Figures and data in LIN37-DREAM prevents DNA end resection and homologous recombination at DNA double-strand breaks in quiescent cells

Figures
Tables
Additional files

7 figures, 1 table and 7 additional files

Figures

Figure 1

Download asset Open asset

An unbiased genome-scale gRNA screen for novel DNA end protection factors.

(A) Flow cytometric analysis of chromatin-bound RPA before and after IR of non-cycling *Lig4⁻*^/− and *Lig4⁻*^/−:*Trp53bp1⁻*^/− abl pre-B cells. (B) Flow cytometric analysis of FLAG-Cas9 in *Lig4⁻*^/− cells with (+dox) and without (−dox) doxycycline to induce expression of FLAG-Cas9. (C) Schematic diagram of the genome-scale guide RNA screen for genes preventing DNA end resection in non-cycling *Lig4⁻*^/− abl pre-B cells. (D) Enrichment score (fold enrichment) of individual gRNAs to a subset of genes identified in the RPA high population. gRNA, guide RNA; IR, ionizing radiation.

Figure 1—source data 1 RPA screen result in non-cycling Lig4⁻^/− abl pre-B cells.: https://cdn.elifesciences.org/articles/68466/elife-68466-fig1-data1-v1.xlsx
Download elife-68466-fig1-data1-v1.xlsx

Figure 2 with 1 supplement

Download asset Open asset

Non-cycling LIN37-deficient cells accumulate chromatin-bound RPA after IR-induced damage.

(A) Western blot analysis of indicated proteins in *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. (B) Flow cytometric analysis of chromatin-bound RPA (top) and γH2AX (bottom) before and after IR of non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. The experiments were repeated in two independently generated cell lines at least twice. (C) Western blot analysis of RPA32 and phosphorylated RPA 32 (pRPA32(S4/S8)) of non-cycling *Lig4⁻*^/−, *Lig4^−/−:Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells treated without or with IR after indicated times. (D) Flow cytometric analysis of cycling and non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells for BrdU incorporation and DNA content (7-AAD). Percentage of cells in S-phase is indicated. (E) Representative images of IR-induced RPA foci in non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells from two independent experiments. (F) Western blot analysis of indicated proteins in WT, *Trp53bp1⁻*^/−, and *Lin37⁻*^/− MCF10A cells. (G) Flow cytometric analysis of BrdU pulsed cycling (top) or non-cycling (bottom) WT, *Trp53bp1⁻*^/−, and *Lin37⁻*^/− MCF10A cells as in (D). (**H, I**) Flow cytometric analysis of chromatin-bound RPA (top) and γH2AX (bottom) before or after IR of non-cycling WT and (H) *Trp53bp1⁻*^/− or (I) *Lin37⁻*^/− MCF10A cells. IR, ionizing radiation; WT, wild type.

Figure 2—figure supplement 1

Download asset Open asset

Non-cycling LIN37-deficient cells accumulate chromatin-bound RPA after IR-induced damage.

(A) Western blot analysis of indicated proteins in WT, *Trp53bp1⁻*^/−, and *Lin37⁻*^/− abl pre-B cells. (B) Flow cytometric analysis of BrdU and DNA (7-AAD) of BrdU pulsed cycling (top) or non-cycling (bottom) WT, *Trp53bp1⁻*^/−, and *Lin37⁻*^/− abl pre-B cells. Percentage of cells in S-phase is indicated. (**C, D**) Flow cytometric analysis of chromatin-bound RPA (top panels) and γH2AX (bottom panels) before or after IR of non-cycling WT and *Trp53bp1⁻*^/− (C) or *Lin37⁻*^/− (D) abl pre-B cells. The experiments were repeated in two independently generated cell lines at least twice. IR, ionizing radiation.

Figure 3 with 1 supplement

Download asset Open asset

LIN37 prevents DNA end resection in non-cycling cells.

(A) Cas9-induced *Lig4⁻*^/−:*Trp53bp1⁻*^/− and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells with (+) and without (−) the *Ctip* gRNA (*gCtip*). Western blot analysis with indicated antibodies (left) and flow cytometric analysis of chromatin-bound RPA before and after IR of the non-cycling cells (right) are shown. Representative of three experiments. (B) End-seq tracks of representative *AsiSI* sites on mouse chromosomes 1, 7, and 19 in non-cycling *Lig4⁻*^/− and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. (C) The heatmaps of End-seq at *AsiSI* DSBs across the mouse genome (y-axis) after *AsiSI* induction in non-cycling *Lig4⁻*^/− and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. Two experiments were carried out in two independently generated *Lig4⁻*^/−:*iAsiSI* and *Lig4⁻*^/−:*Lin37⁻*^/−:*iAsiSI* clones. DSB, double-strand break; End-seq, End Sequencing; gRNA, guide RNA; IR, ionizing radiation.

Figure 3—figure supplement 1

Download asset Open asset

CtIP promotes resection in non-cycling abl pre-B cells independent of CDK4/6 activity.

(A) Flow cytometric analysis of BrdU incorporation and DNA content (7-AAD) of WT abl pre-B cells after treated with Palbociclib. (B) Western blot analysis of WT abl pre-B cells treated with or without Palbociclib using indicated antibodies. (C) Flow cytometric analysis of chromatin-bound RPA before or after IR of non-cycling *Lig4⁻*^/−:*Trp53bp1⁻*^/− and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells treated with or without Palbociclib 1 hr prior to IR. IR, ionizing radiation; WT, wild type.

Figure 4 with 1 supplement

Download asset Open asset

53BP1 and LIN37 have distinct DNA end protection functions.

(A) Western blot analysis of indicated proteins in cycling and non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. (**B, C**) Quantification of 53BP1 (B) or RIF1 (C) foci after IR treatment of non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. Red bars indicate the median number of foci in each sample. More than 1000 cells were analyzed in each cell line in two independent experiments (****p<0.0001, ***p=0.0002, Mann-Whitney test). (**D, E**) Flow cytometric analysis of chromatin-bound RPA before and after IR of non-cycling *Lig4⁻*^/−:*Trp53bp1⁻*^/−(D) or *Lig4⁻*^/−:*Lin37⁻*^/− (E) abl pre-B cells after bulk gene inactivation of *Lin37* (*gLin37*) or *Trp53bp1* (*gTrp53bp1*), respectively. Representative of three experiments. IR, ionizing radiation.

Figure 4—figure supplement 1

Download asset Open asset

53BP1 and LIN37 have distinct DNA end protection functions.

(A) Western blot analysis of indicated proteins in cycling and non-cycling WT, *Trp53bp1−*^/−, and *Lin37−*^/− abl pre-B cells. (**B, C**) Representative images of 53BP1 (B) or RIF1 (C) foci after IR treatment of non-cycling *Lig4−*^/−, *Lig4−*^/−:*Trp53bp1−*^/−, and *Lig4−*^/−:*Lin37−*^/− abl pre-B cells. IR, ionizing radiation.

Figure 5 with 1 supplement

Download asset Open asset

LIN37 suppresses the expression of HR protein expression in non-cycling cells.

(A) Western blot analysis (top) and flow cytometric analysis for chromatin-bound RPA after before or after IR (bottom) of non-cycling *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells with empty lentivirus or lentivirus expressing wild type (WT) LIN37 or the LIN37 (CD) mutant. Representative of three experiments. (B) Volcano plot of RNA-Seq analysis of non-cycling *Lig4⁻*^/− and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells showing log2 values of the ratio of normalized transcript levels of *Lig4^−/−:Lin37^−/−* to *Lig4^−/−* cells (X-axis) and −log10 of the q-values of fold enrichment of each gene (Y-axis). The dashed line indicates q=0.05. Genes with q-values≤0.05 are denoted as red dots. (C) Western blot analysis of indicated proteins in cycling and non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. (D) Western blot analysis of indicated proteins in cycling or non-cycling WT, Trp53bp1⁻^/−, and *Lin37⁻*^/− MCF10A cells. (E) Western blot analysis of indicated proteins in cycling and non-cycling *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells with empty lentivirus or lentivirus expressing WT LIN37 or the LIN37 (CD) mutant. HR, homologous recombination; IR, ionizing radiation; RNA-Seq, RNA sequencing.

Figure 5—source data 1 RNA-Seq result and GO analysis in non-cycling Lig4⁻^/− and Lig4⁻^/−:Lin37^−/− abl pre-B cells. GO, gene ontology; RNA-Seq, RNA sequencing.: https://cdn.elifesciences.org/articles/68466/elife-68466-fig5-data1-v1.xlsx
Download elife-68466-fig5-data1-v1.xlsx

Figure 5—figure supplement 1

Download asset Open asset

LIN37 suppresses HR protein expression in non-cycling cells.

(A) Gene ontology (GO) analysis of genes upregulated in non-cycling *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. Enriched GO terms with the 20 lowest p-values (on the right of each bar) are shown. (B) Western blot analysis of indicated proteins in cycling or non-cycling WT, Trp53bp1⁻^/−, and *Lin37⁻*^/− abl pre-B cells. HR, homologous recombination; WT, wild type.

Figure 6 with 1 supplement

Download asset Open asset

LIN37 prevents resection and HR through suppressing HR protein expression in non-cycling cells.

(A) Western blot analysis of proliferating *Lig4⁻*^/−:*Trp53bp1⁻*^/− or *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells with or without indicated gRNAs following Cas9 induction for bulk gene inactivation using the indicated antibodies (left). Flow cytometric analysis of chromatin-bound RPA before and after IR of the same cells after rendered non-cycling by imatinib treatment (right). Representative of three experiments. (B) Quantification of RAD51 foci in non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells before IR treatment and 4 and 20 hr after IR. Red bars indicate the median number of RAD51 foci in each sample of more than 1000 cells analyzed for each cell line. Representative of two independent experiments (****p<0.0001, Mann-Whitney test). (C) Flow cytometric analysis of HR-mediated DSB repair in non-cycling *Lig4⁻*^/− and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells using the HPRT-DR-GFP reporter. The percentage of GFP-positive cells is shown. Error bars are ± SEM from three experiments (*p=0.0124, t-test). DSB, double-strand break; gRNA, guide RNA; HR, homologous recombination; IR, ionizing radiation.

Figure 6—source data 1 RPA screen result in non-cycling Lig4⁻^/−:Lin37^−/− abl pre-B cells.: https://cdn.elifesciences.org/articles/68466/elife-68466-fig6-data1-v1.xlsx
Download elife-68466-fig6-data1-v1.xlsx

Figure 6—figure supplement 1

Download asset Open asset

LIN37 deficiency leads to RAD51 focus formation in non-cycling abl pre-B cells.

Representative images of RAD51 IR-induced foci in non-cycling *Lig4⁻*^/−, *Lig4⁻*^/−:*Trp53bp1⁻*^/−, and *Lig4⁻*^/−:*Lin37⁻*^/− abl pre-B cells. IR, ionizing radiation.

Figure 7 with 1 supplement

Download asset Open asset

LIN37 function in DNA end protection is restricted to G₀.

(**A, B**) Western blot analysis of indicated proteins in cycling and non-cycling abl pre-B cells (A) or MCF10A cells (B). (**C, D**) Western blot analysis of indicated proteins in cycling G₁ or S/G₂/M abl pre-B cells (C) or MCF10A cells (D), isolated by flow cytometric cell sorting based on the PIP-FUCCI reporter. Representative of two independent experiments. Asterisk indicates non-specific recognizing bands. (**E, F**) Flow cytometric analysis of chromatin-bound RPA and γH2AX before and after IR treatment of G₁-phase *Lig4^−/−*, *Lig4^−/−:Trp53bp1⁻*^/− and *Lig4^−/−:Lin37⁻*^/− abl pre-B cells (E) or WT, *Trp53bp1⁻*^/−, and *Lin37⁻*^/− MCF10A cells (F). Representative of three experiments. IR, ionizing radiation; WT, wild type.

Figure 7—source data 1 RNA-Seq result and GO analysis in cycling G₁ Lig4⁻^/− and Lig4⁻^/−:Lin37^−/− abl pre-B cells. GO, gene ontology; RNA-Seq, RNA sequencing.: https://cdn.elifesciences.org/articles/68466/elife-68466-fig7-data1-v1.xlsx
Download elife-68466-fig7-data1-v1.xlsx
Figure 7—source data 2 GO analysis of genes upregulated in non-cycling G₀ and/or cycling G₁ Lig4⁻^/−:Lin37^−/− abl pre-B cells. GO, gene ontology.: https://cdn.elifesciences.org/articles/68466/elife-68466-fig7-data2-v1.xlsx
Download elife-68466-fig7-data2-v1.xlsx

Figure 7—figure supplement 1

Download asset Open asset

Identification of G₁-phase cells in proliferating cells.

(**A, B**) Flow cytometric analysis of EdU incorporation and DNA content (7-AAD) of cycling *Lig4^−/−*, *Lig4^−/−:Trp53bp1⁻*^/−, and *Lig4^−/−:Lin37⁻*^/− abl pre-B cells (A) or cycling WT, *Trp53bp1⁻*^/−, and *Lin37⁻*^/− MCF10A cells (B). Cells were treated (+EdU) or not treated (−EdU) with EdU and analyses were carried out before or after IR. The percentage of G₁-phase cells is shown. IR, ionizing radiation; WT, wild type.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Antibody	Anti-53BP1 (Rabbit polyclonal)	Bethyl Laboratories	A300-272A	WB (1:3000)
Antibody	Anti-53BP1 (Rabbit polyclonal)	Novus Biologicals	NB100-305	IF (1:1000)
Antibody	Anti-LIN37 (Mouse monoclonal)	Santa Cruz Biotechnology	sc-515686	WB (1:200)
Antibody	Anti-BLM (Rabbit polyclonal)	Bethyl Laboratories	A300-572A	WB (1:2000)
Antibody	Anti-BRCA1 (Mouse monoclonal)	R and D Systems	Custom made (Andre Nussenzweig, NCI)	WB (1:1000); for mouse BRCA1
Antibody	Anti-BRCA1 (Mouse monoclonal)	Millipore Sigma	07-434	WB (1:1000); for human BRCA1
Antibody	Anti-RAD51 (Rabbit polyclonal)	Millipore Sigma	ABE257	WB (1:2000)
Antibody	Anti-RAD51 (Rabbit polyclonal)	Abcam	ab176458	IF (1:250)
Antibody	Anti-BARD1 (Rabbit polyclonal)	Thermo Fisher Scientific	PA5-85707	WB (1:1000)
Antibody	Anti-CtIP (Rabbit polyclonal)	N/A	Custom made (Richard Baer, Columbia University)	WB (1:1000)
Antibody	Anti-MRE11 (Rabbit polyclonal)	Novus Biologicals	NB100-142	WB (1:2000)
Antibody	Anti-RIF1 (Rabbit polyclonal)	Abcam	ab13422	WB (1:500)
Antibody	Anti-RIF1 (Rabbit polyclonal)	N/A	Custom made (Davide Robbiani, Rockefeller University)	IF (1:5000)
Antibody	Anti-C20orf196/ SHLD1 (Rabbit polyclonal)	Thermo Fisher Scientific	PA5-559280	WB (1:200)
Antibody	Anti-GAPDH (Mouse Monoclonal)	Millipore Sigma	G8795	WB (1:10,000)
Antibody	Anti-KAP1 (Rabbit polyclonal)	Genetex	GTX102226	WB (1:2000)
Antibody	Anti-FANCD2 (Rabbit monoclonal)	R and D Systems	MAB93691	WB (1:1000)
Antibody	Anti-BRCA2 (Rabbit polyclonal)	Proteintech	19791-1-AP	WB (1:500); for human BRCA2
Antibody	Anti-Rb1 (Mouse monoclonal)	Thermo Fisher Scientific	LF-MA0173	WB (1:1000)
Antibody	Anti-Phospho -Rb (Ser780) (Rabbit polyclonal)	Cell Signaling Technology	8180T	WB (1:1000)
Antibody	Anti-Phospho -Rb (Ser807/ 811) (Rabbit polyclonal)	Cell Signaling Technology	8516T	WB (1:1000)
Antibody	Anti-PCNA (Rabbit polyclonal)	Bethyl Laboratories	A300-276A	WB (1:3000)
Antibody	Anti-CDK4 (Rabbit polyclonal)	Novus Biologicals	NBP1-31308	WB (1:1000)
Antibody	Anti-CDK4 (phosphor Thr172) (Rabbit polyclonal)	GeneTex	GTX00778	WB (1:1000)
Antibody	Anti-RPA32 (4E4) (Rat monoclonal)	Cell Signaling Technology	2208S	WB (1:1000); FC (1:500)
Antibody	Anti-phospho-H2AX (ser139) (Mouse monoclonal)	Millipore Sigma	05-636	FC (1:1000)
Antibody	HRP, goat anti-mouse	Promega	W4021	WB (1:5000)
Antibody	HRP, goat anti-rabbit IgG	Promega	W4011	WB (1:5000)
Antibody	Alexa Fluor 555, donkey anti-rabbit IgG	Thermo Fisher Scientific	A-31572	IF (1:5000)
Antibody	Alexa Fluor 488,goat anti-rat IgG	BioLegend	405418	FC (1:500)
Antibody	Alexa Fluor 647,goat anti-mouse IgG	BioLegend	405322	FC (1:500)
Recombinant DNA reagent	pCW-Cas9 (plasmid)	Addgene	50661
Recombinant DNA reagent	pX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid)	Addgene	42230
Recombinant DNA reagent	pKLV-U6 gRNA(BbsI)-PGKpuro-2ABFP (plasmid)	Addgene	50946
Recombinant DNA reagent	pLenti-CMV-Blast-PIP-FUCCI (plasmid)	Addgene	138715
Recombinant DNA reagent	Genome-wide CRISPR guide RNA library V2 (plasmid)	Addgene	67988
Recombinant DNA reagent	Lin37 cDNA BC013546 (plasmid)	transOMIC	TCM1004
Recombinant DNA reagent	TRE-Thy1.1 (plasmid)	This study	N/A	Available upon request
Recombinant DNA reagent	pHPRT-DR-GFP (plasmid)	Marian Jasin, MSKCC	N/A
Recombinant DNA reagent	pCBASceI (plasmid)	Marian Jasin, MSKCC	N/A
Recombinant DNA reagent	pCBA (plasmid)	Marian Jasin, MSKCC	N/A
Cell line (Homo-sapiens)	MCA10A	ATCC	CRL-10317
Cell line (Homo-sapiens)	MCA10A: iCas9	This study	Clone 25	Available upon request
Cell line (Homo-sapiens)	MCA10A: Trp53bp1^−/−: iCas9	This study	Clones 7 and 50	Available upon request
Cell line (Homo-sapiens)	MCA10A: Lin37^−/−:iCas9	This study	Clones 5 and 21	Available upon request
Cell line (Mus musculus)	WT:iCas9 abl pre-B cells	This study	M63.1.MG36.iCas9.302	Available upon request
Cell line (M. musculus)	Trp53bp1^−/−:iCas9 abl pre-B cells	This study	Clones 1 and 27	Available upon request
Cell line (M. musculus)	Lin37^−/−:iCas9 abl pre-B cells	This study	Clones 9 and 59	Available upon request
Cell line (M. musculus)	Lig4^−/−:iCas9 abl pre-B cells	This study	A5.83.MG9.iCas9.16	Available upon request
Cell line (M. musculus)	Lig4^−/−: Trp53bp1^−/−:iCas9 abl pre-B cells	This study	Clones 81 and 82	Available upon request
Cell line (M. musculus)	Lig4^−/−:Lin37^−/−:iCas9 abl pre-B cells	This study	Clones 6 and 42	Available upon request
Chemical compound, drug	Imatinib	Selleckchem	S2475
Chemical compound, drug	Doxycycline	Sigma-Aldrich	D9891
Chemical compound, drug	Puromycin	Sigma-Aldrich	P9620
Chemical compound, drug	EGF	PeproTech	AF-100-15
Chemical compound, drug	Hydrocortisone	Sigma-Aldrich	H-0888
Chemical compound, drug	Cholera Toxin	Sigma-Aldrich	C-8052
Chemical compound, drug	Insulin	Sigma-Aldrich	I-1882
Commercial assay or kit	Cytofix/Cytoperm solution	BD Biosciences	554722
Commercial assay or kit	Perm/Wash Buffer	BD Biosciences	554723
Commercial assay or kit	Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit	Life Technologies	C10419
Commercial assay or kit	SG Cell Line 4D X Kit L	Lonza	V4XC-3024
Other	7-AAD (DNA stain)	BD Biosciences	559925
Sequence-based reagent	pKLV lib330F	This study (designed based on Tzelepis et al., 2016)	PCR primers	AATGGACTATCATATGCTTACCGT
Sequence-based reagent	pKLV lib490R	This study (designed based on Tzelepis et al., 2016)	PCR primers	CCTACCGGTGGATGTGGAATG
Sequence-based reagent	PE.P5_pKLV lib195 Fwd	This study (designed based on Tzelepis et al., 2016 and standard Illumana adaptor sequences)	PCR primers	AATGATACGGCGACCACCGAGATCTGGCTTTATATATCTTGTGGAAAGGAC
Sequence-based reagent	P7 index180 Rev	This study (designed based on Tzelepis et al., 2016 and standard Illumana adaptor sequences)	PCR primers	CAAGCAGAAGACGGCATACGAGATINDEXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCCAGACTGCCTTGGGAAAAGC
Sequence-based reagent	Lin37 iso1_5′XhoI_S	This study (designed based on cDNA BC013546)	PCR primers	GCCCTCGAGATGTTCCCGGTAAAGGTGAAAGTGG
Sequence-based reagent	Lin37 3′NotI_AS	This study (designed based on cDNA BC013546)	PCR primers	GCCGCGGCCGCTCACTGCCGGTCATACATCTCCCGT
Sequence-based reagent	Lin37 CD1_AS	This study (designed based on cDNA BC013546 and Mages et al., 2017)	PCR primers	TACAGTGGTGTGTTCTCACTGAACTGGGCCAAGTCCACAGCCCCG GCAAATAGCTTGATC
Sequence-based reagent	Lin37 CD2_S	This study (designed based on cDNA BC013546 and Mages et al., 2017)	PCR primers	ACTTGGCCCAGTTCAGTGAGAACACACCACTGTACCCCATCGCCGGCGCCTGGATGCGCA
Sequence-based reagent	BU1	Canela et al., 2016	PCR primers	5′-Phos-GATCGGAAGAGCGTCGT GTAGGGAAAGAGTGUU[Biotin-dT]U [Biotin-dT]UUACACTCTTTC CCTACACGACGCTCTTCCGATC* T-3′ [*phosphorothioate bond]
Sequence-based reagent	BU2	Canela et al., 2016	PCR primers	5′-Phos-GATCGGAAGAGCACACG TCUUUUUUUUAGACGTGTGCTCTTCCGATCT-3′ [phosphorothioate bond]
Sequence-based reagent	53 bp1 gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	GAACCTGTCAGACCCGATC
Sequence-based reagent	Lin37 gRNA sequences	Sequence is from Tzelepis et al., 2016	N/A	AAGCTATTTGACCGGAGTG
Sequence-based reagent	Brca1 gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	GTCTACATTGAACTAGGTA
Sequence-based reagent	Ctip gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	ATTAACCGGCTACGAAAGA
Sequence-based reagent	Bard1 gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	AAATCGTAAAGGCTGCCAC
Sequence-based reagent	Blm gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	GATTTAACGAAGGAATCGG
Sequence-based reagent	Fancd2 gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	TCTTGTGATGTCGCTCGAC
Sequence-based reagent	Trp53bp1 (human) gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	TCTAGTGTGTTAGATCAGG
Sequence-based reagent	Lin37 (human) gRNA sequence	Sequence is from Tzelepis et al., 2016	N/A	TCTAGGGAGCGTCTGGATG
Software, algorithm	Image J	NIH	RRID:SCR_003070
Software, algorithm	FlowJo	FlowJo	RRID:SCR_008520
Software, algorithm	Prism	GraphPad	RRID:SCR_002798
Software, algorithm	SeqKit	Shen et al., 2016	RRID:SCR_018926
Software, algorithm	Bowtie	Langmead et al., 2009	RRID:SCR_005476
Software, algorithm	SAMtools	Li et al., 2009	RRID:SCR_002105
Software, algorithm	BEDtools	Quinlan and Hall, 2010	RRID:SCR_006646
Others	LSRII flow cytometer	BD Biosciences	RRID:SCR_002159
Others	FACSAria II Cell Sorter	BD Biosciences	RRID:SCR_018934
Others	Lionheart LX automated microscope	BioTex Instrument	RRID:SCR_019745
Others	4-D Nucleofector	Lonza	NA

Additional files

Source data 1 Compiled PDF file that contains raw images with the regions shown in the manuscript labeled.: https://cdn.elifesciences.org/articles/68466/elife-68466-data1-v1.pdf
Download elife-68466-data1-v1.pdf
Source data 2 Raw images from Figures 2 and 3.: https://cdn.elifesciences.org/articles/68466/elife-68466-data2-v1.zip
Download elife-68466-data2-v1.zip
Source data 3 Raw images from Figure 4.: https://cdn.elifesciences.org/articles/68466/elife-68466-data3-v1.zip
Download elife-68466-data3-v1.zip
Source data 4 Raw images from Figure 5.: https://cdn.elifesciences.org/articles/68466/elife-68466-data4-v1.zip
Download elife-68466-data4-v1.zip
Source data 5 Raw images from Figure 5.: https://cdn.elifesciences.org/articles/68466/elife-68466-data5-v1.zip
Download elife-68466-data5-v1.zip
Source data 6 Raw images from Figures 6 and 7.: https://cdn.elifesciences.org/articles/68466/elife-68466-data6-v1.zip
Download elife-68466-data6-v1.zip
Transparent reporting form: https://cdn.elifesciences.org/articles/68466/elife-68466-transrepform-v1.pdf
Download elife-68466-transrepform-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Bo-Ruei Chen
Yinan Wang
Anthony Tubbs
Dali Zong
Faith C Fowler
Nicholas Zolnerowich
Wei Wu
Amelia Bennett
Chun-Chin Chen
Wendy Feng
Andre Nussenzweig
Jessica K Tyler
Barry P Sleckman

(2021)

LIN37-DREAM prevents DNA end resection and homologous recombination at DNA double-strand breaks in quiescent cells

eLife 10:e68466.

https://doi.org/10.7554/eLife.68466

Share this article

Cite this article

An unbiased genome-scale gRNA screen for novel DNA end protection factors.

Figure 1—source data 1

Non-cycling LIN37-deficient cells accumulate chromatin-bound RPA after IR-induced damage.

Non-cycling LIN37-deficient cells accumulate chromatin-bound RPA after IR-induced damage.

LIN37 prevents DNA end resection in non-cycling cells.

CtIP promotes resection in non-cycling abl pre-B cells independent of CDK4/6 activity.

53BP1 and LIN37 have distinct DNA end protection functions.

53BP1 and LIN37 have distinct DNA end protection functions.

LIN37 suppresses the expression of HR protein expression in non-cycling cells.

Figure 5—source data 1

LIN37 suppresses HR protein expression in non-cycling cells.

LIN37 prevents resection and HR through suppressing HR protein expression in non-cycling cells.

Figure 6—source data 1

LIN37 deficiency leads to RAD51 focus formation in non-cycling abl pre-B cells.

LIN37 function in DNA end protection is restricted to G0.

Figure 7—source data 1

Figure 7—source data 2

Identification of G1-phase cells in proliferating cells.

Source data 1

Source data 2

Source data 3

Source data 4

Source data 5

Source data 6

Transparent reporting form

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

LIN37 function in DNA end protection is restricted to G₀.

Identification of G₁-phase cells in proliferating cells.