1. Cell Biology
  2. Chromosomes and Gene Expression
Download icon

LIN37-DREAM prevents DNA end resection and homologous recombination at DNA double-strand breaks in quiescent cells

  1. Bo-Ruei Chen
  2. Yinan Wang
  3. Anthony Tubbs
  4. Dali Zong
  5. Faith C Fowler
  6. Nicholas Zolnerowich
  7. Wei Wu
  8. Amelia Bennett
  9. Chun-Chin Chen
  10. Wendy Feng
  11. Andre Nussenzweig
  12. Jessica K Tyler  Is a corresponding author
  13. Barry P Sleckman  Is a corresponding author
  1. Division of Hematology and Oncology, Department of Medicine, University of Alabama at Birmingham, United States
  2. O’Neal Comprehensive Cancer Center, University of Alabama at Birmingham, United States
  3. Department of Pathology and Laboratory Medicine, Weill Cornell Medicine, United States
  4. Laboratory of Genome Integrity, National Cancer Institute, United States
Research Article
Cite this article as: eLife 2021;10:e68466 doi: 10.7554/eLife.68466
7 figures, 1 table and 7 additional files

Figures

An unbiased genome-scale gRNA screen for novel DNA end protection factors.

(A) Flow cytometric analysis of chromatin-bound RPA before and after IR of non-cycling Lig4/− and Lig4/−:Trp53bp1/− abl pre-B cells. (B) Flow cytometric analysis of FLAG-Cas9 in Lig4/− cells with (+dox) and without (−dox) doxycycline to induce expression of FLAG-Cas9. (C) Schematic diagram of the genome-scale guide RNA screen for genes preventing DNA end resection in non-cycling Lig4/− abl pre-B cells. (D) Enrichment score (fold enrichment) of individual gRNAs to a subset of genes identified in the RPA high population. gRNA, guide RNA; IR, ionizing radiation.

Figure 1—source data 1

RPA screen result in non-cycling Lig4/− abl pre-B cells.

https://cdn.elifesciences.org/articles/68466/elife-68466-fig1-data1-v1.xlsx
Figure 2 with 1 supplement
Non-cycling LIN37-deficient cells accumulate chromatin-bound RPA after IR-induced damage.

(A) Western blot analysis of indicated proteins in Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells. (B) Flow cytometric analysis of chromatin-bound RPA (top) and γH2AX (bottom) before and after IR of non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells. The experiments were repeated in two independently generated cell lines at least twice. (C) Western blot analysis of RPA32 and phosphorylated RPA 32 (pRPA32(S4/S8)) of non-cycling Lig4/−, Lig4−/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells treated without or with IR after indicated times. (D) Flow cytometric analysis of cycling and non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells for BrdU incorporation and DNA content (7-AAD). Percentage of cells in S-phase is indicated. (E) Representative images of IR-induced RPA foci in non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells from two independent experiments. (F) Western blot analysis of indicated proteins in WT, Trp53bp1/−, and Lin37/− MCF10A cells. (G) Flow cytometric analysis of BrdU pulsed cycling (top) or non-cycling (bottom) WT, Trp53bp1/−, and Lin37/− MCF10A cells as in (D). (H, I) Flow cytometric analysis of chromatin-bound RPA (top) and γH2AX (bottom) before or after IR of non-cycling WT and (H) Trp53bp1/− or (I) Lin37/− MCF10A cells. IR, ionizing radiation; WT, wild type.

Figure 2—figure supplement 1
Non-cycling LIN37-deficient cells accumulate chromatin-bound RPA after IR-induced damage.

(A) Western blot analysis of indicated proteins in WT, Trp53bp1/−, and Lin37/− abl pre-B cells. (B) Flow cytometric analysis of BrdU and DNA (7-AAD) of BrdU pulsed cycling (top) or non-cycling (bottom) WT, Trp53bp1/−, and Lin37/− abl pre-B cells. Percentage of cells in S-phase is indicated. (C, D) Flow cytometric analysis of chromatin-bound RPA (top panels) and γH2AX (bottom panels) before or after IR of non-cycling WT and Trp53bp1/− (C) or Lin37/− (D) abl pre-B cells. The experiments were repeated in two independently generated cell lines at least twice. IR, ionizing radiation.

Figure 3 with 1 supplement
LIN37 prevents DNA end resection in non-cycling cells.

(A) Cas9-induced Lig4/−:Trp53bp1/− and Lig4/−:Lin37/− abl pre-B cells with (+) and without (−) the Ctip gRNA (gCtip). Western blot analysis with indicated antibodies (left) and flow cytometric analysis of chromatin-bound RPA before and after IR of the non-cycling cells (right) are shown. Representative of three experiments. (B) End-seq tracks of representative AsiSI sites on mouse chromosomes 1, 7, and 19 in non-cycling Lig4/− and Lig4/−:Lin37/− abl pre-B cells. (C) The heatmaps of End-seq at AsiSI DSBs across the mouse genome (y-axis) after AsiSI induction in non-cycling Lig4/− and Lig4/−:Lin37/− abl pre-B cells. Two experiments were carried out in two independently generated Lig4/−:iAsiSI and Lig4/−:Lin37/−:iAsiSI clones. DSB, double-strand break; End-seq, End Sequencing; gRNA, guide RNA; IR, ionizing radiation.

Figure 3—figure supplement 1
CtIP promotes resection in non-cycling abl pre-B cells independent of CDK4/6 activity.

(A) Flow cytometric analysis of BrdU incorporation and DNA content (7-AAD) of WT abl pre-B cells after treated with Palbociclib. (B) Western blot analysis of WT abl pre-B cells treated with or without Palbociclib using indicated antibodies. (C) Flow cytometric analysis of chromatin-bound RPA before or after IR of non-cycling Lig4/−:Trp53bp1/− and Lig4/−:Lin37/− abl pre-B cells treated with or without Palbociclib 1 hr prior to IR. IR, ionizing radiation; WT, wild type.

Figure 4 with 1 supplement
53BP1 and LIN37 have distinct DNA end protection functions.

(A) Western blot analysis of indicated proteins in cycling and non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells. (B, C) Quantification of 53BP1 (B) or RIF1 (C) foci after IR treatment of non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells. Red bars indicate the median number of foci in each sample. More than 1000 cells were analyzed in each cell line in two independent experiments (****p<0.0001, ***p=0.0002, Mann-Whitney test). (D, E) Flow cytometric analysis of chromatin-bound RPA before and after IR of non-cycling Lig4/−:Trp53bp1/− (D) or Lig4/−:Lin37/− (E) abl pre-B cells after bulk gene inactivation of Lin37 (gLin37) or Trp53bp1 (gTrp53bp1), respectively. Representative of three experiments. IR, ionizing radiation.

Figure 4—figure supplement 1
53BP1 and LIN37 have distinct DNA end protection functions.

(A) Western blot analysis of indicated proteins in cycling and non-cycling WT, Trp53bp1−/−, and Lin37−/− abl pre-B cells. (B, C) Representative images of 53BP1 (B) or RIF1 (C) foci after IR treatment of non-cycling Lig4−/−, Lig4−/−:Trp53bp1−/−, and Lig4−/−:Lin37−/− abl pre-B cells. IR, ionizing radiation.

Figure 5 with 1 supplement
LIN37 suppresses the expression of HR protein expression in non-cycling cells.

(A) Western blot analysis (top) and flow cytometric analysis for chromatin-bound RPA after before or after IR (bottom) of non-cycling Lig4/−:Lin37/− abl pre-B cells with empty lentivirus or lentivirus expressing wild type (WT) LIN37 or the LIN37 (CD) mutant. Representative of three experiments. (B) Volcano plot of RNA-Seq analysis of non-cycling Lig4/− and Lig4/−:Lin37/− abl pre-B cells showing log2 values of the ratio of normalized transcript levels of Lig4−/−:Lin37−/− to Lig4−/− cells (X-axis) and −log10 of the q-values of fold enrichment of each gene (Y-axis). The dashed line indicates q=0.05. Genes with q-values≤0.05 are denoted as red dots. (C) Western blot analysis of indicated proteins in cycling and non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells. (D) Western blot analysis of indicated proteins in cycling or non-cycling WT, Trp53bp1/−, and Lin37/− MCF10A cells. (E) Western blot analysis of indicated proteins in cycling and non-cycling Lig4/−:Lin37/− abl pre-B cells with empty lentivirus or lentivirus expressing WT LIN37 or the LIN37 (CD) mutant. HR, homologous recombination; IR, ionizing radiation; RNA-Seq, RNA sequencing.

Figure 5—source data 1

RNA-Seq result and GO analysis in non-cycling Lig4/− and Lig4/−:Lin37−/− abl pre-B cells.

GO, gene ontology; RNA-Seq, RNA sequencing.

https://cdn.elifesciences.org/articles/68466/elife-68466-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
LIN37 suppresses HR protein expression in non-cycling cells.

(A) Gene ontology (GO) analysis of genes upregulated in non-cycling Lig4/−:Lin37/− abl pre-B cells. Enriched GO terms with the 20 lowest p-values (on the right of each bar) are shown. (B) Western blot analysis of indicated proteins in cycling or non-cycling WT, Trp53bp1/−, and Lin37/− abl pre-B cells. HR, homologous recombination; WT, wild type.

Figure 6 with 1 supplement
LIN37 prevents resection and HR through suppressing HR protein expression in non-cycling cells.

(A) Western blot analysis of proliferating Lig4/−:Trp53bp1/− or Lig4/−:Lin37/− abl pre-B cells with or without indicated gRNAs following Cas9 induction for bulk gene inactivation using the indicated antibodies (left). Flow cytometric analysis of chromatin-bound RPA before and after IR of the same cells after rendered non-cycling by imatinib treatment (right). Representative of three experiments. (B) Quantification of RAD51 foci in non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells before IR treatment and 4 and 20 hr after IR. Red bars indicate the median number of RAD51 foci in each sample of more than 1000 cells analyzed for each cell line. Representative of two independent experiments (****p<0.0001, Mann-Whitney test). (C) Flow cytometric analysis of HR-mediated DSB repair in non-cycling Lig4/− and Lig4/−:Lin37/− abl pre-B cells using the HPRT-DR-GFP reporter. The percentage of GFP-positive cells is shown. Error bars are ± SEM from three experiments (*p=0.0124, t-test). DSB, double-strand break; gRNA, guide RNA; HR, homologous recombination; IR, ionizing radiation.

Figure 6—source data 1

RPA screen result in non-cycling Lig4/−:Lin37−/− abl pre-B cells.

https://cdn.elifesciences.org/articles/68466/elife-68466-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
LIN37 deficiency leads to RAD51 focus formation in non-cycling abl pre-B cells.

Representative images of RAD51 IR-induced foci in non-cycling Lig4/−, Lig4/−:Trp53bp1/−, and Lig4/−:Lin37/− abl pre-B cells. IR, ionizing radiation.

Figure 7 with 1 supplement
LIN37 function in DNA end protection is restricted to G0.

(A, B) Western blot analysis of indicated proteins in cycling and non-cycling abl pre-B cells (A) or MCF10A cells (B). (C, D) Western blot analysis of indicated proteins in cycling G1 or S/G2/M abl pre-B cells (C) or MCF10A cells (D), isolated by flow cytometric cell sorting based on the PIP-FUCCI reporter. Representative of two independent experiments. Asterisk indicates non-specific recognizing bands. (E, F) Flow cytometric analysis of chromatin-bound RPA and γH2AX before and after IR treatment of G1-phase Lig4−/−, Lig4−/−:Trp53bp1/− and Lig4−/−:Lin37/− abl pre-B cells (E) or WT, Trp53bp1/−, and Lin37/− MCF10A cells (F). Representative of three experiments. IR, ionizing radiation; WT, wild type.

Figure 7—source data 1

RNA-Seq result and GO analysis in cycling G1 Lig4/− and Lig4/−:Lin37−/− abl pre-B cells.

GO, gene ontology; RNA-Seq, RNA sequencing.

https://cdn.elifesciences.org/articles/68466/elife-68466-fig7-data1-v1.xlsx
Figure 7—source data 2

GO analysis of genes upregulated in non-cycling G0 and/or cycling G1 Lig4/−:Lin37−/− abl pre-B cells.

GO, gene ontology.

https://cdn.elifesciences.org/articles/68466/elife-68466-fig7-data2-v1.xlsx
Figure 7—figure supplement 1
Identification of G1-phase cells in proliferating cells.

(A, B) Flow cytometric analysis of EdU incorporation and DNA content (7-AAD) of cycling Lig4−/−, Lig4−/−:Trp53bp1/−, and Lig4−/−:Lin37/− abl pre-B cells (A) or cycling WT, Trp53bp1/−, and Lin37/− MCF10A cells (B). Cells were treated (+EdU) or not treated (−EdU) with EdU and analyses were carried out before or after IR. The percentage of G1-phase cells is shown. IR, ionizing radiation; WT, wild type.

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
AntibodyAnti-53BP1 (Rabbit polyclonal)Bethyl LaboratoriesA300-272AWB (1:3000)
AntibodyAnti-53BP1 (Rabbit polyclonal)Novus BiologicalsNB100-305IF (1:1000)
AntibodyAnti-LIN37 (Mouse monoclonal)Santa Cruz Biotechnologysc-515686WB (1:200)
AntibodyAnti-BLM (Rabbit polyclonal)Bethyl LaboratoriesA300-572AWB (1:2000)
AntibodyAnti-BRCA1 (Mouse monoclonal)R and D SystemsCustom made (Andre Nussenzweig, NCI)WB (1:1000); for mouse BRCA1
AntibodyAnti-BRCA1 (Mouse monoclonal)Millipore Sigma07-434WB (1:1000); for human BRCA1
AntibodyAnti-RAD51 (Rabbit polyclonal)Millipore SigmaABE257WB (1:2000)
AntibodyAnti-RAD51 (Rabbit polyclonal)Abcamab176458IF (1:250)
AntibodyAnti-BARD1 (Rabbit polyclonal)Thermo Fisher ScientificPA5-85707WB (1:1000)
AntibodyAnti-CtIP (Rabbit polyclonal)N/ACustom made (Richard Baer, Columbia University)WB (1:1000)
AntibodyAnti-MRE11 (Rabbit polyclonal)Novus BiologicalsNB100-142WB (1:2000)
AntibodyAnti-RIF1 (Rabbit polyclonal)Abcamab13422WB (1:500)
AntibodyAnti-RIF1 (Rabbit polyclonal)N/ACustom made (Davide Robbiani, Rockefeller University)IF (1:5000)
AntibodyAnti-C20orf196/ SHLD1 (Rabbit polyclonal)Thermo Fisher ScientificPA5-559280WB (1:200)
AntibodyAnti-GAPDH (Mouse Monoclonal)Millipore SigmaG8795WB (1:10,000)
AntibodyAnti-KAP1 (Rabbit polyclonal)GenetexGTX102226WB (1:2000)
AntibodyAnti-FANCD2
(Rabbit monoclonal)
R and D SystemsMAB93691WB (1:1000)
AntibodyAnti-BRCA2 (Rabbit polyclonal)Proteintech19791-1-APWB (1:500); for human BRCA2
AntibodyAnti-Rb1 (Mouse monoclonal)Thermo Fisher ScientificLF-MA0173WB (1:1000)
AntibodyAnti-Phospho -Rb (Ser780) (Rabbit polyclonal)Cell Signaling Technology8180TWB (1:1000)
AntibodyAnti-Phospho -Rb (Ser807/ 811) (Rabbit polyclonal)Cell Signaling Technology8516TWB (1:1000)
AntibodyAnti-PCNA (Rabbit polyclonal)Bethyl LaboratoriesA300-276AWB (1:3000)
AntibodyAnti-CDK4 (Rabbit polyclonal)Novus BiologicalsNBP1-31308WB (1:1000)
AntibodyAnti-CDK4 (phosphor Thr172) (Rabbit polyclonal)GeneTexGTX00778WB (1:1000)
AntibodyAnti-RPA32 (4E4) (Rat monoclonal)Cell Signaling Technology2208SWB (1:1000);
FC (1:500)
AntibodyAnti-phospho-H2AX (ser139) (Mouse monoclonal)Millipore Sigma05-636FC (1:1000)
AntibodyHRP, goat anti-mousePromegaW4021WB (1:5000)
AntibodyHRP, goat anti-rabbit IgGPromegaW4011WB (1:5000)
AntibodyAlexa Fluor 555, donkey anti-rabbit IgGThermo Fisher ScientificA-31572IF (1:5000)
AntibodyAlexa Fluor 488,goat anti-rat IgGBioLegend405418FC (1:500)
AntibodyAlexa Fluor 647,goat anti-mouse IgGBioLegend405322FC (1:500)
Recombinant DNA reagentpCW-Cas9 (plasmid)Addgene50661
Recombinant DNA reagentpX330-U6-Chimeric_BB-CBh-hSpCas9 (plasmid)Addgene42230
Recombinant DNA reagentpKLV-U6 gRNA(BbsI)-PGKpuro-2ABFP (plasmid)Addgene50946
Recombinant DNA reagentpLenti-CMV-Blast-PIP-FUCCI (plasmid)Addgene138715
Recombinant DNA reagentGenome-wide CRISPR guide RNA library V2 (plasmid)Addgene67988
Recombinant DNA reagentLin37 cDNA BC013546 (plasmid)transOMICTCM1004
Recombinant DNA reagentTRE-Thy1.1 (plasmid)This studyN/AAvailable upon request
Recombinant DNA reagentpHPRT-DR-GFP (plasmid)Marian Jasin, MSKCCN/A
Recombinant DNA reagentpCBASceI (plasmid)Marian Jasin, MSKCCN/A
Recombinant DNA reagentpCBA
(plasmid)
Marian Jasin, MSKCCN/A
Cell line (Homo-sapiens)MCA10AATCCCRL-10317
Cell line (Homo-sapiens)MCA10A: iCas9This studyClone 25Available upon request
Cell line (Homo-sapiens)MCA10A: Trp53bp1−/−: iCas9This studyClones 7 and 50Available upon request
Cell line (Homo-sapiens)MCA10A: Lin37−/−:iCas9This studyClones 5 and 21Available upon request
Cell line (Mus musculus)WT:iCas9 abl pre-B cellsThis studyM63.1.MG36.iCas9.302Available upon request
Cell line (M. musculus)Trp53bp1−/−:iCas9 abl pre-B cellsThis studyClones 1 and 27Available upon request
Cell line (M. musculus)Lin37−/−:iCas9 abl pre-B cellsThis studyClones 9 and 59Available upon request
Cell line (M. musculus)Lig4−/−:iCas9 abl pre-B cellsThis studyA5.83.MG9.iCas9.16Available upon request
Cell line (M. musculus)Lig4−/−: Trp53bp1−/−:iCas9 abl pre-B cellsThis studyClones 81 and 82Available upon request
Cell line (M. musculus)Lig4−/−:Lin37−/−:iCas9 abl pre-B cellsThis studyClones 6 and 42Available upon request
Chemical compound, drugImatinibSelleckchemS2475
Chemical compound, drugDoxycyclineSigma-AldrichD9891
Chemical compound, drugPuromycinSigma-AldrichP9620
Chemical compound, drugEGFPeproTechAF-100-15
Chemical compound, drugHydrocortisoneSigma-AldrichH-0888
Chemical compound, drugCholera ToxinSigma-AldrichC-8052
Chemical compound, drugInsulinSigma-AldrichI-1882
Commercial assay or kitCytofix/Cytoperm solutionBD Biosciences554722
Commercial assay or kitPerm/Wash BufferBD Biosciences554723
Commercial assay or kitClick-iT EdU Alexa Fluor 647 Flow Cytometry Assay KitLife TechnologiesC10419
Commercial assay or kitSG Cell Line 4D X Kit LLonzaV4XC-3024
Other7-AAD (DNA stain)BD Biosciences559925
Sequence-based reagentpKLV lib330FThis study (designed based on Tzelepis et al., 2016)PCR primersAATGGACTATCATATGCTTACCGT
Sequence-based reagentpKLV lib490RThis study (designed based on Tzelepis et al., 2016)PCR primersCCTACCGGTGGATGTGGAATG
Sequence-based reagentPE.P5_pKLV lib195 FwdThis study (designed based on Tzelepis et al., 2016 and standard Illumana adaptor sequences)PCR primersAATGATACGGCGACCACCGAGATCTGGCTTTATATATCTTGTGGAAAGGAC
Sequence-based reagentP7 index180 RevThis study (designed based on Tzelepis et al., 2016 and standard Illumana adaptor sequences)PCR primersCAAGCAGAAGACGGCATACGAGATINDEXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCCAGACTGCCTTGGGAAAAGC
Sequence-based reagentLin37 iso1_5′XhoI_SThis study (designed based on cDNA BC013546)PCR primersGCCCTCGAGATGTTCCCGGTAAAGGTGAAAGTGG
Sequence-based reagentLin37 3′NotI_ASThis study (designed based on cDNA BC013546)PCR primersGCCGCGGCCGCTCACTGCCGGTCATACATCTCCCGT
Sequence-based reagentLin37 CD1_ASThis study (designed based on cDNA BC013546 and Mages et al., 2017)PCR primersTACAGTGGTGTGTTCTCACTGAACTGGGCCAAGTCCACAGCCCCG GCAAATAGCTTGATC
Sequence-based reagentLin37 CD2_SThis study (designed based on cDNA BC013546 and Mages et al., 2017)PCR primersACTTGGCCCAGTTCAGTGAGAACACACCACTGTACCCCATCGCCGGCGCCTGGATGCGCA
Sequence-based reagentBU1Canela et al., 2016PCR primers5′-Phos-GATCGGAAGAGCGTCGT GTAGGGAAAGAGTGUU[Biotin-dT]U [Biotin-dT]UUACACTCTTTC CCTACACGACGCTCTTCCGATC* T-3′ [*phosphorothioate bond]
Sequence-based reagentBU2Canela et al., 2016PCR primers5′-Phos-GATCGGAAGAGCACACG TCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]
Sequence-based reagent53 bp1 gRNA sequenceSequence is from Tzelepis et al., 2016N/AGAACCTGTCAGACCCGATC
Sequence-based reagentLin37 gRNA sequencesSequence is from Tzelepis et al., 2016N/AAAGCTATTTGACCGGAGTG
Sequence-based reagentBrca1 gRNA sequenceSequence is from Tzelepis et al., 2016N/AGTCTACATTGAACTAGGTA
Sequence-based reagentCtip gRNA sequenceSequence is from Tzelepis et al., 2016N/AATTAACCGGCTACGAAAGA
Sequence-based reagentBard1 gRNA sequenceSequence is from Tzelepis et al., 2016N/AAAATCGTAAAGGCTGCCAC
Sequence-based reagentBlm gRNA sequenceSequence is from Tzelepis et al., 2016N/AGATTTAACGAAGGAATCGG
Sequence-based reagentFancd2 gRNA sequenceSequence is from Tzelepis et al., 2016N/ATCTTGTGATGTCGCTCGAC
Sequence-based reagentTrp53bp1 (human) gRNA sequenceSequence is from Tzelepis et al., 2016N/ATCTAGTGTGTTAGATCAGG
Sequence-based reagentLin37 (human) gRNA sequenceSequence is from Tzelepis et al., 2016N/ATCTAGGGAGCGTCTGGATG
Software, algorithmImage JNIHRRID:SCR_003070
Software, algorithmFlowJoFlowJoRRID:SCR_008520
Software, algorithmPrismGraphPadRRID:SCR_002798
Software, algorithmSeqKitShen et al., 2016RRID:SCR_018926
Software, algorithmBowtieLangmead et al., 2009RRID:SCR_005476
Software, algorithmSAMtoolsLi et al., 2009RRID:SCR_002105
Software, algorithmBEDtoolsQuinlan and Hall, 2010RRID:SCR_006646
OthersLSRII flow cytometerBD BiosciencesRRID:SCR_002159
OthersFACSAria II Cell SorterBD BiosciencesRRID:SCR_018934
OthersLionheart LX automated microscopeBioTex InstrumentRRID:SCR_019745
Others4-D NucleofectorLonzaNA

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)