)=13.30, p=0.0007, Table 13). Multiple comparison testing indicated that the TTX-sensitive divalent-dependent current was greater than the Gd3+-sensitive (p=0.039) and remaining divalent-dependent currents (p=0.0009; Table 14). Similar differences in the relative sizes of the TTX-, Gd3+-, and remainder divalent-dependent basal current currents were also observed in Casr-/-neurons (Figure 5D). While there were rare neurons in which there was a larger Gd3+-sensitive current (Figure 5C) the reduced sensitivity of neurons to the reduction of [Ca2+]o in the presence of TTX, confirms that VGSCs are the major contributor to the depolarizing current elicited by low [Ca2+]o.

Figure 5 with 1 supplement see all
VGSC current activation by decreased external divalent concentration.

(A,B) Plots illustrating the responses of the basal currents in two WT neurons during application of T1.1 and T0.2 before and during TTX or TTX and Gd3+. Average basal currents were measured over 50 ms every 2 s with T1.1 and T0.2 application indicated by vertical shading (gray represents T0.2) and blockers application by horizontal bars and broken vertical lines. (C) Plot of average basal current measurements (filled circles) and individual neurons (open circles) in each solution condition in conWT (n = 13) neurons. Each basal current represents the average value recorded during last 20 s of the specific solution application. (D) Average [Ca2+]o dependent basal currents sensitive to TTX and Gd3+ calculated by subtraction of data in C and the remaining [Ca2+]o dependent current after application of both blockers for conWT neurons. (E) Exemplar traces of currents elicited by 50 ms voltage steps between −100 and −50 mV during application of solutions described in C. (F) Plots of the average currents over the last 5 ms of each voltage step in all six solutions for conWT (n = 13). (G) Plots of the average [Ca2+]o dependent currents derived by subtraction of conWT data (F) resolved as total or control (broken blue), in the presence of TTX (broken red), and in the presence of TTX and Gd3+ (remainder green). The TTX-sensitive (solid red), Gd3+-sensitive (solid blue) and NALCN (dotted line) component currents were obtained by further subtraction. Inset shows expanded view at intercept of TTX-sensitive and NALCN components. (H) Exemplars of the TTX- and Gd3+-sensitive [Ca2+]o-dependent currents. Broken red line represents zero current line.

Table 13
divalent-dependent basal currents at −70 mV.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Treatment6.871e-02123.435e-021F (1.495, 17.94)=13.30p=0.0007
Individual (between rows)5.669e-022124.725e-023F (12, 24)=0.1828p=0.9981
Residual (random)6.201e-021242.584e-022
Total1.364e-02038
Table 14
Post hoc testing of divalent-dependent basal currents at −70 mV.
Sidak's multiple comparisons testMean diff.95% CI of diff.Significant?SummaryAdjusted p value
TTX sens vs. Gd3+ sens−2.247e-011−4.391e-011 to −1.033e-012Yes*0.0392
TTX sens vs. Rem−3.158e-011−4.899e-011 to −1.418e-011Yes***0.0009
Gd3+ sens vs. Rem−9.111e-012−2.146e-011 to 3.240e-012Nons0.1789

In a fraction of the neurons, an inward deflection of the basal current occurred when external divalent concentration was increased in the presence of TTX (Figure 5B,C) which contrasted with the outward current expected from NALCN deactivation (Figure 5A). We examined the voltage-dependence of the contributions of VGSCs, NALCN, and this second divalent-dependent TTX-resistant current to better characterize divalent-dependent excitability. We used 50 ms voltage steps between −100 and −50 mV and averaged the current over the last 5 ms of the step. Three additional major effects are illustrated by the exemplar current traces (Figure 5E). First, in the absence of blockers, the switch from T1.1 to T0.2 substantially increased the number of large, rapidly inactivating inward currents even at −70 mV following hyperpolarizing steps. Second, in TTX, low [Ca2+]o increased the linear inward and rectifying outward currents. Third, in the presence of TTX and Gd3+ changing between T1.1 and T0.2 had little effect suggesting Gd3+ is blocking both NALCN and the second divalent-dependent TTX-resistant current. These observations were confirmed in the average current-voltage plots (Figure 5F) where it is clear that at −80 to −100 mV the major divalent-dependent currents are inward and resistant to TTX and sensitive to Gd3+, whereas at −70 to −50 mV the largest divalent-dependent currents are TTX-sensitive. The divalent-dependent effects were calculated by subtracting the currents recorded in T1.1 from those in T0.2 under control conditions (Figure 5G, broken red), in the presence of TTX (broken blue) and TTX plus Gd3+ (solid green). The TTX-sensitive (solid red) and Gd3+-sensitive (solid blue) divalent-dependent currents were obtained by additional subtraction (broken red minus broken blue and broken blue minus green). The average divalent-dependent current carried by VGSCs only became evident once the neurons were depolarized above −80 mV (Figure 5G). The time course of deactivation of the persistent divalent-dependent VGSC currents was observed following hyperpolarization from −70 mV (Figure 5H, middle). At more negative potentials, the Gd3+-sensitive current accounted for all the divalent-dependent current and traces showed an ohmic voltage dependence (Figure 5G). However, the Gd3+-sensitive current reversed at −60 mV and outward currents were elicited by steps to −60 and −50 mV that exhibited a voltage-dependent activation and inactivation (Figure 5H, right-hand). This is consistent with the Gd3+-sensitive current consisting of the sum of NALCN and an outward voltage-dependent current. Assuming conservatively that all of the Gd3+-sensitive current at −100 mV could be attributed to NALCN and employing the channel’s linear voltage-dependence and zero mV reversal potential (Lu et al., 2007; Lu et al., 2010), then the amplitude of NALCN currents could be estimated over the voltage range −100 to 0 mV (broken black line, Figure 5G). By interpolation (Figure 5G, inset), the contribution of NALCN and VGSCs to divalent-dependent currents were equal at −77 mV with the contribution from VGSCs increasing with depolarization. A similar analysis of divalent-dependent currents in Casr-/- neurons indicated that the contribution of VGSCs was greater than that of NALCN once membrane potentials were depolarized beyond −72 mV (Figure 5—figure supplement 1). These data indicate that divalent-dependent currents around the resting membrane that contribute to divalent-dependent excitability are mainly attributable to VGSCs.

Changes in resting potential resulting from lowered divalents are mediated mainly by VGSCs

The complex architecture of neocortical neurons restricted our ability to clamp the membrane potential following the activation of large, rapid VGSC currents. Thus, we re-examined the contribution of VGSCs and NALCN to the depolarizations that mediate divalent-dependent excitability in current clamp recordings from conWT neurons. Consistent with earlier experiments (Figure 2), switching from T1.1 to T0.2 depolarized the membrane potential from −70 mV by 7.2 ± 1.5 mV (n = 12) and increased spontaneous action potential firing in pharmacologically isolated neurons (Figure 6A,B). We used TTX and Gd3+ to measure the contributions of VGSCs and NALCN respectively to these divalent-dependent depolarizations. TTX blocked action potential generation, as expected, but also hyperpolarized the membrane potential indicating that VGSCs were open in T0.2 (Figure 6A1) and T1.1 (Figure 6A2). The switch from T0.2 to T1.1 in TTX resulted in a hyperpolarization, consistent with divalent-dependent NALCN closure, in some neurons (Figure 6A 1 lower trace and B). Other neurons depolarized with the switch to T1.1 (Figure 6A 2 lower trace and B) consistent with a divalent-dependent outward current similar to that observed in Figure 5B,C. On average the divalent-dependent depolarization was almost entirely prevented by TTX or TTX and Gd3+ co-application (Figure 6B). The amplitude of the divalent-dependent depolarizations in conWT neurons changed with blocker type (1-way RM ANOVA, F (1.219, 13.41)=12.83, p=0.0022, Table 15). The TTX-sensitive component was greater than the Gd3+-sensitive and the blocker-resistant component (p=0.022 and 0.0028 respectively, Table 16). On average VGSCs accounted for 93% of the depolarization that triggers divalent-dependent excitability in WT neurons starting at −70 mV (Figure 6C) and we observed a similar pattern in Casr-/- neurons (Figure 6C).

Divalent-dependent depolarization is almost entirely mediated via VGSCs.

(A) The response of the membrane potential in two WT neurons during application of T1.1 and T0.2 before and during TTX or TTX and Gd3+. T1.1 and T0.2 application is indicated by vertical shading (gray represents T0.2) and blocker applications by horizontal bars and broken vertical lines. The broken red line indicates −70 mV. Voltage-expanded view of the trace illustrates that in the presence of TTX, hyperpolarization (A1) and depolarization (A2) may occur following the switch to T1.1. Membrane potential values highlighted by broken red lines. (B) Plot of average (filled circles) and individual (open circles) Ca2+-dependent voltage changes (filled circles) following the switch from T1.1 to T0.2 (by subtraction of average between-spike membrane potential over the last 10 s of each solution application). Each solution applied to conWT (n = 12) and Casr-/- (n = 9) neurons. (C) Average [Ca2+]o dependent voltage changes sensitive to TTX and Gd3+ calculated by subtraction of data in B, and the remaining [Ca2+]o-dependent voltage after application of both blockers (Figure 6—source data 1). (D) Estimates of the average relative size of the external divalent concentration-dependent NALCN and VGSC currents in neocortical neurons between −100 and −30 mV. NALCN values from Figure 5G. The external divalent concentration-dependent VGSC currents were estimated as follows: the products of the VGSC activation and inactivation conductance plots were calculated for T1.1 and T0.2 using the average Boltzmann curves in Figure 3. These were converted to currents (I = driving voltage x conductance), and scaled to match the average TTX-sensitive current at −70 mV. The current generated in T0.2 minus that generated in T1.1 (ΔICa) was plotted against membrane voltage. (E) Plot of the average divalent-dependent depolarizing current carried by VGSC derived from D. The change in average resting membrane potential recorded in Figure 1 is indicated by the gray bar.

Figure 6—source data 1

Depolarization elicited by switch from T1.1 to T0.2 that was sensitive to TTX, Gd3+, or resistant to both blockers in conventional WT and Casr-/- neurons.

Depolarization units are volts and each sub-column represents measurements from a single neuron.

https://cdn.elifesciences.org/articles/67914/elife-67914-fig6-data1-v2.xlsx
Table 15
divalent-dependent depolarization.
ANOVA tableSSDFMSF (DFn, DFd)p Value
Treatment0.000394420.0001972F (1.219, 13.41)=12.83p=0.0022
Individual (between rows)0.0001037119.423e-006F (11, 22)=0.6132p=0.7982
Residual (random)0.0003381221.537e-005
Total0.000836135
Table 16
Post hoc testing of blocker sensitive fractions of the divalent-dependent depolarization.
Sidak's multiple comparisons testMean diff.95% CI of diff.Significant?SummaryAdjusted p value
TTX sens vs. Gd3+ sens0.0065280.001005 to 0.01205Yes*0.0215
TTX sens vs. Rem0.0074280.002879 to 0.01198Yes**0.0028
Gd3+ sens vs. Rem0.0009−0.001301 to 0.003101Nons0.5311

Next we estimated the average relative contributions of the divalent-dependent NALCN and VGSC currents over a wider voltage range. Ohmic divalent-dependent NALCN currents were extrapolated from −100 mV, where contaminating currents appear minimal (Figure 5G) and compared with the divalent-dependent VGSC currents predicted from scaled conductance plots (Figure 3D). The VGSC currents were the major contributor to divalent-dependent currents over the −77 to −30 mV voltage range (Figure 6D,E). These findings indicate that VGSCs are the predominant contributor to the depolarizations that lead to action potential generation at lower external divalent concentrations (Figure 6E, gray bar).

Discussion

Extracellular calcium concentration regulates both synaptic transmission and intrinsic neuronal excitability, thereby strongly affecting the probability of action potential generation. Consequently, physiological and pathological changes in [Ca2+]o will impact neuronal computation in a complex manner. We have investigated the mechanisms underlying divalent-dependent changes in intrinsic neuronal excitability and tested if CaSR is transducing decreases in [Ca2+]o into NALCN-mediated depolarizations to trigger action potentials (Lu et al., 2010). We found no evidence that this specific mechanism was active in neocortical neurons (Figure 2). Instead, we determined that the vast majority of divalent-dependent neuronal excitability was mediated via VGSCs in three ways. Decreasing the concentration of external divalents activated VGSCs at the resting membrane potential and depolarized the membrane toward the action potential threshold (Figure 6). This occurred because the decreased divalent concentration hyperpolarized the VGSC window current toward the membrane potential increasing sodium currents and the likelihood of action potential generation (Figure 3). Unexpectedly the deletion of CaSR modulated VGSC gating, decreasing the sensitivity of current activation to depolarization via an unidentified mechanism (Figure 3). Deletion of CaSR also indirectly affected action potential generation by modestly hyperpolarizing the membrane potential (Figure 1). While the actions of [Ca2+]o on VGSCs were responsible for the vast majority of the [Ca2+]o-dependent neuronal excitability, using Gd3+ we isolated small divalent-dependent inward currents in about half of the neurons (Figure 5). These Gd3+-sensitive currents presumably reflected activation of NALCN, and were unaffected by CaSR deletion, but their relatively small size compared to TTX-sensitive divalent-dependent inward currents indicate that they would be minor contributors to divalent-dependent excitability compared to VGSCs (Figures 5 and 6).

The fractions of the divalent-dependent currents and depolarizations that were sensitive to TTX were surprisingly large compared to those that were Gd3+-sensitive (Figures 5D and 6C) indicating the relative importance of VGSC- and NALCN-mediated contributions to divalent-dependent excitability respectively. The resistance of NALCN to TTX (Lu et al., 2007; Swayne et al., 2009) reassures that the relatively large TTX-sensitive component is due to selective block of VGSC currents. Persistent subthreshold VGSC currents have been shown to determine spiking rates in other central neurons (Taddese and Bean, 2002; Gorelova and Seamans, 2015) and so the increased VGSC currents we observed in T0.2 are well-positioned to explain the increased action potential frequency (Figure 6). We are unable to determine from these experiments which neuronal compartment is most affected by the change in [Ca2+]o (Gorelova and Seamans, 2015). However, the physiological impact of VGSC-mediated divalent-dependent excitability may be enormous overall because of the dynamic nature of [Ca2+]oin vivo where it decreases from basal (1.1–1.2 mM) by 30–80% (Nicholson et al., 1978; Ohta et al., 1997; Pietrobon and Moskowitz, 2014). The overall computational effects of physiological decrements in [Ca2+]o will be complex because the increased action potential generation due to changes on VGSCs (Figures 3 and 6) will be confounded by the impact of reduced Ca2+ entry through VACCs (Hess et al., 1986; Weber et al., 2010; Williams et al., 2012), reduced excitatory synaptic transmission (Neher and Sakaba, 2008; Vyleta and Smith, 2011), and altered CaSR-mediated signaling at the nerve terminal (Phillips et al., 2008; Chen et al., 2010; Vyleta and Smith, 2011).

It remains unclear why NALCN was the dominant effector of divalent-dependent excitability in hippocampal (Lu et al., 2010) but not neocortical neurons (Figure 6). Could our use of [Ca2+]o and [Mg2+]o rather than [Ca2+]o alone be responsible? We changed divalents simultaneously to provide a strong stimulus to CaSR-signaling and VGSC gating, both of which are sensitive to [Ca2+]o and [Mg2+]o (Frankenhaeuser and Hodgkin, 1957; Brown et al., 1993). Consequently, the same pathways were expected to respond to changes in divalents or [Ca2+]o alone, since the potentially confounding effects on synaptic transmission were blocked in our experiments. Another difference is that we counted spontaneous action potentials as the main measure of excitability whereas others have focused on action potentials elicited by direct injection. We used spontaneous activity to allow us to isolate the depolarization (Figure 2) that was hypothesized to arise from NALCN activation and trigger action potentials following the reduction of external divalent concentration changes (Figure 2). Spontaneous and depolarization-elicited action potentials have been recognized as forms of [Ca2+]o-dependent excitability for >60 years (Frankenhaeuser and Hodgkin, 1957) and both types of activity were increased here when external divalent concentrations were decreased (Figure 1 and Figure 1—figure supplement 2). Because we observed increased excitability, despite the injection of a current to bring the steady state membrane potential back to that recorded in T1.1, mechanisms other than a voltage-independent non-selective cation channel, like NALCN, must have been active (Figure 1 and Figure 1—figure supplement 2). Similarly, the increased spikes elicited by transient current injections in low [Ca2+]o in hippocampal neurons occurred after the steady state membrane potential was set to −80 mV using a longer current injection (Lu et al., 2010). The long injection would have reversed the NALCN-mediated depolarization in low [Ca2+]o and so the mechanism by which the increased excitability occurred is unclear. One possible explanation is that at low [Ca2+]o NALCN could have been further activated by shorter depolarizing current injections; however, this is at odds with the lack of voltage-dependence of NALCN (Lu et al., 2010). Could NALCN be operating via a different mechanism? One possibility is that NALCN activation is enhancing excitability measured at the soma by enhancing calcium entry into nerve terminals (directly or modifying the action potential waveform and VACC activation) and strengthening excitatory synaptic transmission onto the neuron under study. This would require that the enhancement of synaptic transmission by NALCN be greater than the reduction due to reduced Ca2+ entry (Neher and Sakaba, 2008) but could be addressed by recording directly from terminals (Ritzau-Jost et al., 2021) or by determining if NALCN deletion has the same effect after blocking glutamatergic transmission. However, the loss of NALCN could be contributing to [Ca2+]o-dependent changes in excitability independent of a depolarization based on other reports. A number of mechanisms have been postulated to explain how a persistent sodium leak into excitable cells at rest can affect excitability (Sokolov et al., 2007). Such mechanisms or other compensatory changes in neuronal function, as observed with null-mutant animals (Jun et al., 1999), could arise from the loss of NALCN and possibly contribute to the reduced sensitivity of hippocampal neurons to decreased [Ca2+]o (Lu et al., 2010). Lastly, the apparent difference between the studies could reflect different properties of hippocampal and neocortical neurons. While possible it still remains unclear why the deletion of NALCN or UNC-79 completely ablated [Ca2+]o-dependent excitability in hippocampal neurons (Lu et al., 2010) since these neurons contain VGSCs that retain sensitivity to changes in [Ca2+]o (Isaev et al., 2012). However, if the UNC79-UNC80-NALCN pathway modulates VGSC function this could explain how loss of NALCN or UNC-79 could delete acute divalent-dependent changes in VGSC function and excitability. NALCN appears to transduce [Ca2+]o- and G-protein-dependent excitability in other neurons (Philippart and Khaliq, 2018) but GPCRs other than CaSR may be involved (Kubo et al., 1998; Tabata and Kano, 2004) and under certain conditions Ca2+ directly blocks NALCN (Chua et al., 2020). Further characterization of the UNC79-UNC80-NALCN signaling pathway is essential given the major changes in neurological function that have been described following mutations of NALCN or upstream co-molecules such as UNC79 and UNC80 (Stray-Pedersen et al., 2016; Bourque et al., 2018; Kuptanon et al., 2019).

In a small fraction of the neocortical neurons (Figures 5 and 6) there was a modest inward current or depolarization with the lowering of extracellular divalent concentration once VGSCs had been blocked. In a few cases, they were sensitive to 10 µM Gd3+ consistent with a NALCN-mediated effect and those that were resistant were consistent with other divalent-dependent non-selective cation channels (Ma et al., 2012b). However, deletion of CaSR did not decrease divalent-dependent depolarizations and after membrane potential matching did not impact divalent-dependent excitability (Figures 2E and 6B). While CaSR-NALCN signaling did not contribute to divalent-dependent excitability in neocortical neurons (Figures 2 and 6) it was clear that Casr-/- neurons were substantially less sensitive to changes [Ca2+]o (Figure 1A,B). The reduced [Ca2+]o sensitivity in these neurons is attributable to the combination of altered VGSC gating (Figure 3E,F) and the hyperpolarized RMP (Figure 1E). Although CaSR did not affect the amplitude of the shift in V0.5 following the switch to T0.2, the gating characteristics of VGSC activation was depolarized by loss of CaSR (Figure 3EF). Could CaSR stimulation activate G-proteins and regulate the V0.5 for VGSC currents (Figure 3E,F)? In neocortical neurons, G-protein activation hyperpolarized VGSC gating and this was blocked by GDPβS (Mattheisen et al., 2018) which is inconsistent with the effect we observed here. Other possible explanations are that CaSR could regulate VGSC subunit expression or post translational modification (Cantrell et al., 1996; Zhang et al., 2019), and this may represent a compensatory mechanism similar to that observed with other mutant mouse models (Jun et al., 1999). Loss of CaSR also hyperpolarized the neocortical neurons (Figure 1I) and this may have been due to decreased function of depolarizing components or stimulation of hyperpolarizing elements. There are a number of candidate channels and pumps that have been shown to regulate the RMP in cortical neurons (Tavalin et al., 1997; Talley et al., 2001; Bean, 2007; Harnett et al., 2015; Hu and Bean, 2018). The changes in VGSC gating and RMP in Casr-/- neurons may be attributable to homeostatic mechanisms that compensate for perturbations in network activity and have been observed in central and peripheral neurons (Turrigiano, 2008).

Overall, our studies indicate that divalent-dependent excitability in neurons is largely attributable to actions of extracellular calcium on the VGSC function. Given the dynamic nature of brain extracellular calcium, this mechanism is likely to impact neuronal signaling greatly under physiological and pathological conditions. CaSR-dependent reduction of VGSC sensitivity to membrane potential adds further complexity to extracellular calcium signaling and identifies another potential mechanism by which CaSR stimulation may influence neuronal death following stroke and traumatic brain injury (Kim et al., 2013; Hannan et al., 2018).

Materials and methods

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (M. musculus)CasrGenBankCasr
Strain, strain background (M. musculus)Mouse wild-type strain C57BL/6J × 129×1The Jackson LaboratoryRRID:MGI:5652742
Genetic reagent, strain background (M. musculus)Mouse expressing Nestin-cre mutationThe Jackson Laboratory as used in Sun et al., 2018Stock No. 003771C57/BL6J and 129S4 background strain
Genetic reagent, strain background (M. musculus)Mouse with Lox mutation to delete exon 7 of CasrLaboratory of Dr. Wenhan Chang, UCSF
(Chang et al., 2008)
Casrfl/flC57/BL6J and 129S4 background strain
Sequence-based reagentCasrApplied BiosystemsMm00443377_m1Quantitative PCR Mouse probe set
Sequence-based reagentActbApplied BiosystemsMm04394036_g1Quantitative PCR Mouse probe set
Sequence-based reagentNes-Cre1 primerIDTGCAAAACAGGCTCTAGCGTTCG
Sequence-based reagentNes-Cre2 primerIDTCTGTTTCACTATCCAGGTTACGG
Sequence-based reagentP3U primerIDTTGTGACGGAAAACATACTGC
Sequence-based reagentLox R primerIDTGCGTTTTTAGAGGGAAGCAG

Genotyping and CaSR mutant mice

Request a detailed protocol

ConWT animals were obtained from an established colony consisting of a stable strain of C57BL/6J and 129 × 1 mice. The Casr-/- mice were generated by breeding floxed Casr (Chang et al., 2008) and nestin Cre mice (B6.Cg-Tg (Nes-cre)1Kln/J, The Jackson Laboratory) as described previously (Sun et al., 2018). The lox sites were positioned to delete Casr exon seven which resulted in the loss of Casr expression (Chang et al., 2008) and the nestin promoter was designed to ensure floxing occurred in neuronal and glial precursors. The NesCre mice were generated by crossing mice that did not contain the flox Casr mutation but did express the nestin Cre mutation. The Casr-/- and NesCre mice were all generated using a background C57BL/6J and 129S4 strain. Tail DNA extraction was performed using the Hot Shot Technique with a 1–2 hr boil (Montero-Pau et al., 2008). The presence or absence of the flox Casr mutation and Cre mutation were confirmed by PCR for each mouse. MoPrimers used for cre PCR were: Nes-cre1: GCAAAACAGGCTCTAGCGTTCG, Nes-cre2: CTGTTTCACTATCCAGGTTACGG; run on a 1% agarose gel. Primers for lox PCR were: P3U: TGTGACGGAAAACATACTGC, Lox R: GCGTTTTTAGAGGGAAGCAG; run on a 1.5% agarose gel (Chang et al., 2008). Successful deletion of Casr in the neocortical cultures was confirmed by measuring mRNA expression levels with the QuantStudio12K Flex Real-time PCR System (Applied Biosystems) and the TaqMan mouse probe set to Casr (Mm00443377_m1) with ActB (Mm04394036_g1) as the endogenous control (Figure 1—figure supplement 1). The paper describes experiments comparing the effects of CaSR deletion using the Casr-/- mice. After confirming that conWT and NesCre neurons responded similarly to changing external divalents (Figure 1A–D) we used NesCre neurons and Casr-/- neurons to examine if Casr was responsible for the sensitivity to extracellular divalents. This comparison avoided possible confounding cre-dependent effects (Qiu et al., 2011). In later experiments, we used conventional WT to ensure that our measurements of the relative size of the effect of VGSC and NALCN were not impacted by cre-dependent effects (Qiu et al., 2011).

Neuronal cell culture

Request a detailed protocol

Neocortical neurons were isolated from postnatal day 1–2 mouse pups of either sex as described previously (Phillips et al., 2008). All animal procedures were approved by V.A. Portland Health Care System Institutional Animal Care and Use Committee in accordance with the U.S. Public Health Service Policy on Humane Care and Use of Laboratory Animals and the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The active protocols covering this work are 4254–19 and 4359–20. Animals were decapitated following induction of general anesthesia with isoflurane and then the cerebral cortices were removed. Cortices were incubated in trypsin and DNase and then dissociated with a heat polished pipette. Dissociated cells were cultured in MEM plus 5% FBS on glass coverslips. Cytosine arabinoside (4 µM) was added 48 hr after plating to limit glial division. Cells were used, unless otherwise stated after ≥14 days in culture.

Electrophysiological recordings

Request a detailed protocol

Cells were visualized with a Zeiss IM 35 inverted microscope. Whole-cell voltage-and current-clamp recordings were made from cultured neocortical neurons using a HEKA EPC10 amplifier. Except where stated in the text, extracellular Tyrodes solution contained (mM) 150 NaCl, 4 KCl, 10 HEPES, 10 glucose, 1.1 MgCl2, 1.1 CaCl2, pH 7.35 with NaOH. Calcium and magnesium concentrations were modified as described in the Figure legends. The CaSR and surface charge screening are both sensitive to Ca2+ and Mg2+ with Ca2+ being two to three times more effective in both processes (Frankenhaeuser and Hodgkin, 1957; Brown et al., 1993). We modified the divalent concentrations simultaneously to utilize a greater fraction of the dynamic range of the phenomenon under study and to avoid irreversible changes that can occur in Ca2+-free solutions (Frankenhaeuser and Hodgkin, 1957). Synaptic transmission was blocked by the addition of (in µM) 10 CNQX, 10 Gabazine, and 50 APV to the bath solution. Most recordings were made using a potassium gluconate intracellular solution containing (mM) 135 K-gluconate, 10 HEPES, 4 MgCl2, 4 NaATP, 0.3 NaGTP, 10 phosphocreatine disodium, pH 7.2 with KOH hydroxide. In nucleated patch experiments, the pipette solution contained (in mM) 113 Cesium methane sulfonate, 1.8 EGTA, 10 HEPES, 4 MgCl2, 0.2 CaCl2, 4 NaATP, 0.3 NaGTP, 14 phosphocreatine disodium, pH 7.2 with TEA hydroxide. Electrodes used for recording had resistances ranging from 2 to 7 MΩ. Voltages have been corrected for calculated liquid junction potentials (JPCalc, Professor P. H. Barry) and were 14 or 15 mV for all recordings. All experiments were performed at room temperature (21–23°C).

Data acquisition and analysis

Request a detailed protocol

Whole-cell voltage-and current-clamp recordings were made using a HEKA EPC10 USB amplifier, filtered at 2.9 kHz using a Bessel filter, and sampled at 20 kHz during injection protocols and 10 kHz during continuous acquisition. Analysis was performed using Igor Pro (Wavemetrics, Lake Oswego, OR) and Minianalysis (Synaptosoft). Data values are reported as mean ± SEM. Statistical tests were performed using GraphPad Prism (6) and p-values<0.05, 0.01, 0.001, and 0.0001 were indicate with *, **, ***, and ****. All post-hoc tests were Sidak compensated for multiple comparisons. Data were log-transformed to improve normalization in Figure 2D. To ensure non-zero values, minimize bias, and allow logarithmic transformation, each action potential frequency measurement was increased by 0.02 as the duration of the T1.1 recording at −70 mV was 50 s.

Solution application

Request a detailed protocol

Solutions were applied by gravity from a glass capillary (1.2 mm outer diameter) placed ~1 mm from the neuron under study. Solutions were switched manually using a low dead volume manifold upstream of the glass capillary. CNQX and Gabazine were supplied by Abcam. KB-R7943 Mesylate was supplied by Tocris. Creatine Phosphate was supplied by Santa Cruz Biotech. Cinacalcet was supplied by Toronto Research Chemicals and Tetrodotoxin by Alomone Other reagents were obtained from Sigma-Aldrich.

Data availability

All data generated are in the manuscript and supporting files. Source provided for Figures 1, 2, and 6 in the manuscript.

References

  1. Book
    1. Hille B
    (2001)
    Ion Channels of Excitable Membranes (Third Edition)
    Sunderland, Mass: Sinauer. ISBN 978-0-87893-321-1.

Decision letter

  1. Yukiko Goda
    Reviewing Editor; RIKEN, Japan
  2. Kenton J Swartz
    Senior Editor; National Institute of Neurological Disorders and Stroke, National Institutes of Health, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This manuscript presents some interesting and important results about how reduction of external divalent ions enhances the intrinsic excitability of cortical neurons. The authors test the idea that the effect of reducing external calcium to increase neuronal excitability is due to enhancement of sodium leak channel (NALCN) current via a pathway initiated by calcium-sensing receptor (CaSR), a G-protein-coupled receptor. The authors conclude that in cultured cortical neurons, the major effects of reducing divalent ions on excitability are not mediated by CaSR-mediated changes in NALCN current but rather by altered voltage-dependence of voltage-dependent sodium current. While contrary to expectations, these key conclusions are nonetheless in agreement with the classical view. A better understanding of how neuronal excitability is affected by changes in extracellular calcium is crucial given that large changes in extracellular calcium are thought to drive circuit and behavioral changes under pathological conditions.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "CaSR modulates sodium channel-mediated Ca2+-dependent excitability" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Kenton Swartz as Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Stephen Williams (Reviewer #3).

Our decision has been reached after consultation between the reviewers.

The reviewers have agreed that the study addresses an important question and that the findings are potentially interesting. Nevertheless, several major issues remain, in particular the potential developmental effects of the lack of expression of CaSR, voltage-clamp analysis being performed in very young neurons, as well as a lack of confirmation of the knock-out of CaSR protein.

Based on the discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife, at least for the present submission. However, provided that the major concerns of the reviewers could be fully addressed involving additional experiments, we encourage resubmission of the revised manuscript.

Reviewer #1:

This study re-examines the contribution of sodium leak channel (NALCN) downstream to the activation of calcium sensing receptor (CaSR) and the UNC79-UNC80 complex in regulating extracellular calcium-dependence of membrane excitability. Recording from cultured neocortical neurons, contrary to the previously reported role for CaSR in hippocampal neurons, the authors find that robust extracellular calcium-dependent changes in excitability remains in CaSR knockout neurons specifically after correcting for the hyperpolarized membrane potential in CaSR KO neurons. Moreover, a switch to bath solution containing reduced divalents depolarizes both WT and Casr-/- neurons, where VGSC gating is shifted. Interestingly, the shift in VGSC gating observed in Casr-/- neurons is not accompanied by changes in NALCN sensitivity to extracellular calcium. It is concluded that extracellular calcium-dependence of membrane excitability is largely attributed to changes in VGSC gating rather than being mediated via NALCN through CaSR. While the topic is important, the study touches on a controversial mechanism. Therefore, to deliver a compelling conclusion, there are a number of issues that require careful consideration.

1. One should directly confirm by immunostaining or western blots that the expression of CaSR protein is actually lost in Casr-/- neurons used for recordings.

2. Figure 3. While it is appreciated that the voltage clamp is difficult in older neurons, it is highly questionable that the expression of channels and regulatory proteins of relevance are comparable between DIV 2-3 neurons vs. DIV 14-28 neurons. Although not definitive, at the least, the authors should provide experimental support for similar levels of protein expression of VGSC, CaSR, NALCN and VGPC in cortical neurons at two different culture time points.

3. Figure 3A. Representative traces for creCasr-/- cells should be shown also.

4. Figure 5. By what basis control WT neurons used here are not those expressing Cre that have been used in the previous figures? Figure 1A-C suggests that the expression of Cre may cause subtle non-specific effects. Thus the interchangeable use of conWT and creWT is a source of concern.

5. Figure 5A-D. It would be informative to reverse the order of addition of VGSC and NALCN blockers – Gd3+ first, followed by TTX, to confirm that the minimal contribution of NALCN to extracellular Ca-dependent depolarization is not dependent on prior blockade of VGSC.

6. Figure 5F, G. It is difficult to discriminate the data between different groups as shown.

7. Figure 6. Which WT neurons were used as controls here?

Reviewer #2:

This paper describes that changing the extracellular Ca modulates activation of Ca-sensing receptors (CaSRs) and changes the voltage-dependence of voltage gated Na channels. This is in contrast to the previous postulate that Ca-sensing receptors modulate leak currents. The results are interesting and important, but there are several issues in this study. Also, the papers are a bit difficult to read, because of the way of presentation.

1. Although there is an effect of the CaSR KO neurons, the effect of extracellular Ca itself on Na channel activation seems more drastic. Is it possible that the surface charge screening effects are more dominant?

2. Although voltage clamp of Na channels is difficult, some of the traces (Figure 5) seem to indicate that voltage clamp is not sufficient. Is it possible to use TTX to reduce the current amplitudes and improve the clamp for Figure 3?

3. I do not see the difference between WT and CaSR KO in Figure 1A, which seems to suggest that CaSRs are not really important for the excitability. Perhaps, show the individual data in Figure 1D?

4. Intracellular mechanisms connecting between CaSRs and Na channels are unclear.

5. Overall there are many superimposed traces in the figures, which makes me difficult to understand (Figure 5, for example). Also, it is helpful if the authors draw some scheme at the end of the paper for readability.

Reviewer #3:

This well written manuscripts describes electrophysiological recordings from cultured neocortical neurons to examine in control and knockout animals (Casr -/-) the mechanism(s) underlying the augmentation of action potential firing rate by altering the extracellular cation concentration. The topic is of general interest. The manuscript supplies novel and interesting new data. Methodologically the approach taken by the authors is generally sound. The conclusions that the authors make from their data also is logical and justified. I was particularly taken by the observation that the sodium window current plays a significant role in the enhancement of action potential firing. Judging the first two figures of the paper, there seems to be striking differences in the waveforms of action potentials recorded from Casr positive and negative neurons. Do the authors have an explanation for this, does for example Casr influence the developmental trajectory of neurons in culture, in terms of maturation of the expression of voltage gated ion channels? I think the manuscript would benefit from analysis that indicates at given stages of culture that current densities are equivalent etc, which would allow clearer comments to be made by the authors. My main problem with the work lies in the voltage-clamp analysis. The authors indicate in mature cultures that inward currents cannot be voltage-controlled. They therefore turn to analysis of neurons that have been cultured for only a few days. I am not sure that this is the right thing to do – as alluded to above. I would suggest that the authors consider employing recording approaches, such as nucleated patch, that would allow near perfect voltage control. This would allow analysis at the same developmental stage, and also if made from various ages in culture the charting of the developmental profile.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "CaSR modulates sodium channel-mediated Ca2+ -dependent excitability" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Kenton Swartz as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential Revisions:

As indicated in the public comments, the authors need to systematically reword the presentation, starting with the title, to reflect the fact that all their experiments examined effects of reducing both Ca and Mg, and it is therefore incorrect to state the changes reflect "[Ca2+]-dependent" effects as is done throughout. There were also many places where the wording (and sometimes the order of presentation) seemed unnecessarily convoluted, which made it difficult to understand exactly what the authors meant by a particular sentence. The data in the paper are very interesting and the ability of the reader to digest the results and their meaning would be improved if the presentation were clearer in some places.

Following points in particular require careful consideration:

Title: "CaSR modulates sodium channel-mediated Ca2+-dependent excitability". The title is misleading in two ways. First, the main point of the paper is that the most important effects of reducing divalents are NOT mediated by CaSR receptors. Whatever effects on excitability are seen in the CaSR-/- neurons probably reflect homeostatic changes rather than direct function of CaSR receptors, so even the statement that CaSR might "modulate" effects is questionable. In any case, such modulation is a very much secondary point of the paper, not the main one. Second, as already pointed out, the authors looked at changes in response to changing both Ca and Mg and can't say any of the key phenomena examined in the paper are "Ca2+-dependent". Something like "Enhanced excitability of cultured cortical neurons in low-divalent solutions is mediated mainly by altered voltage-dependence of voltage-dependent sodium channels" would better capture the content and conclusions of the paper.

Abstract: Abstract was not understandable until after reading the paper. The authors summarize the key results as follows " Here we report that action potential (AP) firing rates increased in wild-type (WT), but not CaSR null mutant (Casr-/-) neocortical neurons, following the switch from physiological to reduced Ca 2+-containing Tyrode. However, after membrane potential correction, action potential firing increased similarly in both genotypes inconsistent with CaSR regulation of NALCN." It was completely unclear whether the authors were saying that reduction of calcium did or did not enhance excitability in the CaSR-/- cells, the central question of the paper. The first sentence says "no" and the second sentence says "yes", but only after a "membrane potential correction" that is completely undefined. It is also completely unclear until after reading the paper that "action potential firing" refers to spontaneous firing at the resting potential. As it turns out, a clearer description of the results would be something along the lines of: "CaSR-/- neurons had more negative resting potentials than control neurons and unlike control neurons did not fire spontaneously either in normal or reduced calcium solutions. However action potential firing in response to depolarizing current injections was enhanced in CaSR-/- neurons by reduction of divalent cations to a similar degree as in control neurons."

p. 3 "Classical studies proposed that the mechanism underlying [Ca2+]o-dependent excitability centers on voltage-gated sodium channel (VGSC) sensitivity to extracellular Ca2+. External Ca2+ was proposed to interact with local negative charges on the extracellular face of the membrane or ion channels thereby increasing the potential field experienced by VGSCs and reducing the likelihood of VGSC activation at the resting membrane potential (Frankenhaeuser and Hodgkin, 1957; Hille, 1968)". Frankenhaeuser and Hodgkin only looked at shifts of Na channel gating in voltage clamp experiments and did not report firing of the cells at the resting potential, as the reader might conclude from this. In fact in their discussion they conclude because of the shift in inactivation, axons in low Ca would be inexcitable. A more accurate summary might be something like "Reduced external Ca2+ was proposed to shift the effective voltage-dependent gating of the sodium conductance in the hyperpolarizing direction by reducing the screening of local negative charges on the extracellular face of the membrane by external Ca2+ (Frankenhaeuser and Hodgkin, 1957; Hille, 1968)".

p. 11: "[Ca2+]o reduction and CaSR hyperpolarized this region of overlap towards the RMP (Figure 3 F,G insets) increasing the likelihood that persistent VGSC currents were activated at resting membrane potential and therefore contributing to [Ca2+]o-dependent excitability."

The rationale for saying that [Ca2+]o reduction (or really divalent reduction) hyperpolarized the region of overlap is clear. However, the rationale connecting the experimental results with saying that "CaSR hyperpolarized the region of overlap" is very vague.

p. 14 paragraph heading "VGSCs are the dominant contributor to [Ca2+]o-dependent excitability". This statement seems almost meaningless. There is no excitability of any kind without VGSCs. The meaning of "[Ca2+]o-dependent excitability" here (and it is used many other times) is not clear. Perhaps the authors mean "changes in excitability produced by changes in divalent concentrations". In any case, the paragraphs to follow are focused mainly on how changes in resting potential are mediated, not really on excitability. So the meaning is something like "Changes in resting potential resulting from lowered divalents are mediated mainly by VGSCs".

p. 16: "We have investigated the mechanisms underlying [Ca2+]o-dependent changes in intrinsic neuronal excitability and tested if CaSR is transducing decreases in [Ca2+]o into NALCN-mediated depolarizations to trigger action potentials (Lu et al., 2010; Philippart and Khaliq, 2018). We found no evidence that this specific mechanism was active in neocortical neurons (Figure 2)."

Nothing in the Philippart and Khaliq paper examined whether or not CaSRs were involved in control of NALCN by divalents. Their paper concerned a completely different regulation of NALCN current by GABAB and dopamine receptors.

p. 16 "CaSR also indirectly affected action potential generation by modestly depolarizing the membrane potential (Figure 1)." The authors have no evidence that stimulating CaSRs depolarizes the resting potential. What they mean is that CaSR-/- neurons have hyperpolarized resting potentials compared to WT neurons. They have no evidence of whether this reflects a loss of a normal depolarizing effect of CaSR stimulation or a homeostatic effect of development of the neurons without CaSRs.

p. 21 "Voltages have been corrected for liquid junction potentials." The value used for the corrections should be given, as the exact membrane potentials are quite important for the effects that are shown (especially the firing at the resting potential).

The switch from the use of CreWT to ControlWT lacking the expression of Cre recombinase still remains to be justified. The authors reason that the switch has been made to ControlWT given that they have shown that calcium-dependence of excitability is not mediated by CaSR-modulation of NALCN but by VGSC, and also in order to avoid any confounds presented by the exogenous expression of Cre. Nevertheless, the logic is not clear. The conclusion of the apparent lack of contribution of CaSR-modulation of NALCN has been reached by the use of Cre expressing neurons. The authors should explicitly state whether or not there were any differences in the electrophysiological properties of conWT and creWT neurons and if so, explain what they are, perhaps in the methods.

There were many typos in the paper.

Throughout the text, there seemed to be a global replacement of "T1.1" by a space, which made a lot of sentences hard to read. For example, p. 12 " Switching to plus TTX produced minimal change in the basal current on average (Figure 5C). However, in some neurons elicited an outward current (Figure 5A,C) whereas in others there was an inward current (Figure 5B,C)…" It is assumed that there are two missing "T1.1"'s.

p.11 D,E). The reduction in [Ca2+]o (F (1, 18) = 56, P < 0.0001) left- shifted V0.5 (2-way RM ANOVA,

https://doi.org/10.7554/eLife.67914.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1:

1. One should directly confirm by immunostaining or western blots that the expression of CaSR protein is actually lost in Casr-/- neurons used for recordings.

We have used quantitative RT PCR to determine expression levels of the Casr in wild-type (conventional and cre expressing) and Casr-/- cultured neocortical neurons. We examined expression levels in 6 different cultures (in triplicate) for each of the 3 genotypes. We used actin expression as a positive control. Our data (Figure 1 Supplementary figure) show ≥98% reduction in Casr expression which confirms other studies that used thisknockout mouse and nestin cre-recombinase to delete Casr in neurons. reduction in Casr expression which confirms other studies that used this knockout mouse and nestin cre-recombinase to delete Casr in neurons.

2. Figure 3. While it is appreciated that the voltage clamp is difficult in older neurons, it is highly questionable that the expression of channels and regulatory proteins of relevance are comparable between DIV 2-3 neurons vs. DIV 14-28 neurons. Although not definitive, at the least, the authors should provide experimental support for similar levels of protein expression of VGSC, CaSR, NALCN and VGPC in cortical neurons at two different culture time points.

Two referees pointed out that developmental changes in VGSC could have confounded previous voltage clamp experiments. We addressed this problem using nucleated patches (Figure 3) from neurons of the same age used in other parts of the manuscript. We also confirmed that the voltage dependence (V0.5) of VGSC activation and inactivation was stable over the time range of our experiments.

3. Figure 3A. Representative traces for creCasr-/- cells should be shown also.

This figure now replaced with nucleated patch experiments and representative traces added for Casr-/- cells.

We have added these representative traces.

4. Figure 5. By what basis control WT neurons used here are not those expressing Cre that have been used in the previous figures? Figure 1A-C suggests that the expression of Cre may cause subtle non-specific effects. Thus the interchangeable use of conWT and creWT is a source of concern.

Our main hypothesis was that CaSR regulates NALCN and thereby impact calcium dependent excitability. Studies shown in Figures 1-3 indicated that calcium dependence of excitability was not mediated by CaSR-modulation of NALCN, but rather via VGSCs. Once we had addressed the impact of CaSR (after Figure 4) we switched back to using a regular WT to avoid any possible confounding due to the presence of cre. We have added mention of this to the manuscript (P. 12) to underline this point.

CaSR did shift VGSC gating in Figure 3 and this partially accounted for the different excitability of creWT and cre-Casr-/- neurons in experiments examining what happens at the resting membrane potential. Since the RMP in Casr-/- neurons was more negative this also contributed to the observed difference in excitability between genotypes. This effect was absent once the membrane potential was slightly offset to -70 mV to reduce the likelihood of RMP confounding the result. The experiments described in Figures 5 and 6 were performed to examine the relative contribution of VGSC and NALCN. We expected to see a contribution by NALCN that was independent of CaSR and chose the conventional WT as we hoped to avoid the small potential confounder that the cre mutation was interfering with calcium-dependent excitability. The Casr-/- experiments were performed because we were surprised (because of the work by the Ren Lab) to see no obvious sign of NALCN contributing in the WT neurons and hoped to find some explanation here. I have modified Figure 5 in attempt to make the rationale for the experimental design more clear. The Casr-/- data has been extracted and placed in a supplementary figure.

5. Figure 5A-D. It would be informative to reverse the order of addition of VGSC and NALCN blockers – Gd3+ first, followed by TTX, to confirm that the minimal contribution of NALCN to extracellular Ca-dependent depolarization is not dependent on prior blockade of VGSC.

The careful work by others demonstrating NALCN does not possess the TTX binding site and the demonstrations that TTX is ineffective against NALCN in expression systems (Lu et al., 2007; Swayne et al., 2009) reassures that the small action of Gd3+ in the presence of TTX is unlikely to be an artefact due to a non-selective action of TTX. Unfortunately, Gd3+ blocks VGSCs and so the application of Gd3+ alone is expected to block both VGSCs and NALCN. We have edited the manuscript to make this clear (P. 12, Since NALCN is resistant to the VGSC blocker tetrodotoxin (TTX) (Lu et al., 2007; Swayne et al., 2009) but Gd3+ (10 µM) inhibits NALCN and VGSCs (Elinder and Arhem, 1994; Li and Baumgarten, 2001; Lu et al., 2009)). However, we also performed the requested experiments to check if Gd3+ was selective under our experimental conditions. Using a similar experimental design to that in Figure 5, Gd3+ application inhibited the baseline [Ca2+ ]o-dependent current by a substantial amount if it was applied in the absence of TTX . Gd3+ also reversibly reduced the probability of VGSC activation. Given the valence of Gd3+ and the sensitivity of VGSC to charged particles this is unsurprising.

6. Figure 5F, G. It is difficult to discriminate the data between different groups as shown.

Apologies. The figure has been redrawn to improve clarity.

7. Figure 6. Which WT neurons were used as controls here?

For the reasons given above (question 4) we used the conventional WT.

Reviewer #2:

This paper describes that changing the extracellular Ca modulates activation of Ca-sensing receptors (CaSRs) and changes the voltage-dependence of voltage gated Na channels. This is in contrast to the previous postulate that Ca-sensing receptors modulate leak currents. The results are interesting and important, but there are several issues in this study. Also, the papers are a bit difficult to read, because of the way of presentation.

1. Although there is an effect of the CaSR KO neurons, the effect of extracellular Ca itself on Na channel activation seems more drastic. Is it possible that the surface charge screening effects are more dominant?

We agree that the effect on VGSC is the dominant one and modified the manuscript to ensure this is clearer.

2. Although voltage clamp of Na channels is difficult, some of the traces (Figure 5) seem to indicate that voltage clamp is not sufficient. Is it possible to use TTX to reduce the current amplitudes and improve the clamp for Figure 3?

The currents were already very small but we have used nucleated patches to address reviewers’ concerns about the VGSC currents (Figure 3).

3. I do not see the difference between WT and CaSR KO in Figure 1A, which seems to suggest that CaSRs are not really important for the excitability. Perhaps, show the individual data in Figure 1D?

In Figure 1A the number of action potentials in T0.2 is reduced by severalfold in the CaSR KO (red) middle row compared to the two wild types (black and blue). This is emphasized in 1B where the average responses of individual neurons is shown as well as the grand means. This is consistent with the initial hypothesis. However, once adjustments were made for RMP the differences dissipated (Figure 2). In Figure 3 we show a difference in the properties of VGSC currents that indicates one way in which CaSR deletion impacts the calcium sensitivity of VGSCs. The RMP is the other change dependent on CaSR that impacts calcium dependent excitability.

4. Intracellular mechanisms connecting between CaSRs and Na channels are unclear.

We have not yet addressed how CaSR affects VGSC properties experimentally but hope to address this going forwards. I have rewritten the MS to make this clear.

5. Overall there are many superimposed traces in the figures, which makes me difficult to understand (Figure 5, for example). Also, it is helpful if the authors draw some scheme at the end of the paper for readability.

Apologies for overlapping traces. We have expanded the panels to improve readability. I have changed the last panel of Figure 6 to demonstrate the relative size of the contributions of VGSC and NALCN to calcium dependent excitability. In addition we have expanded the discussion on how NALCN might influence excitability in other settings if it does not seem to be regulated by CaSR as hypothesized by Ren and colleagues.

Reviewer #3:

This well written manuscripts describes electrophysiological recordings from cultured neocortical neurons to examine in control and knockout animals (Casr -/-) the mechanism(s) underlying the augmentation of action potential firing rate by altering the extracellular cation concentration. The topic is of general interest. The manuscript supplies novel and interesting new data. Methodologically the approach taken by the authors is generally sound. The conclusions that the authors make from their data also is logical and justified. I was particularly taken by the observation that the sodium window current plays a significant role in the enhancement of action potential firing. Judging the first two figures of the paper, there seems to be striking differences in the waveforms of action potentials recorded from Casr positive and negative neurons. Do the authors have an explanation for this, does for example Casr influence the developmental trajectory of neurons in culture, in terms of maturation of the expression of voltage gated ion channels? I think the manuscript would benefit from analysis that indicates at given stages of culture that current densities are equivalent etc, which would allow clearer comments to be made by the authors. My main problem with the work lies in the voltage-clamp analysis. The authors indicate in mature cultures that inward currents cannot be voltage-controlled. They therefore turn to analysis of neurons that have been cultured for only a few days. I am not sure that this is the right thing to do – as alluded to above. I would suggest that the authors consider employing recording approaches, such as nucleated patch, that would allow near perfect voltage control. This would allow analysis at the same developmental stage, and also if made from various ages in culture the charting of the developmental profile.

We have performed the suggested new experiments using nucleated patches from neurons after >14 days in culture (Figure 3). These experiments address the concerns about VGSC currents being examined in neurons of different ages to those examined in other parts of the manuscript.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential Revisions:

As indicated in the public comments, the authors need to systematically reword the presentation, starting with the title, to reflect the fact that all their experiments examined effects of reducing both Ca and Mg, and it is therefore incorrect to state the changes reflect "[Ca2+]-dependent" effects as is done throughout. There were also many places where the wording (and sometimes the order of presentation) seemed unnecessarily convoluted, which made it difficult to understand exactly what the authors meant by a particular sentence. The data in the paper are very interesting and the ability of the reader to digest the results and their meaning would be improved if the presentation were clearer in some places.

Following points in particular require careful consideration:

Title: "CaSR modulates sodium channel-mediated Ca2+-dependent excitability". The title is misleading in two ways. First, the main point of the paper is that the most important effects of reducing divalents are NOT mediated by CaSR receptors. Whatever effects on excitability are seen in the CaSR-/- neurons probably reflect homeostatic changes rather than direct function of CaSR receptors, so even the statement that CaSR might "modulate" effects is questionable. In any case, such modulation is a very much secondary point of the paper, not the main one. Second, as already pointed out, the authors looked at changes in response to changing both Ca and Mg and can't say any of the key phenomena examined in the paper are "Ca2+-dependent". Something like "Enhanced excitability of cultured cortical neurons in low-divalent solutions is mediated mainly by altered voltage-dependence of voltage-dependent sodium channels" would better capture the content and conclusions of the paper.

We have modified the title to better represent the papers major findings. We have used:

Enhanced excitability of cortical neurons in low-divalent solutions is primarily mediated by altered voltage-dependence of voltage-gated sodium channels

Abstract: Abstract was not understandable until after reading the paper. The authors summarize the key results as follows " Here we report that action potential (AP) firing rates increased in wild-type (WT), but not CaSR null mutant (Casr-/-) neocortical neurons, following the switch from physiological to reduced Ca 2+-containing Tyrode. However, after membrane potential correction, action potential firing increased similarly in both genotypes inconsistent with CaSR regulation of NALCN." It was completely unclear whether the authors were saying that reduction of calcium did or did not enhance excitability in the CaSR-/- cells, the central question of the paper. The first sentence says "no" and the second sentence says "yes", but only after a "membrane potential correction" that is completely undefined. It is also completely unclear until after reading the paper that "action potential firing" refers to spontaneous firing at the resting potential. As it turns out, a clearer description of the results would be something along the lines of: "CaSR-/- neurons had more negative resting potentials than control neurons and unlike control neurons did not fire spontaneously either in normal or reduced calcium solutions. However action potential firing in response to depolarizing current injections was enhanced in CaSR-/- neurons by reduction of divalent cations to a similar degree as in control neurons."

We agree that the abstract was unclear. We have adopted many of the reviewers’ suggestions and believe they have helped clarify the abstract.

p. 3 "Classical studies proposed that the mechanism underlying [Ca2+]o-dependent excitability centers on voltage-gated sodium channel (VGSC) sensitivity to extracellular Ca2+. External Ca2+ was proposed to interact with local negative charges on the extracellular face of the membrane or ion channels thereby increasing the potential field experienced by VGSCs and reducing the likelihood of VGSC activation at the resting membrane potential (Frankenhaeuser and Hodgkin, 1957; Hille, 1968)". Frankenhaeuser and Hodgkin only looked at shifts of Na channel gating in voltage clamp experiments and did not report firing of the cells at the resting potential, as the reader might conclude from this. In fact in their discussion they conclude because of the shift in inactivation, axons in low Ca would be inexcitable. A more accurate summary might be something like "Reduced external Ca2+ was proposed to shift the effective voltage-dependent gating of the sodium conductance in the hyperpolarizing direction by reducing the screening of local negative charges on the extracellular face of the membrane by external Ca2+ (Frankenhaeuser and Hodgkin, 1957; Hille, 1968)".

Our approach was taken to try and emphasize the action of calcium rather than the effect of removing calcium but we agree the reviewers’ version is clearer and have changed the text. We have attempted to clarify what we mean by excitability and have drawn on the work of Frankenhaeuser and Hodgkin. In their introduction, Frankenhaeuser and Hodgkin point out that they investigated the mechanism responsible for excitability including spontaneous firing. ”Physiologists have been interested in the action of calcium on excitable tissues since the days of Ringer (1883). Some of the main facts established (see Brink,1954) are that increasing the external calcium concentration raises the threshold, increases membrane resistance (Cole, 1949) and accelerates accommodation. Reducing the calcium concentration has the converse effects, and frequently leads to spontaneous oscillations or repetitive activity (e.g. Adrian & Gelfan, 1933; Arvanitaki, 1939).” While their approach focused on the voltage clamp method they did describe how low calcium increased excitability “Another advantage of using anodal polarization was that it stopped the fibre firing repetitively in low calcium solutions.” As far as we can determine they reported that reduced excitability was only seen after prolonged exposure to zero calcium conditions and this is generally presumed to reflect a different mechanism, “Unpublished experiments with a conventional type of internal electrode indicate that although there may be little change in resting potential, squid fibres become inexcitable in zero calcium within 5-20 min.”

p. 11: "[Ca2+]o reduction and CaSR hyperpolarized this region of overlap towards the RMP (Figure 3 F,G insets) increasing the likelihood that persistent VGSC currents were activated at resting membrane potential and therefore contributing to [Ca2+]o-dependent excitability."

The rationale for saying that [Ca2+]o reduction (or really divalent reduction) hyperpolarized the region of overlap is clear. However, the rationale connecting the experimental results with saying that "CaSR hyperpolarized the region of overlap" is very vague.

We have changed the section to improve clarity. It now says “ Divalent reduction hyperpolarized this region of overlap towards the RMP (Figure 3 F,G insets) increasing the likelihood that persistent VGSC currents were activated at resting membrane potential and therefore contributing to divalent-dependent excitability. The depolarization of VGSC activation gating that resulted from CaSR deletion (Figure 3I), shifted the area of conductance curve overlap for T0.2 in a depolarizing direction (Figure 3G).”

p. 14 paragraph heading "VGSCs are the dominant contributor to [Ca2+]o-dependent excitability". This statement seems almost meaningless. There is no excitability of any kind without VGSCs. The meaning of "[Ca2+]o-dependent excitability" here (and it is used many other times) is not clear. Perhaps the authors mean "changes in excitability produced by changes in divalent concentrations". In any case, the paragraphs to follow are focused mainly on how changes in resting potential are mediated, not really on excitability. So the meaning is something like "Changes in resting potential resulting from lowered divalents are mediated mainly by VGSCs".

I agree about the heading and have changed accordingly. We agree that we have used "[Ca2+]o-dependent excitability" to mean "changes in excitability produced by changes in divalent concentrations". We will clarify in the text.

p. 16: "We have investigated the mechanisms underlying [Ca2+]o-dependent changes in intrinsic neuronal excitability and tested if CaSR is transducing decreases in [Ca2+]o into NALCN-mediated depolarizations to trigger action potentials (Lu et al., 2010; Philippart and Khaliq, 2018). We found no evidence that this specific mechanism was active in neocortical neurons (Figure 2)."

I agree about the heading and have changed accordingly. We agree that we have used "[Ca2+]o-dependent excitability" to mean "changes in excitability produced by changes in divalent concentrations". We will clarify in the text.

Nothing in the Philippart and Khaliq paper examined whether or not CaSRs were involved in control of NALCN by divalents. Their paper concerned a completely different regulation of NALCN current by GABAB and dopamine receptors.

We agree that Philipart and Khaliq did not study CaSR regulation of NALCN and have deleted the citation.

p. 16 "CaSR also indirectly affected action potential generation by modestly depolarizing the membrane potential (Figure 1)." The authors have no evidence that stimulating CaSRs depolarizes the resting potential. What they mean is that CaSR-/- neurons have hyperpolarized resting potentials compared to WT neurons. They have no evidence of whether this reflects a loss of a normal depolarizing effect of CaSR stimulation or a homeostatic effect of development of the neurons without CaSRs.

We agree and have modified the text accordingly.

p. 21 "Voltages have been corrected for liquid junction potentials." The value used for the corrections should be given, as the exact membrane potentials are quite important for the effects that are shown (especially the firing at the resting potential).

The switch from the use of CreWT to ControlWT lacking the expression of Cre recombinase still remains to be justified. The authors reason that the switch has been made to ControlWT given that they have shown that calcium-dependence of excitability is not mediated by CaSR-modulation of NALCN but by VGSC, and also in order to avoid any confounds presented by the exogenous expression of Cre. Nevertheless, the logic is not clear. The conclusion of the apparent lack of contribution of CaSR-modulation of NALCN has been reached by the use of Cre expressing neurons. The authors should explicitly state whether or not there were any differences in the electrophysiological properties of conWT and creWT neurons and if so, explain what they are, perhaps in the methods.

We have addressed the rationale for use of WT and added it to the methods section as suggested. We did not identify any differences in the electrophysiological properties of conWT and creWT neurons. In Figure 1 A-D we showed that the basal firing rates of the con WT and creWT responded the same to reduced divalent concentrations. We opted to use the creWT and Casr-/- neurons to examine if Casr was responsible for the sensitivity to extracellular divalents. Deletion of Casr changed sensitivity to divalents because of its impact on RMP and VGSC activation (V0.5). This comparison avoided possible confounding due to cre. Since we had determined that CaSR did not regulate NALCN and that the changes in excitability produced by changes in divalent concentrations were the same in cre and conWT neurons we switched back to conventional neurons. The new question we addressed was, what is the relative contribution of NALCN and VGSC to the depolarizations that occurred after switching to T0.2 and caused increased action potential firing? Since this question did not include the CaSR we used the conventional WT to ensure the results were generalizable. Our findings that VGSC currents mediated the majority of the changes in basal current and membrane potential following decreases in divalent concentrations means that even if CaSR had regulated NALCN, as hypothesized by Lu et al., the relative size of the effect would have been quite modest.

We were very surprised that most of the divalent mediated depolarization was sensitive to TTX in these WT neurons which also indicates NALCN is not having a substantial role in the mediation of the divalent dependent depolarization. The Casr-/- neurons are very similar as shown in the supplementary figures.

There were many typos in the paper.

Throughout the text, there seemed to be a global replacement of "T1.1" by a space, which made a lot of sentences hard to read. For example, p. 12 " Switching to plus TTX produced minimal change in the basal current on average (Figure 5C). However, in some neurons elicited an outward current (Figure 5A,C) whereas in others there was an inward current (Figure 5B,C)…" It is assumed that there are two missing "T1.1"'s.

p.11 D,E). The reduction in [Ca2+]o (F (1, 18) = 56, P < 0.0001) left- shifted V0.5 (2-way RM ANOVA,

We have corrected the typos and apologize for our error in replacing T1.1 with space.

https://doi.org/10.7554/eLife.67914.sa2

Article and author information

Author details

  1. Briana J Martiszus

    1. Section of Pulmonary & Critical Care Medicine, VA Portland Health Care System, Portland, United States
    2. Department of Medicine, Division of Pulmonary & Critical Care Medicine, Oregon Health & Science University, Portland, United States
    Contribution
    Formal analysis, Investigation, Writing - original draft
    Competing interests
    No competing interests declared
  2. Timur Tsintsadze

    1. Section of Pulmonary & Critical Care Medicine, VA Portland Health Care System, Portland, United States
    2. Department of Medicine, Division of Pulmonary & Critical Care Medicine, Oregon Health & Science University, Portland, United States
    Contribution
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
  3. Wenhan Chang

    Endocrine Research Unit, Veterans Affairs Medical Center and University of California, San Francisco, San Francisco, United States
    Contribution
    Resources, Methodology
    Competing interests
    No competing interests declared
  4. Stephen M Smith

    1. Section of Pulmonary & Critical Care Medicine, VA Portland Health Care System, Portland, United States
    2. Department of Medicine, Division of Pulmonary & Critical Care Medicine, Oregon Health & Science University, Portland, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Methodology, Project administration, Writing - review and editing
    For correspondence
    smisteph@ohsu.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0331-7615

Funding

U.S. Department of Veterans Affairs (BX002547)

  • Stephen M Smith

National Institute of General Medical Sciences (GM134110)

  • Stephen M Smith

U.S. Department of Veterans Affairs (IK6BX004835)

  • Wenhan Chang

U.S. Department of Veterans Affairs (BX003453)

  • Wenhan Chang

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work was supported by grants awarded by U.S. Department of Veterans Affairs (BX002547) and NIGMS (GM134110) to SMS. We thank Dr Wenyan Chen for performing the experiments on potassium channel currents and Dr Glynis Mattheisen, Dr Brian Jones, Ms Natasha Baas-Thomas, and Ms Maya Feldthouse for helpful discussion and comments on the manuscript. Thanks to Drs Chris Harrington and Brittany Daughtry of the OHSU Gene Profiling Shared Resource who performed RNA isolation, quality assessments, and qPCR assays. The authors declare no competing financial interests. The contents do not represent the views of the U.S. Department of Veterans Affairs or the United States Government.

Ethics

Animal experimentation: All animal procedures were approved by V.A. Portland Health Care System Institutional Animal Care and Use Committee in accordance with the U.S. Public Health Service Policy on Humane Care and Use of Laboratory Animals and the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The active protocols covering this work are 4254-19 and 4359-20.

Senior Editor

  1. Kenton J Swartz, National Institute of Neurological Disorders and Stroke, National Institutes of Health, United States

Reviewing Editor

  1. Yukiko Goda, RIKEN, Japan

Publication history

  1. Received: February 26, 2021
  2. Accepted: May 10, 2021
  3. Accepted Manuscript published: May 11, 2021 (version 1)
  4. Version of Record published: May 28, 2021 (version 2)

Copyright

This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

Metrics

  • 764
    Page views
  • 133
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Neuroscience
    Jormay Lim et al.
    Research Article

    CNS neurons have no sensory function, protected by the skull. For this reason, brain neuromodulation by ultrasound were either done at a high intensity or through auditory nerves. We demonstrate in this study CNS neurons react to ultrasound stimulation at an intensity (5 mW/cm2) far lower than typical therapeutic ultrasound (>30 mW/cm2). Using micropipette ultrasound in calcium imaging, we show ASIC1a channels play a role in the reactions of CNS neurons to ultrasound, pointing to the molecular basis for direct ultrasound neuromodulation at low intensity. Furthermore, we also show evidence of neurogenesis with the same ultrasound stimulation, suggesting potential therapeutic translation.

    1. Neuroscience
    Eric L Denovellis et al.
    Research Article

    Representations related to past experiences play a critical role in memory and decision-making processes. The rat hippocampus expresses these types of representations during sharp-wave ripple (SWR) events, and previous work identified a minority of SWRs that contain ‘replay’ of spatial trajectories at ∼20x the movement speed of the animal. Efforts to understand replay typically make multiple assumptions about which events to examine and what sorts of representations constitute replay. We therefore lack a clear understanding of both the prevalence and the range of representational dynamics associated with replay. Here, we develop a state space model that uses a combination of movement dynamics of different speeds to capture the spatial content and time evolution of replay during SWRs. Using this model, we find that the large majority of replay events contain spatially coherent, interpretable content. Furthermore, many events progress at real-world, rather than accelerated, movement speeds, consistent with actual experiences.