An inhibitory circuit from central amygdala to zona incerta drives pain-related behaviors in mice
- National Center for Complementary and Integrative Health, United States
- National Institute of Mental Health, United States
- National Institutes on Drug Abuse, National Institutes of Health, United States
Figures
Figure 1 with 2 supplements
CeA-PKCδ neurons efferent targets.
(A) Schematic of experimental approach. AAV-DIO-mCherry was unilaterally injected into the CeA of PKCδ-cre mice. A representative coronal brain slice of an injected mouse is shown on the right …
Figure 1—figure supplement 1
Rostral-caudal distribution of viral injection sites within the CeA of mice used for anatomical experiments.
(A) Schematic of experimental approach. AAV-FLEX-ChrimsonR-tdTomato or AAV-DIO-mCherry was unilaterally injected into the CeA of PKCδ-cre mice. A representative coronal brain slice of mouse injected …
-
Figure 1—figure supplement 1—source data 1
Source data for quantification of CeA neurons transduced with ChrimsonR-tdTomato or mCherry.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Rostral-caudal distribution of CeA-PKCδ terminals in ZI.
(A) Schematic of experimental approach. AAV-FLEX-ChrimsonR-tdTomato or AAV--DIO-mCherry was unilaterally injected into the CeA of PKCδ-cre mice. Terminal densities and distributions were evaluated …
-
Figure 1—figure supplement 2—source data 1
Source data for quantification of CeA-PKCδ axonal terminal density within the ZI.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig1-figsupp2-data1-v2.xlsx
Figure 2 with 1 supplement
CeA-PKCδ inhibitory projections to the ZI (A) Schematic drawing of retrograde tracing experimental approach (left panel).
Fluorescently tagged cholera toxin B (CTB-647) was injected into the ZI of a PKCδ-cre::Ai9 mouse brain. A representative coronal brain slice depicting the focal injection of CTB-647 (cyan) into the …
-
Figure 2—source data 1
Source data for anatomical and electrophysiological validation of CeA-PKCd to ZI pathway.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Anatomical validation of CeA-PKCd to ZI pathway using retrograde tracer approach.
(A) Representative images of coronal brain slices at different rostral-caudal levels containing the CeA of PKCδ-cre:Ai9 mice injected with the fluorescently tagged retrograde tracer cholera toxin B …
-
Figure 2—figure supplement 1—source data 1
Source data for quantification of CTB-647 and PKCδ-tdTomato positive neurons in the CeA.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig2-figsupp1-data1-v2.xlsx
Figure 3 with 1 supplement
Inhibition of GABAergic ZI neurons is sufficient to induce bilateral tactile and pressure hypersensitivity in uninjured mice.
(A) Schematic of the experimental approach. VGAT-cre mice were stereotaxically injected with hM4Di into the ZI. Current-clamp recordings were obtained from hM4Di-positive cells in acute ZI slices 2 …
-
Figure 3—source data 1
Source data for chemogenetic inhibition of ZI-GABAergic neurons.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Responses to thermal stimuli are unaltered by chemogenetic inhibition of ZI-GABAergic neurons.
(A) Rostral-caudal distribution of hM4Di injection sites in mice used for behavioral experiments. Drawings of injection sites throughout the VGAT-cre mice brains injected with hM4Di into the ZI. …
-
Figure 3—figure supplement 1—source data 1
Source data for thermal responses to chemogenetic inhibition of ZI-GABAergic neurons.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig3-figsupp1-data1-v2.xlsx
Figure 4 with 2 supplements
Activation of GABAergic ZI neurons reverses cuff-induced hypersensitivity to pinch stimulation.
(A) VGAT-cre mice were injected with hM3Dq or mCherry into the ZI. Low-magnification representative image of a coronal brain slice shows the site of virus injection in red. The area delineated by …
-
Figure 4—source data 1
Source data for chemogenetic activation of ZI-GABAergic neurons.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Rostral-caudal distribution of hM3Dq injection sites in mice used for behavioral experiments.
Drawings of injection sites throughout the VGAT-cre mice brains injected with hM3Dq into the ZI. Individual mice are represented in different color.
Figure 4—figure supplement 2
Cuff-induced thermal hypersensitivity is unaltered by chemogenetic activation of ZI-GABAergic neurons.
(A) Rostral-caudal distribution of mCherry injection sites in mice used for behavioral experiments. Drawings of injection sites throughout the VGAT-cre mice brains injected with mCherry into the ZI. …
-
Figure 4—figure supplement 2—source data 1
Source data for thermal responses to chemogenetic activation of ZI-GABAergic neurons in cuff implanted mice.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig4-figsupp2-data1-v2.xlsx
Figure 5 with 1 supplement
Optogenetic inhibition of CeA-PKCδ terminals in ZI reverses cuff-induced hypersensitivity.
(A) Schematic of experimental approach. PKCδ-cre mice were stereotaxically injected with NpHR-mCherry or control-mCherry virus into the CeA and simultaneously implanted with an optic fiber above the …
-
Figure 5—source data 1
Source data for optogenetic inhibition of CeA-PKCδ terminals in ZI.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Rostral-caudal distribution of injection sites in PKCδ-cre mice used for optogenetics behavioral experiments.
Drawings of injection sites injected into CeA with (A) control-mCherry (B) NpHR-mCherry and (C) ChR2-mCherry. Individual mice are represented in different color.
Figure 6
Inhibition of CeA-PKCδ terminals in ZI reduces cuff-induced tactile and thermal hypersensitivity.
(A) Experimental timeline of viral infection in CeA, optic probe implantation in ZI, cuff implantation in sciatic nerve and battery of nociceptive behavior tests. (B–D) Different modalities of pain …
-
Figure 6—source data 1
Source data for behavioral responses to tactile, cold and heat stimulation after optogenetic inhibition of CeA-PKCδ terminals in ZI.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig6-data1-v2.xlsx
Figure 7
Optogenetic activation of CeA-PKCδ terminals in ZI induces pain related hypersensitivity in uninjured paw.
(A) Schematic of experimental approach. PKCδ-cre mice were stereotaxically injected with ChR2-mCherry or control-mCherry virus into the CeA and simultaneously implanted with an optic fiber above the …
-
Figure 7—source data 1
Source data for optogenetic activation of CeA-PKCδ terminals in ZI.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig7-data1-v2.xlsx
Figure 8
Activation of CeA-PKCδ terminals in ZI induces pain related tactile and thermal hypersensitivity in uninjured paw.
(A) Experimental timeline of viral infection in CeA, optic probe implantation in ZI, cuff implantation in sciatic nerve and battery of nociceptive behavior tests. (B–D) Different modalities of pain …
-
Figure 8—source data 1
Source data for behavioral responses to tactile, cold and heat stimulation after optogenetic inhibition of CeA-PKCδ terminals in ZI.
- https://cdn.elifesciences.org/articles/68760/elife-68760-fig8-data1-v2.xlsx
Figure 9
Proposed model for modulation of pain-related behaviors in the ZI.
Schematic drawing showing activation of CeA-PKCδ neurons after nerve injury, which leads to inhibition of VGAT-positive ZI neurons (ZI-VGAT), subsequently promoting behavioral hypersensitivity.
Tables
Table 1
CeA-PKCδ neuronal efferent targets.
Semi-quantitative analysis of the density of axonal terminals in brain regions from 5 PKCδ-Cre mice stereotaxically injected with an adeno-associated virus expressing the cre-dependent gene …
| Area | Abbreviations | ET832 mCherry | ET835 mCherry | ET 987 ChrimsonR | ET 903 ChrimsonR | Allen Brain Atlas EGFP |
|---|---|---|---|---|---|---|
| Striatum and Basal Forebrain | ||||||
| Bed nucleus of stria terminalis | BNST | +++ | +++ | +++ | +++ | +++ |
| Globus pallidus | GP | ++ | + | + | + | + |
| Extended amygdala | EA | +++ | +/++ | +++ | +++ | +++ |
| Central amygdala | CeA | ++ | +/++ | +++ | +++ | ++ |
| Substantia innominata | SI | ++ | +/++ | ++ | ++ | ++ |
| Thalamus | ||||||
| Subthalamic nucleus | STh | + | - | ++ | + | - |
| Zona Incerta | ZI | ++ | - | ++ | + | + |
| Para subthalamic nucleus | PSTh | +/++ | + | ++ | ++ | - |
| Hypothalamus | ||||||
| lateral preoptic area | LPO | +/++ | + | + | + | + |
| Lateral hypothalamus | LH | +/++ | + | + | + | + |
| Midbrain | ||||||
| Ventral tegmental area | VTA | +/++ | - | +/++ | + | - |
| Substantia nigra | SN | ++ | + | ++ | +/++ | - |
| Pedunculopontine tegmental nucleus | PTg | ++ | - | + | + | - |
| Laterodorsal tegmental nucleus | LDTg | - | + | + | + | - |
| Periaqueductal grey | PAG | - | + | +/++ | + | - |
| Reticular formation | mRT | +/++ | +/++ | +/++ | + | - |
| Pons | ||||||
| Lateral parabrachial | LPB | ++/+++ | + | +++ | +++ | - |
| Locus coeruleus | LC | ++ | + | + | + | - |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | PKCδ-cre mice | GENSAT | founder line 011559-UCD | |
| Genetic reagent (M. musculus) | Ai9 mice | Jackson Laboratories | Stock number 007909 | |
| Genetic reagent (M. musculus) | Vesicular GABA transporter Cre mice | Jackson Laboratories | Stock number 016962 | |
| Genetic reagent (M. musculus) | C57BL/6NJ mice | Jackson Laboratories | Stock number 005304 | |
| Transfected construct (M. musculus) | pAAV8-hSyn-DIO-hM4D(Gi)-mCherry | Addgene; donated by Bryan Roth Krashes et al., 2011 | Addgene:#44362-AAV8 | |
| Transfected construct (M. musculus) | pAAV8-hSyn-DIO-mCherry | Addgene; donated by Bryan Roth | Addgene:#50459-AAV8 | |
| Transfected construct (M. musculus) | pAAV8-hSyn-DIO-hM3D(Gq)-mCherry | Addgene; donated by Bryan Roth Krashes et al., 2011 | Addgene:#44361-AAV8 | |
| Transfected construct (M. musculus) | AAV9-Syn-Flex-ChrimsonR-tdTomato | UNC; donated by Edward Boyden | Lot Number AV4384G | |
| Transfected construct (M. musculus) | rAAV2-hSyn-hChR2(H134R)-EYFP-WPRE-PA | UNC; donated by Karl Deisseroth | Lot Number AV6556C | |
| Transfected construct (M. musculus) | pAAV8-EF1a-double floxed-hChR2 (H134R)-mCherry-WPRE-HGHpA | Addgene; donated by Karl Deisseroth | Addgene:#20297-AAV8 | |
| Transfected construct (M. musculus) | AAV2-EF1a-DIO-eNpHR3.0-mCherry | UNC; donated by Karl Deisseroth | Lot Number AV4872B | |
| Transfected construct (M. musculus) | AAV2-EF1a-DIO mCherry | UNC; donated by Bryan Roth | Lot Number AV4735E | |
| Antibody (rat monoclonal) | rat anti-mCherr | Invitrogen | M11217 | 1:500 |
| Antibody (rabbit monoclonal) | rabbit anti-Phospho-c-Fos (Ser32) | Cell Signaling Technology | 5348 | 1:2000 |
| Antibody (mouse monoclonal) | mouse anti-PKCδ | BD Biosciences | 610397 | 1:1000 |
| Antibody (goat polyclonal) | goat anti-rat Cy3 | Invitrogen | A10522 | 1:250 |
| Antibody (goat polyclonal) | Alexa Fluor 647-conjugated goat anti-rabbit | Invitrogen | A21244 | 1:250 |
| Antibody (goat polyclonal) | Alexa Fluor 647-conjugated goat anti-mouse | Invitrogen | A21235 | 1:100 |
| Sequence-based reagent | Forward primer to genotype for the presence of cre-recombinase: TTAATCCATATTGGCAGAACGAAAACG | Transnetyx | Transnetyx.com | |
| Sequence-based reagent | Reverse primer to genotype for the presence of cre-recombinase: AGGCTAAGTGCCTTCTCTACA | Transnetyx | Transnetyx.com | |
| Peptide, recombinant protein | Alexa Fluor 647-conjugated cholera toxin subunit B | Invitrogen | C34778 |
