An autoinhibitory clamp of actin assembly constrains and directs synaptic endocytosis
- Department of Biology, Brandeis University, United States
- Department of Biochemistry and NCCR Chemical Biology, University of Geneva, Switzerland
- Department of Mathematics, Brandeis University, United States
Figures
Figure 1 with 2 supplements
Synaptic actin patches are dynamic WASp-dependent structures.
(A) Representative maximum intensity projections (MaxIPs) of single spinning disc confocal microscopy time points, showing C155-Gal4-driven actin probes GFP::actin, GMA, and Lifeact::Ruby. (B–D) …
-
Figure 1—source data 1
Source data for Figure 1 and associated figure supplements.
Source data quantifying raw actin patch dynamics data for control actin markers. Source data quantifying Pearson’s correlation values between Lifeact::Ruby, clc::GFP, BRP::GFP, and Arp3::GFP. Source data quantifying actin patch dynamics data for control and WASp mutant neuromuscular junctions (NMJs). Source data quantifying raw actin patch dynamics data for control and WASp mutant NMJs. Source data quantifying raw data measuring WASp::Myc levels at control and Wsp RNAi NMJs. Source data quantifying raw patch frequency values in control NMJs and % difference between control and WASp mutant NMJs measured over the indicated parameter space. Samples analyzed are the same video dataset as in Figure 1G–I.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig1-data1-v1.zip
Figure 1—figure supplement 1
Additional characterization of actin patches.
Figure 1—figure supplement 2
Actin dynamics analysis is robust to tracking parameters.
(A) Quantification of patch frequency in the control genotype of Figure 1G–I across a range of patch detection and tracking parameters. Link distance and patch detection threshold have a small …
Figure 2
Periactive zone proteins accumulate broadly across the NMJ.
(A) The periactive zone (PAZ) proteins Nwk (magenta) and Dap160 (green) accumulate in a micron-scale mesh adjacent to active zones (AZ) (Bruchpilot, blue). Image shows maximum intensity projection …
-
Figure 2—source data 1
Source data for Figure 2.
Source data quantifying Pearson R values between Nwk, WASp, and GMA. Source data quantifying Pearson R values between Dap160, WASp, and GMA.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig2-data1-v1.zip
Figure 3 with 2 supplements
Distinct SH3-SH3 and SH3-BAR domain interactions drive Dap160-Nwk association in vitro and at synapses.
(A) Model for autoinhibition of Nwk membrane binding and WASp activation. Neither membrane-bound nor membrane-free Nwk efficiently activates WASp-mediated actin polymerization, due to persistent …
-
Figure 3—source data 1
Source data for Figure 3 and associated figure supplements.
Whole Coomassie gels measuring the interaction between GST-Dap160 fragments and Nwk proteins, as indicated in each file name. Collected and annotated gels for Figure 3B with lanes and constructs labeled. Quantification of blots for Figure 3B. Quantification of Nwk intensity in Dap160 rescue larvae, also containing raw data for Figure 3—figure supplement 2B (Dap160 transgene abundance). Source data quantifying Nwk-Dap160 transgene colocalization and intensity in Dap160 rescue larvae; also containing raw data for Figure 3—figure supplement 2C (Dap160 transgene abundance). Collected and annotated gels measuring Dap160 fragment pulldowns of Nwk SH3b for Figure 3—figure supplement 1A with lanes and constructs labeled. Raw gels for Figure 3—figure supplement 1A. Raw data quantifying Figure 3—figure supplement 1A. Collected and annotated gels measuring Dap160 fragment pulldowns of Nwk FBAR in Figure 3—figure supplement 1B with lanes and constructs labeled. Raw gels for Figure 3—figure supplement 1B. Data quantifying Dap160 fragment pulldowns of Nwk FBAR. Raw data quantifying Dap160 abundance in control and dap160 rnai-expressing NMJs.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig3-data1-v1.zip
Figure 3—figure supplement 1
Domain specific interactions between Dap160 and Nwk.
(A, B) Glutathione-S-transferase (GST) fusion proteins were immobilized on glutathione agarose and incubated with the indicated purified proteins. Pellets and supernatants were fractionated by …
Figure 3—figure supplement 2
Validation of Dap160 transgene rescue and knockdown experiments.
(A) Schematic of Dap160 rescue transgenes used in in vivo and Nwk fragments used in in vitro experiments. (B, C) Quantification of Dap160 variant transgene expression (mCherry signal) at …
Figure 4
Nwk, Dap160, and PI(4,5)P2 potentiate WASp-mediated actin assembly at membranes.
(A, B) Pyrene-actin assembly assay (2.5 µM actin, 5% pyrene-labeled). Curves are representative single experiments demonstrating actin assembly kinetics; graphs represent rates calculated from the …
-
Figure 4—source data 1
Source data for Figure 4.
Raw data quantifying pyrene-actin assembly kinetics with Nwk, Dap160, and WASp. Raw data quantifying pyrene-actin assembly kinetics with Nwk, Dap160, WASp, and liposomes.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig4-data1-v1.zip
Figure 5 with 1 supplement
Dap160SH3CD and WASp promote Nwk membrane association.
(A–C) Liposome cosedimentation assays between the indicated purified proteins and liposomes composed of [mol% = DOPC/DOPE/DOPS/PI(4,5)P2 = 80-x/15/5/x], with x representing PI(4,5)P2 concentration …
-
Figure 5—source data 1
Source data for Figure 5 and associated figure supplements.
Source data quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Annotated gels quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Raw gels quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Annotated gels quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Raw gels quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Source data quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Source data quantifying FRAP recovery and curve fitting of Nwk::GFP in control and dap160 RNAi-expressing neuromuscular junctions (NMJs). Annotated gels quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments. Raw gels quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments. Source data quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig5-data1-v1.zip
Figure 5—figure supplement 1
Membrane binding and bending by Dap160-WASp-Nwk.
(A) Cosedimentation assay between the indicated purified proteins and liposomes composed of [mol% = DOPC/DOPE/DOPS/PI(4,5)P2 = 75/15/5/5]. Dap160SH3CD is unable to enhance membrane binding of NwkΔSH3…
Figure 6 with 2 supplements
Loss of the Dap160-Nwk interaction disrupts actin patch dynamics at synapses in vivo.
(A, D) Maximum intensity projections (MaxIPs) of live spinning disc confocal micrographs of presynaptically expressed GMA in muscle 6/7 neuromuscular junctions (NMJs) of the indicated genotypes, …
-
Figure 6—source data 1
Source data for Figure 6 and associated figure supplements.
Source data quantifying actin patch dynamics in control and nwk mutant neuromuscular junctions (NMJs). Source data quantifying actin patch dynamics in control and Dap160 transgene rescue NMJs. Source data showing raw patch frequency values in control NMJs and % difference between control and nwk mutant NMJs measured over the indicated parameter space. Samples are the same video dataset as in Figure 6A–C. Data showing the coefficient of variation over time of GMA signal intensity in control and nwk mutant NMJs. Samples are the same video dataset as in Figure 6A–C. Data showing the area fraction of highly variant (Std Dev over time) pixels in control and nwk mutant NMJs, thresholded by two methods. Samples are the same video dataset as in Figure 6A–C.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig6-data1-v1.zip
Figure 6—figure supplement 1
Analysis of actin dynamics is robust to tracking parameters at 1 Hz imaging.
(A) Quantification of patch frequency in the control genotype of Figure 6A–C across a range of patch detection and tracking parameters. Consistent with the 0.25 Hz imaging (Figure 1—figure …
Figure 6—figure supplement 2
Validation of actin particle analysis in nwk mutants.
(A) Coefficient of variation (CoV) projections of timelapse videos of GMA dynamics in control and nwk mutant neuromuscular junctions (NMJs) (analysis of the same dataset as shown in Figure 6A–C; …
Figure 7 with 3 supplements
Actin patches and the Nwk-Dap160 interaction are associated with synaptic endocytosis.
(A, B) Sum intensity projection (A) and representative kymographs (B) of spinning disc confocal timelapse of presynaptically expressed Lifeact::Ruby and clc::GFP. (A) Sum projection of 41 frames (82 …
-
Figure 7—source data 1
Source data for Figure 7 and associated figure supplements.
Source data showing intensity dynamics over time from the kymographs shown in Figure 7A. Contains raw Pearson’s correlation values between Lifeact::Ruby, clc::GFP, BRP::GFP, and Arp3::GFP. Source data quantifying actin dynamics in control and shiTS1 mutant neuromuscular junctions (NMJs). Source data quantifying FM dye uptake in control and nwk mutant NMJs. Source data quantifying FM dye uptake in control and Dap160 transgene rescue NMJs. Source data quantifying the radial distribution (from edge to center of boutons) of AP2 and Clc. Source data quantifying colocalization between AP2 and Lifeact::Ruby. Source data quantifying satellite bouton counts in Dap160 transgene rescue NMJs. Source data quantifying FM dye uptake and unloading in control and nwk mutant NMJs. Source data quantifying FM dye uptake and unloading in control and Dap160 transgene rescue NMJs.
- https://cdn.elifesciences.org/articles/69597/elife-69597-fig7-data1-v1.zip
Figure 7—figure supplement 1
Colocalization of actin with AP2α and Clathrin light chain.
(A) Clc::GFP and AP2α::GFP are enriched at the synaptic plasma membrane. Images show single plane Z-slices of the mid-bouton region (effectively a cross-section through the bouton) from live …
Figure 7—figure supplement 2
All Dap160 transgenes rescue dap160 satellite bouton phenotype.
(A) Maximum intensity projections (MaxIPs) of epifluorescence micrographs of muscle 4 neuromuscular junctions (NMJs) stained for anti-HRP (magenta) and anti-Dlg (green). Dap160 RNAi-expressing NMJs …
Figure 7—figure supplement 3
nwk and dap160 domain mutants do not disrupt FM dye unloading.
Loading and unloading of FM dyes in nwk and dap160 domain mutants by stimulation in 90 mM KCl + 2 mM CaCl2. (A, D) Maximum intensity projections (MaxIPs) of spinning disc confocal stacks acquired …
Videos
Video 1
Dynamics of actin patches labeled by complementary reporters.
Video 2
Loss of nwk increases the frequency of brief actin patches.
Video 3
Clc-GFP and Lifeact::Ruby partially colocalize.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) | nwk | GenBank | FLYB: FBgn0263456 | |
| Gene (D. melanogaster) | dap160 | GenBank | FLYB: FBgn0023388 | |
| Gene (D. melanogaster) | wsp | GenBank | FLYB: FBgn0024273 | |
| Gene (D. melanogaster) | shi | GenBank | FLYB: FBgn0003392 | |
| Gene (D. melanogaster) | clc | GenBank | FLYB: FBgn0024814 | |
| Gene (D. melanogaster) | AP-2α | GenBank | FLYB: FBgn0264855 | |
| Genetic reagent (D. melanogaster) | AP2α::GFP | This study | Maintained in Kaksonen Lab - see 'Methods' for description | |
| Genetic reagent (D. melanogaster) | w; UAS-WASp::TEV-Myc IIB (chromosome II insertion) | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Genetic reagent (D. melanogaster) | w; UAS-GFP::Moesin Actin Binding Domain (GMA) | Bloomington Drosophila Stock Center | BDSC:31776; FLYB: FBti0131132; RRID:BDSC_31777 | FlyBase symbol: P{UAS-GMA}3 |
| Genetic reagent (D. melanogaster) | w; UAS-Lifeact::Ruby | Bloomington Drosophila Stock Center | BDSC:35545; FLYB: FBst0035545; RRID:BDSC_35545 | FlyBase symbol: P{UAS-Lifeact-Ruby}VIE-19A |
| Genetic reagent (D. melanogaster) | w; UAS-Arp3::GFP | Bloomington Drosophila Stock Center | BDSC: 39722; FLYB: FBst0039722; RRID:BDSC_39722 | FlyBase symbol: P{w[+mC]=UASp-Arp3.GFP}3 |
| Genetic reagent (D. melanogaster) | w; e1, wsp1/TM6b,Tb | Bloomington Drosophila Stock Center | BDSC: 51657; FLYB: FBst0051657; RRID:BDSC_51657 | FlyBase symbol: e[1] WASp[1] |
| Genetic reagent (D. melanogaster) | w; UAS-GFP::actin | Bloomington Drosophila Stock Center | BDSC: 9258; FLYB: FBst0009258; RRID:BDSC_9258 | FlyBase symbol: P{w[+mC]=UASp-GFP.Act5C}2-1 |
| Genetic reagent (D. melanogaster) | yv; P{TRiP.HMC03360}attP40 - Wasp RNAi | Bloomington Drosophila Stock Center | BDSC: 51802; FLYB: FBst0051802; RRID:BDSC_51802 | FlyBase symbol: P{y[+t7.7] v[+t1.8]=TRiP.HMC03360}attP40 |
| Genetic reagent (D. melanogaster) | yw; UAS-luciferase RNAi | Bloomington Drosophila Stock Center | BDSC: 31603; FLYB: FBst0031603; RRID:BDSC_31603 | FlyBase symbol: P{y[+t7.7] v[+t1.8]=TRiP.JF01355}attP2 |
| Genetic reagent (D. melanogaster) | w; UAS-Dap160ΔSH3D::mCherry VK00027 | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Genetic reagent (D. melanogaster) | w; UAS-Dap160ΔSH3CD::mCherry VK00027 | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Genetic reagent (D. melanogaster) | w; UAS-Dap160FL::mCherry VK00027 | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Genetic reagent (D. melanogaster) | yw; UAS-Dap160-RNAi | Bloomington Drosophila Stock Center | BDSC: 25879; FLYB: FBst0025879; RRID:BDSC_25879 | FlyBase symbol: P{y[+t7.7] v[+t1.8]=TRiP.JF01918}attP2 |
| Genetic reagent (D. melanogaster) | yw; Mi{PT-GFSTF.1}nwkMI05435-GFSTF.1 | Bloomington Drosophila Stock Center | BDSC: 64445; FLYB: FBst0064445; RRID:BDSC_64445 | FlyBase symbol: Mi{PT-GFSTF.1}nwk[MI05435-GFSTF.1] |
| Genetic reagent (D. melanogaster) | w; nwk2,h | Coyle et al., 2004 | FLYB: FBal0154818 | FlyBase symbol: nwk[2] |
| Genetic reagent (D. melanogaster) | w; nwk1 | Bloomington Drosophila Stock Center | BDSC: 51626; FLYB: FBst0051626; RRID:BDSC_51626 | FlyBase symbol: nwk[1] |
| Genetic reagent (D. melanogaster) | w; dap160Δ1 | Bloomington Drosophila Stock Center | BDSC: 24877; FLYB: FBst0024877; RRID:BDSC_24877 | FlyBase symbol: Dap160[Delta1] |
| Genetic reagent (D. melanogaster) | w; Df(2L)Exel6047, P{XP-U}Exel6047/CyOGFP (Dap160Df) | Bloomington Drosophila Stock Center | BDSC: 7529; FLYB: FBst0007529; RRID:BDSC_7529 | FlyBase symbol: Df(2L)Exel6047, P{w[+mC]=XP-U}Exel6047 |
| Genetic reagent (D. melanogaster) | dvglut(X)-GAL4 | Daniels et al., 2008 | FLYB: FBti0129146 | FlyBase symbol: P{VGlut-GAL4.D}NMJX |
| Genetic reagent (D. melanogaster) | elavc155-GAL4 | Bloomington Drosophila Stock Center | BDSC: 458; FLYB: FBst0000458; RRID:BDSC_458 | FlyBase symbol: P{w[+mW.hs]=GawB}elav[C155] |
| Genetic reagent (D. melanogaster) | UAS-Dcr2 | Bloomington Drosophila Stock Center | BDSC: 24646; FLYB: FBst0024646; RRID:BDSC_24646 | FlyBase symbol: P{w[+mC]=UAS-Dcr-2.D}1 |
| Genetic reagent (D. melanogaster) | CD8-mCherry | Bloomington Drosophila Stock Center | BDSC:32218; FLYB: FBst0032218; RRID:BDSC_32218 | FlyBase symbol: P{y[+t7.7] w[+mC]=10XUAS-IVS-mCD8::RFP}attP2 |
| Antibody | Rabbit α-Nwk Polyclonal | Coyle 2004 | #970 RRID:AB_2567353 | IF(1:1000), WB (1:1000) |
| Antibody | Mouse α-Brp Monoclonal | DSHB | RRID:AB_2314866 | IF(1:100) |
| Antibody | Mouse α-Myc Monoclonal | DSHB | RRID:AB_2266850 | IF(1:50) |
| Antibody | Rabbit α-Dap160 Polyclonal | Davis/Kelly | RRID:AB_2569367 | IF(1:1000) |
| Antibody | Mouse α-Xpress Monoclonal | ThermoFisher | RRID:AB_2556552 | WB(1:1000) |
| Antibody | Mouse α-Tubulin Monoclonal | Sigma | RRID:AB_477579 | WB(1:1000) |
| Antibody | α-HRP Polyclonal | Jackson ImmunoResearch | RRID:AB_2338967 | IF(1:500) |
| Recombinant DNA reagent | His-Nwk607-731 | Kelley et al., 2015 | ||
| Recombinant DNA reagent | GST | Kelley et al., 2015 | ||
| Recombinant DNA reagent | 6His-Dap160SH3C | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | 6His-Dap160SH3D | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | 6His-Dap160SH3CD | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | GST-Dap160SH3C | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | GST-Dap160SH3D | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | GST-Dap160SH3CD | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | His-Nwk1-428 | Becalska et al., 2013 | ||
| Recombinant DNA reagent | His-Nwk1-633 | Kelley et al., 2015 | ||
| Recombinant DNA reagent | His-Nwk1-731 | Kelley et al., 2015 | ||
| Recombinant DNA reagent | His-WASp1-143 | Rodal et al., 2008 | ||
| Recombinant DNA reagent | His-SNAP-Nwk1-731 | Kelley et al., 2015 | ||
| Recombinant DNA reagent | His-SNAP-Nwk1-633 | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Recombinant DNA reagent | His-SNAP-Dap160SH3CD | This study | Maintained in Rodal Lab - see 'Methods' for description | |
| Sequence-based reagent | UAS-Dap160SH3ΔCD-FWD | This paper | PCR primers | ATGAACTCGGCGGTGGATGCGTGG |
| Sequence-based reagent | UAS-Dap160SH3ΔCD-REV | This paper | PCR primers | CCACATCAGCCTTTTGGACAT |
| Sequence-based reagent | UAS-Dap160SH3ΔD-FWD | This paper | PCR primers | ATGAACTCGGCGGTGGATGCGTGG |
| Sequence-based reagent | UAS-Dap160SH3ΔD-REV | This paper | PCR primers | GAGAACCTTCACGTAAGTGGC |
| Sequence-based reagent | UAS-Dap160SH3FL-FWD | This paper | PCR primers | ATGAACTCGGCGGTGGATGCGTGG |
| Sequence-based reagent | UAS-Dap160SH3FL-REV | This paper | PCR primers | TCTTCTTGGTGGTGCCATTTG |
| Sequence-based reagent | His/GST-Dap160SH3C-FWD | This paper | PCR primers | GGAATGCGTGCCAAGCGG |
| Sequence-based reagent | His/GST-Dap160SH3C-REV | This paper | PCR primers | TTGGAGAACCTTCACGTAAGTGG |
| Sequence-based reagent | His/GST-Dap160SH3CD-FWD | This paper | PCR primers | GGAATGCGTGCCAAGCGG |
| Sequence-based reagent | His/GST-Dap160SH3CD-REV | This paper | PCR primers | TCACTTCTTGGTGGTGCCATTTGC |
| Sequence-based reagent | His/GST-Dap160SH3D-FWD | This paper | PCR primers | CAAGGTCATTGCTCTCTATCCG |
| Sequence-based reagent | His/GST-Dap160SH3D-REV | This paper | PCR primers | TCACTTCTTGGTGGTGCCATTTGC |
| Sequence-based reagent | His/GST-Dap160SH3ABCD-FWD | This paper | PCR primers | CACAGGCTCTTCCAGTGCTTGG |
| Sequence-based reagent | His/GST-Dap160SH3ABCD-REV | This paper | PCR primers | TCACTTCTTGGTGGTGCCATTTGC |
| Peptide, recombinant protein | Arp2/3 Complex | Cytoskeleton, Inc | RP01-P | |
| Biological sample (Oryctolagus cuniculus) | Rabbit Muscle | Pel-Freez | 41225 -2 | |
| Software, algorithm | Prism | Graphpad | RRID:SCR_002798 | |
| Software, algorithm | FIJI | FIJI | RRID:SCR_002285 | |
| Other | DOPC | Echelon | 1182 | |
| Other | DOPS | Avanti | 840035C | |
| Other | PI(4,5)P2 | Avanti | 840046X | |
| Other | TopFluor-PE | Avanti | 810282C | |
| Other | DOPE | Echelon | 2182 | |
| Other | FM1-43FX | ThermoFisher | F35355 | |
| Other | FM4-64FX | ThermoFisher | F34653 |
Additional files
-
Source code 1
This file contains the code used in this manuscript as follows.
Code used to generate toy data analyzed in Figure 6—figure supplement 2. Code used to analyze toy data analyzed in Figure 6—figure supplement 2. Code used to analyze channel intensity and distribution for Figure 1—figure supplement 1F, Figure 3D, Figure 3—figure supplement 2B-D, Figure 7F–I, Figure 7—figure supplement 3. Code used to analyze channel colocalization in 3D for Figure 1F, Figure 2D,F, Figure 3E, Figure 7C, Figure 7—figure supplement 1C.
- https://cdn.elifesciences.org/articles/69597/elife-69597-code1-v1.zip
-
Supplementary file 1
Summary of genotypes and statistics for all experiments in this study.
- https://cdn.elifesciences.org/articles/69597/elife-69597-supp1-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/69597/elife-69597-transrepform-v1.docx
