Discovery and characterization of Hv1-type proton channels in reef-building corals
- Departmento de Fisiología, Facultad of Medicina, Universidad Nacional Autónoma de México, Mexico
- Unidad Académica de Sistemas Arrecifales, Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, Mexico
- EvoDevo Research Group, Unidad Académica de Sistemas Arrecifales, Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, Mexico
- Department of Physiology and Biophysics, School of Medicine, Virginia Commonwealth University, United States
- Departmento of Neurociencia Cognitiva, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Mexico
Figures
Figure 1 with 2 supplements
Conservation and phylogenetic relationships of Hv1 channels.
(A) The tree obtained from a multiple sequence alignment from Hv1 channels in CLUSTAL-O. Highlighted in red and yellow are the branches containing coral Hv1 sequences. (B) Consensus logo sequences …
-
Figure 1—source code 1
Code for generating the tree in Figure 1.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig1-code1-v1.xlsx.zip
Figure 1—figure supplement 1
Some characteristics of Hv1 from Acropora palmata.
(A) Comparison of the amino acid sequence of Hv1s from Acropora millepora (Am) and Acropora palmata (Ap). The asterisks below each residue indicate identity. (B) Currents elicited from an inside-out …
Figure 1—figure supplement 2
Comparison of the sequence of AmHv1 to other voltage-sensing proteins.
Voltage-sensing phosphatases like CiVSP, and TPTE and TPTE2 membrane proteins contain a voltage-sensing domain (VSD). Other proteins such as TMEM266 also contain VSDs. Sequence similarity can be …
Figure 2 with 1 supplement
Protein sequence alignment of the AmHv1 channel with selected Hv1s from other organisms.
(A) Amino acid sequence alignment of Acropora millepora Hv1 (AmHv1) with other known Hv1 orthologs provided by the CLUSTAL-O algorithm. The predicted transmembrane domains are shown by the colored …
Figure 2—figure supplement 1
Comparison of the AmHv1 protein sequence with similar sequences found in other coral species.
Species for which transcriptomes are available at Reefgenomics.org and https://dornsife.usc.edu/labs/carlslab/data/ are Acropora palmata, Acropora tenuis, Posillopora damicornis, Posillopora …
Figure 3
Subunits of the AmHv1 channel associate to form dimers.
(A) Probability of coiled-coil formation per amino acid residue of the C-terminus domain of hHv1 (top) and Acropora millepora Hv1 (AmHv1) (bottom). The different colors correspond to the three …
-
Figure 3—source data 1
Source data for Figure 3.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig3-data1-v1.xlsx
Figure 4
Proton currents mediated by AmHv1 expressed in HEK293 cells.
(A) A typical proton current family elicited by depolarizing pulses from −50 to 60 mV in 10 mV intervals. The duration of the pulses is 500 ms. Linear current components have been subtracted. (B) …
-
Figure 4—source data 1
Source data for Figure 4.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig4-data1-v1.xlsx
Figure 5
Coral Hv1 channels are faster and activate more readily than their human counterpart.
(A) Acropora millepora Hv1 (AmHv1) currents in response to voltage-clamp pulses from −100 to 120 mV and of 500 ms duration. (B) AmHv1 currents in response to the same voltage-clamp pulses as in (A) …
-
Figure 5—source data 1
Source data for Figure 5.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig5-data1-v1.xlsx
Figure 6 with 2 supplements
Modulation of channel activation by the pH gradient.
(A) Conductance vs voltage relationships obtained at the indicated ΔpH values, from whole-cell recordings of Acropora millepora Hv1 (AmHv1) proton currents. Continuous lines are fits to Equation 1. …
-
Figure 6—source data 1
Source data for Figure 6.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Equations for the model in Figure 7.
These equations describe the steady-state open probability of the channel as a function of voltage and the internal and external pH.
Figure 6—figure supplement 2
Simulations of the voltage- and pH-dependent behavior predicted by the allosteric model.
(A) Calculated conductance-voltage (G-V) curves and (B) V0.5 as a function of ΔpH. The range of ΔpH values is the same for both the panels. Model parameters are pKo, pKi = 7, K(0) = 0.00005, q = 1 eo…
-
Figure 6—figure supplement 2—source code 1
Source code for Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig6-figsupp2-code1-v1.xlsx.zip
Figure 7
Gating scheme I.
(A) Modular representation of a simple Monod-Wyman-Changeux (MWC) model; the channel opening transition is voltage-dependent, with equilibrium constant K(V). Bo and Bi are the unbound states of the …
Figure 8
Block of AmHv1 channels by extracellular zinc.
(A) Acropora millepora Hv1 (AmHv1)-mediated currents from an outside-out patch in the absence (top) and presence of 10 μM zinc (middle) and after washing of zinc (bottom). The scale bars apply to …
-
Figure 8—source data 1
Source data for Figure 8.
- https://cdn.elifesciences.org/articles/69248/elife-69248-fig8-data1-v1.xlsx
Tables
Table 1
Oligonucleotides used to clone amino- and carboxy-terminal partial sequences of AmHv1 from total reverse-transcribed mRNA from A. millepora.
| Oligo name | Sequence |
|---|---|
| AcHvNt5´ | ATGATTGATGCAAGAACCAGACGATCGAGCATGGATGAT |
| AcHvNt3´ | TGATCCTGCTCTCAAGTCAAGAACCAACTCAGCAATGAC |
| AcHvCt5´ | ATGGGATTCACATTTTCAAGCACAAATGGAGGTGTTT |
| AcHvCt3´ | TCAGCTTTGTTTTAATGTTGTCAATTCAGACTCCAACTG |
