A zebrafish screen reveals Renin-angiotensin system inhibitors as neuroprotective via mitochondrial restoration in dopamine neurons
- Department of Bioengineering and Therapeutic Sciences and Programs in BiologicalSciences and Human Genetics, University of California, San Francisco, United States
- Graduate Program of Pharmaceutical Sciences and Pharmacogenomics, University of California, San Francisco, United States
- Tsinghua-Peking Center for Life Sciences, McGovern Institute for Brain Research, Tsinghua University, China
- Department of Pharmaceutical Chemistry, University of California, San Francisco, United States
- Graduate Program of Bioengineering, University of California, San Francisco, United States
- Department of Pathology, Stanford University School of Medicine, United States
- Small Molecule Discovery Center, University of California, San Francisco, United States
- Department of Biochemistry and Biophysics, University of California, San Francisco, United States
- Department of Cardiovascular Medicine, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, China
- Institute for Neurodegenerative Diseases (IND), UCSF Weill Institute forNeurosciences, University of California, San Francisco, United States
- Chan Zuckerberg Biohub, United States
- Bakar Computational Health Sciences Institute, University of California, San Francisco, United States
Figures
Figure 1 with 2 supplements
The zebrafish NTR-MTZ chemo-genetic DA neuron ablation model suffers from mitochondrial dysfunction that can be counteracted by PD-associated mitochondrial quality control gene activity.
(A) Confocal images of ventral forebrain DA neurons in 0.2% DMSO control and 9 mM MTZ-treated 6 days post fertilization (dpf) transgenic larval zebrafish brains show significant difference in normalized fluorescent intensity (n = 10; p < 0.05, unpaired t test). The red fluorescence in the eyes is due to pigment-derived autofluorescence. (B) Long-range PCR of mitochondrial DNA versus nuclear DNA products using ventral forebrain DA neurons from control and MTZ-treated 6 dpf larval zebrafish brains anterior to the mid-hindbrain boundary (4.5 mM, 8 hrs) (n = 4 pools of 25 larval brains per pool; p < 0.01, unpaired t test). (C) Live confocal imaging of mitochondrial dynamics with mitochondria-targeted DsRed and mitochondria-targeted photoactivatable GFP in 5dpf larvae treated with 0.2% DMSO (control) or 4.5 mM MTZ for 16 hr. Arrowheads point to the elongated appearance of mitochondria in DA axons of MTZ-treated animals. (D–H) Analysis of mitochondrial dynamics including total mitochondrial count, length, % moving, velocity, and direction of movement between control and MTZ-treated samples (n = 8–10; **p < 0.01, ****p < 0.0001, unpaired t test). (I–M) Overexpression of PD-associated human genes including PARK2, PARK6, PARK7, PARK1, and associated mutant forms. mRNAs were microinjected into one-cell stage transgenic embryos and treated with 4.5 or 9 mM MTZ at 30hpf for 24 hrs to determine the neuroprotective effect of experimental conditions compared to control GFP-encoding mRNA injection (n = 10–12; *p < 0.05, **p < 0.01, ***p < 0.001, unpaired t test).
-
Figure 1—source data 1
Dopamine neuron intensity quantification and statistical tests.
DMSO Control vs 9 mM MTZ. Human Parkin overexpression. Human PINK1 overexpression. Human DJ1 overexpression. Human alpha synuclein overexpression. Human alpha synuclein A53T overexpression.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Labeled mitochondrial DNA damage gel.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig1-data2-v1.pdf
-
Figure 1—source data 3
Labeled nuclear DNA damage gel.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig1-data3-v1.pdf
-
Figure 1—source data 4
Raw mitochondria DNA damage gel.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig1-data4-v1.pdf
-
Figure 1—source data 5
Raw nuclear DNA damage gel.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig1-data5-v1.pdf
Figure 1—video 1
Movies showing mitochondrial dynamics in DA neuronal axons.
DA neuronal axons with mitochondria-targeted DsRed and mitochondria-targeted photoactivatable GFP were visualized and recorded under a confocal microscope in 5 dpf larvae treated with 0.2% DMSO (control, Figure 1—video 1) or 4.5 mM MTZ (Figure 1—video 2) for 16 hr.
Figure 1—video 2
Movies showing mitochondrial dynamics in DA neuronal axons.
DA neuronal axons with mitochondria-targeted DsRed and mitochondria-targeted photoactivatable GFP were visualized and recorded under a confocal microscope in 5 dpf larvae treated with 0.2% DMSO (control, Figure 1—video 1) or 4.5 mM MTZ (Figure 1—video 2) for 16 hr.
Figure 2 with 4 supplements
A high throughput in vivo imaging-based chemical screen uncovers the neuroprotective effects of inhibiting the renin-angiotensin (RAAS) pathway.
(A) A flow chart outlining the screening pipeline. 5dpf transgenic larvae expressing Tg[fuguth:gal4-uas:GFP;uas:NTRmCherry] were arranged in glass bottom 96-well plates and treated with MTZ (4.5 mM, 48 hrs) along with each of the 1403 bioactive compounds (n = 3 per screening compound). The dual flashlight plot of Brain Health Score (BHS) and Strictly Standardized Mean Difference (SSMD) score was used to quantify the neuroprotective effects of all compounds in the screen. (B) Wilcoxon rank sum test was performed to compare data of all 1403 compounds with those representing RAAS inhibitors (n = 13) in the screened compound set, revealing a significantly higher SSMD score distribution in the RAAS inhibitor group (p = 0.012, Wilcoxon rank sum test). (C) Secondary hit validation. To obtain more precise data, before and after treatment imaging was carried out for each larva embedded in agarose and a treatment regimen with 9 mM MTZ for 24 hr was used. Compounds including the RAAS inhibitors and the N-acetyl cysteine (NAC) control compound were tested at 10 µM with increased sample size (n = 40 per group; *p < 0.05, **p < 0.01, ***p < 0.001, unpaired t test). (D) Confocal images of ventral forebrain DA neurons. Positive control (0.2 % DMSO), negative control (9 mM MTZ), and 9 mM MTZ +10 µM olmesartan following 24 hrs of treatment. (E) Schematic of the chronic drug treatment and behavior test for adult zebrafish. (F) Quantification of total distance traveled across 5 min recording in the home tank for adult zebrafish treated with 0.2 % DMSO (positive control), 5 mM MTZ (negative control), 5 mM MTZ +10 mM levodopa, and 5 mM MTZ +10 µM olmesartan (with daily change of drug solutions after behavioral recording). Distance recordings were conducted for baseline, 3, 6, 9, 12, and 14 days. ANOVA and post-hoc Tukey test showed significant difference in 12 and 14 days for the MTZ versus MTZ+ olmesartan-treated groups. [n = 6 (three males, three females) for MTZ and MTZ+ Olm, n = 4 (two males, two females) for DMSO control and levodopa; p < 0.01, one-way ANOVA post-hoc Tukey’s test]. (G) Mass spectrometry data of adult zebrafish homogenized brain versus body samples after 14 days of chronic treatment with Olmesartan (n = 6, three males and three females). (H) Quantification of relative fluorescent intensity of DA neurons at 6 dpf in positive control (0.2% DMSO), negative control (9 mM MTZ, 24 hr from 5 dpf to 6 dpf), agtr1a morphant +9 mM MTZ, agtr1b morphant +9 mM MTZ, agtr1a/agtr1b double morphant +9 mM MTZ, and 10 µM olmesartan +9 mM MTZ (n = 10–12; *p < 0.05, ***p < 0.001, unpaired t test).
-
Figure 2—source data 1
Secondary hit validation for RAAS compounds.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Mass spectrometry data and adult behavior.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-data2-v1.xlsx
Figure 2—figure supplement 1
Overview of the classically known renin angiotensin pathway and the inhibitors identified from our high throughput screen.
Olmesartan, captopril, and aliskiren are antihypertensive medications working on the Renin-Angiotensin Signaling (RAAS) pathway by blocking the binding of angiotensin II to the receptor, inhibiting the conversion of angiotensin I to angiotensin II, and directly inhibiting the renin enzyme respectively. Ten other RAAS inhibitors also in the 1403-compound bioactive screen are imidapril, enalaprilat, quinapril, ramipril, moexipril, enalapril, which are angiotensin converting enzyme (ACE) inhibitors, and valsartan, telmisartan, azilsartan, and eprosartan, which are angiotensin receptor blockers (ARBs).
Figure 2—figure supplement 2
Manual validation and dose response studies of RAAS inhibitors.
(A) Blind counting of ventral forebrain DA. Neurons in transgenic Tg[fuguth:gal4-uas:GFP; uas-NTRmCherry] 6dpf larvae after 24 hrs of MTZ (9 mM) and RAAS compound (10 μM) treatment (n = 6–8; *p < 0.05, ***p < 0.001, unpaired t-test compared to negative control). (B–D) Dose response studies of RAAS pathway inhibitors. Tg[fuguth:gal4-uas:GFP; uas-NTRmCherry] larvae were imaged 5dpf (Before MTZ treatment) and 6dpf (After MTZ treatment). The Y-axis is the ratio of DA neuron intensity after vs. before MTZ treatment. The MTZ concentration for all dose response studies is 10 mM. (n = 12–24; *p < 0.05, **p < 0.01, ***p < 0.001, unpaired t-test compared to negative control). (E) Quantification of ventral forebrain DA neurons in adult zebrafish under different treatment conditions (E). (F) Representative images showing ventral forebrain DA neurons in adult zebrafish under different treatment conditions. Note the preservation of DA neurons in in MTZ+ olmesartan condition. These DA neurons appeared, however, more scattered in the brain compared to control.
-
Figure 2—figure supplement 2—source data 1
Dose response quantification for captopril, aliskiren, olmesartan.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-figsupp2-data1-v1.xlsx
Figure 2—figure supplement 3
Agtr1a and Agtr1b morpholino phenotypes and western blot validation.
(A) Translational blocking morpholino (MO) designs for agtr1a and agtr1b. The mRNA target shows the site within the agtr1a and agtr1b transcripts that is targeted by the translational blocking MO. (B) Western blot image showing successful knockdown of the agtr1 protein in the agtr1a + 1 b morpholino-injected samples compared to control (β-Actin). (C) Representative confocal images of DA neurons in different treatment conditions.
-
Figure 2—figure supplement 3—source data 1
AGTR1 western blot labeled.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-figsupp3-data1-v1.pdf
-
Figure 2—figure supplement 3—source data 2
Beta actin western blot labeled.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-figsupp3-data2-v1.pdf
-
Figure 2—figure supplement 3—source data 3
AGTR1 western blot raw.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-figsupp3-data3-v1.pdf
-
Figure 2—figure supplement 3—source data 4
Beta actin western blot raw.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig2-figsupp3-data4-v1.pdf
Figure 2—figure supplement 4
Olmesartan shows neuroprotective effects post neuronal injury in the NTR-MTZ DA neuron ablation model.
(A) Timeline of chemical treatment for MTZ and olmesartan for experiment 1 (8 hr MTZ pretreatment) and experiment 2 (24hr MTZ pretreatment). After pretreating with MTZ for 8 or 24 hr, 10 μΜolmesartan was added and imaged after 16 hr (at 24 and 40 hr, respectively). For both experiments 1 and 2, MTZ concentration was 4.5 mM. (B) DA neuron intensity is significantly greater in the olmesartan-treated samples compared to MTZ alone for both 8 hr (left) and 24 hr MTZ pre-treatment groups (right) (n = 10–12; p < 0.05, unpaired t test).
Figure 3 with 1 supplement
Genetic inactivation of agtr1a and agtr1b in DA neurons is neuroprotective.
(A) Schematic showing the procedure of FACs to isolate DA neurons for qPCR analysis of RAAS pathway gene expression. (B) qPCR data of 5 dpf larval samples show the relative expression of RAAS pathway genes normalized to the house-keeping gene eef1a1, in DA neurons (red bars) versus non-DA cells (blue bars). PRR (prorenin receptor), agtr1a (Angiotensin II receptor, type 1a), agtr1b (Angiotensin II receptor, type 1b), agtr2 (Angiotensin II receptor, type 2), ace (Angiotensin I converting enzyme), ace2 (Angiotensin I converting enzyme 2) (n = 2 biological replicates, 6 technical replicates). (C) A schematic showing the conditional CRISPR design, imaging, and analysis procedure to inactivate agtr1a and agtr1b in DA neurons. (D) Confocal images of DA neurons in 5 dpf (before MTZ treatment) and 6 dpf (24 hr after 10 mM MTZ treatment) larvae injected with either the scrambled control sgRNA construct (top) or the effective agtr1a and agtr1b sgRNA construct (bottom). Yellow cells express both NTR-mCherry and Cas9. (E) Quantification shows a significant preservation of DA neuron intensity in the agtr1a and agtr1b sgRNA construct-injected animals compared to the scrambled sgRNA control upon 10 mM MTZ treatment. (n = 15, p < 0.01, unpaired t-test).
-
Figure 3—source data 1
DA neuron quantification for conditional CRISPR.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Fluorescent activated cell sorting output file.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig3-data2-v1.pdf
Figure 3—figure supplement 1
sgRNA design and validation for conditional CRISPR knockout of agtr1a and 1b in DA neurons.
(A) sgRNA target sequences (green) with PAM sites highlighted in yellow in the agtr1a (left) and agtr1b (right) genes. 8 different targets for each gene were examined to determine the highest sgRNA KO efficiency. (B) Primers used to construct template plasmids for sgRNA synthesis. sgRNA efficiency was calculated based on sequencing followed by ICE software analysis (https://ice.synthego.com/#/) comparing the knockouts to control. CRISPRScan scores with predicted efficiency is also shown in column 5. The sgRNAs highlighted in yellow were used for conditional CRISPR KO of agtr1a and agtr1b on DA neurons. (C) Schematic showing the workflow for validating successful knockout of agtr1a and agtr1b in DA neurons. After DA neuron imaging, larval zebrafish brains were dissociated and DA neurons expressing Cas9-GFP and NTR-mCherry were collected via mouth-pipetting and pooled. PCR was performed to amplify genomic DNA regions targeted by agtr1a and agtr1b sgRNAs followed by sequencing. The samples were also amplified with th primers for QC. Sequencing results were analyzed with the Synthego ICE software. In this example dataset, at least 50% or 40% of sequenced reads carry open reading frame-shifting deletions in agtr1a and agtr1b genes, respectively. The scrambled sgRNAs for agtr1a and agtr1b showed no indel mutations when compared to controls.
Figure 4 with 2 supplements
The AGTR1 Inhibitor olmesartan is neuroprotective in a chemically induced Gaucher disease model.
(A) Locomotor tracks of 5 dpf larvae treated 24 hr with 0.2 % DMSO, 500 µM CBE, 10 µM olmesartan, and 500 µM levodopa. The background subtraction method was used to identify and track movement for 5 min duration. (B) Quantification of total distance (in millimeters, mm) travelled during 5 min recordings for each sample group. Drugs were added at the indicated concentrations and incubated for 24 hr before behavioral recording (n = 12–13; *p < 0.05, ***p < 0.001, unpaired t test) (C) Confocal images of TH-immunoreactive DA neurons (red) and 5HT-immunoreactive serotonin neurons (green) in 6dpf larval zebrafish brains after treatments as indicated in (B). (D–E) Quantification of neurons in the demarcated regions as shown in (C). Fluorescent intensity was quantified using ImageJ and normalized against the control (0.2% DMSO) (n = 8; *p < 0.05, **p < 0.01, unpaired t test).
-
Figure 4—source data 1
Larval behavior total distance tracking.
TH staining quantification. 5HT staining quantification.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Dose-dependent effects of CBE on larval zebrafish.
(A) Brightfield images of 6 dpf larvae treated with CBE at varying doses (100, 500, 1000 µM) for 24 hr. No significant alterations in morphology were observed. (B–C) Confocal images of DA neurons after 24 hr of CBE treatment. Treatment with 500 µM CBE caused a significant reduction in DA neuron fluorescent intensity. CBE 1 mM was lethal to all larvae. (n = 10; p < 0.05, unpaired t test) (D) Total distance moved in a 5 min recording upon CBE treatment for 6 dpf larvae after 24 hr of chemical treatment. (n = 12, p < 0.01, unpaired t test).
Figure 4—figure supplement 2
Olmesartan and captopril are neuroprotective in a MPP+ larval zebrafish model.
(A) Timeline of the MPP+ and RAAS inhibitor treatment. (B) Olmesartan and captopril treatment showed significant neuroprotection against MPP+ (n = 10–12, *p < 0.05, **p < 0.05, unpaired t test compared to MPP+ treatment alone). (C) Confocal images of ventral forebrain DA neurons in DMSO control, MPP+, and RAAS inhibitor-treated animals after 24 hr of drug treatment.
Figure 5 with 1 supplement
DA neuron-specific RNA-seq uncovers neurotoxic insult-induced alterations of mitochondrial pathway gene expression that is in part restored by the AGTR1 inhibitor olmesartan.
(A) A schematic showing the RNA-seq procedure of larval samples from chemical treatment to FACs, library preparation, and differential gene expression analysis. (B) A heatmap of clustering analysis comparing the differential gene expression in DMSO control, olmesartan, CBE, MTZ, MTZ+ olmesartan, and CBE+ olmesartan treatment groups. Gene counts were normalized and analyzed with the R program DESeq2 package. All samples are numbered 1, 2, and 3 to indicate biological replicates. (C–D) Venn diagrams showing the overlapping gene expression alterations between different conditions: MTZ/control and CBE/control (C) and MTZ+ Olmesartan/MTZ and CBE+ Olmesartan/CBE (D) (α = 0.05, FDR = 0.1, Wald test). (E–F) Metascape ontology clusters highlighting the top enriched GO terms for differential gene expression common between that of MTZ/Control and CBE/Control (E) and that of MTZ+ olmesartan/MTZ and CBE+ olmesartan/CBE (F). The colors of the nodes correspond to significant values. The size of the nodes is proportional to the number of input genes in the GO term. The most significant GO terms in both (E) and (F) include oxidative phosphorylation, respiratory electron transport, ATP metabolic process, and inorganic cation transport.
-
Figure 5—source data 1
DESeq2 output with RefSeq (GCF_000002035.6_GRCz11).
-CBE vs Control. -CBE+ olmesartan vs CBE. -CBE vs MTZ. -MTZ+ olmesartan vs MTZ.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig5-data1-v1.xlsx
-
Figure 5—source data 2
GO analysis.
-CBE/control vs MTZ/control annotations.-CBE/control vs MTZ/control pathway enrichment. -CBE+ olm/CBE vs MTZ+ olm/MTZ annotations. -CBE+ olm/CBE vs MTZ+ olm/MTZ pathway enrichment.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig5-data2-v1.xlsx
-
Figure 5—source data 3
Cytoscape file for GO analysis CBE/control vs MTZ/control.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig5-data3-v1.cys
-
Figure 5—source data 4
Cytoscape file for GO analysis CBE+ olm/CBE vs MTZ+ olm/MTZ.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig5-data4-v1.cys
Figure 5—figure supplement 1
Quality control (QC) and pathway analysis of DA neuron-specific RNA-seq data.
(A) Representative FastQC output of a CBE-treated sample. All samples underwent FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) for quality control. Mappings were aligned with the GRCz11 genome assembly and all samples showed greater than 75% uniquely mapped reads as the example. (B) The Principal Component Analysis (PCA) plot of the RNA-seq sample replicates shows that each sample group forms distinct clusters. (C) Volcano plots showing the differential gene expression comparing CBE vs control, MTZ vs control, MTZ+ olmesartan vs MTZ, and CBE+ olmesartan vs CBE. Log transformed adjusted p-values are plotted on the y-axis and log2 fold change values are plotted on the x-axis. (α = 0.05, FDR = 0.1; Wald test) (D) Pathway enrichment analysis of the differential gene set for olmesartan treatment compared to control using gProfiler. The top 20 pathways are shown. Thirteen additional pathways (not shown) also showed significance with Padj <0.05. (E) List of top 10 upregulated genes and downregulated genes under different conditions listed in the first column.
Figure 6
The AGTR1 inhibitor olmesartan significantly rescues phenotypes in the Drosophila pink1 mutant model.
(A–F) images show the abnormal wing posture (B) and thoracic indentation (E) in the mutant compared to wild-type siblings (A,D). Quantification of %mutant individuals with abnormal wing posture (C) and thoracic indentation (F) showed a significant difference between vehicle- and drug (olmesartan)-treated samples. (G–J) Effect of olmesartan on the mitochondrial aggregation and DA neuron loss phenotypes of pink1 mutant, in comparison to DMSO control. Mitochondria are labeled with mito-GFP reporter. Data quantification shown in I, J. (n = 12; **, p < 0.01, *** p < 0.001, unpaired t-test).
Figure 7 with 1 supplement
Clinical data analysis uncovers delayed disease progression in PD patients on RAAS inhibitors.
(A) Flow chart showing the patient cohort studied in the PPMI data. Red circles indicate groups of patients on RAAS, not on RAAS, and on other anti-hypertension medications (HTN) used for the time to levodopa analysis. Green circles indicate the patient cohorts not on levodopa for 3+ years that were used for the UPDRS Part 1, 2, and 3 analyses. (B) Average time to levodopa therapy for de novo PD patients shows significant difference in patients taking RAAS inhibitors versus patients not on RAAS inhibitors (n = 96 and 212; p < 0.05, unpaired t-test) (C) Kaplan Meier survival curve showing the percentage of HTN patients free of levodopa over time for those on RAAS inhibitors versus on other anti-hypertensive medications. HTN patients on RAAS inhibitors showed greater percentage free of levodopa over time compared to patients on other HTN medications (n = 96 and 42; p < 0.05, Log-rank Mantel-cox test). (D) UPDRS Score part one shows significantly worsened (higher) scores for subsequent visits in the No RAAS group and the group using other anti-hypertensives compared to the group on RAAS inhibitors (n = 46, 24, and 103; p = 0.023, one-way ANOVA, post-hoc Tukey).
-
Figure 7—source data 1
Parkinson Progression Marker’s Initiative deidentified patient data for analysis.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig7-data1-v1.xlsx
-
Figure 7—source data 2
UPDRS Score analysis.
-RAAS vs No RAAS time to levodopa. -Part 1, 2, 3.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig7-data2-v1.xlsx
-
Figure 7—source data 3
R script for propensity score matching.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig7-data3-v1.zip
-
Figure 7—source data 4
PPMI Data and Publications Committee approval letter.
- https://cdn.elifesciences.org/articles/69795/elife-69795-fig7-data4-v1.pdf
Figure 7—figure supplement 1
Patient cohorts from PPMI data, propensity score matching, and UPDRS Part2, Part3 analysis.
(A) Baseline characteristics of the de novo PD patients on RAAS inhibitors and not on RAAS inhibitors. (B) Plots of the covariates against the estimated propensity score, separated by patients on RAAS inhibitors versus patients not on RAAS inhibitors. There was no significant difference in means upon matching (Welch two sample t-test; Age p = 0.98, Race p = 0.93, Gender p = 0.93, Caffeine intake p = 0.52, History of head injury p = 0.81, Smoking p = 0.84, Alcohol intake p = 0.91) (C) Pairwise Pearson correlation of the covariables including age, gender, duration of PD, race, time to levodopa, smoking status, caffeine, alcohol consumption, history of head injury, and RAAS inhibitor use. The lower left panel shows the correlation without matching and the upper right panel shows the correlation upon matching. Prior to matching, the RAAS cohort was significantly different in gender, age, and time to levodopa compared to the No RAAS group (*p < 0.05, **p < 0.01). Upon matching, the RAAS inhibitor use was significantly correlated with time to levodopa (*p < 0.05). (D) Mean UPDRS scores and standard deviation progression for the RAAS inhibitor, Non-RAAS, and other anti-hypertensive medication cohort starting from baseline to visit 12. (E) UPDRS part 2 and (F) part 3 progression showed no significant difference across the RAAS inhibitor, Non-RAAS, and other hypertension cohort. (n = 39–46 for RAAS cohort, n = 92–103 for No RAAS cohort, n = 21–24 for No RAAS_HTN cohort; Part 2 p = 0.53; Part 3 p = 0.85, one-way ANOVA).
Tables
Table 1
Mitochondrial function-related genes that are commonly up-regulated and down-regulated in the two types of neurotoxic insults (MTZ and CBE), and their significant changes in olmesartan-treated conditions.
Genes highlighted in blue are downregulated in the neurotoxic conditions compared to control but upregulated in olmesartan treatment compared to neurotoxic conditions. Genes highlighted in red are up-regulated in the neurotoxic conditions compared to control, but down-regulated in olmesartan treatment compared to neurotoxic conditions.
| Significantly upregulated mito-expressed genes common in MTZ/C and CBE/C | Significantly downregulated mito-expressed genes common in MTZ/C and CBE/C |
|---|---|
| Atp5l: ATP synthase, H + transporting, mitochondrial F0 complex, subunit g (C-V) coa5: cytochrome c oxidase assembly factor 5cox5aa,cox5ab,cox6a1, cox6c, cox7a2a, cox7c, cox8a, mt-co3: cytochrome c oxidase subunit 5Aa, 5Ab, 6A1, 6 C, 7A2a, 7 C, 8A, III (C-IV) cycsb: cytochrome c, somatic b (C-III) mdh2: malate dehydrogenase 2, NAD (mitochondrial) mrpl13, mrpl32, mrpl36: mitochondrial ribosomal protein L13, L32, L36mrps18c, mrps21: mitochondrial ribosomal protein s18C, S21ndufa1, ndufb2, ndufs4, ndufv2: NADH:ubiquinone oxidoreductase subunit A1, B2, S4, core subunit V2 (C-I) timm9: translocase of inner mitochondrial membrane 9tomm6, tomm20a, tomm20b: translocase of outer mitochondrial membrane 6, 20uqcc3: ubiquinol-cytochrome c reductase complex assembly factor 3uqcr10: ubiquinol-cytochrome c reductase, complex III subunit X | atad3: ATPase family AAA domain containing 3A bnip3la: BCL2 interacting protein three like cpox: coproporphyrinogen oxidase ctnnbip1: catenin beta interacting protein 1kcnh3: potassium voltage-gated channel subfamily H member 3mthfd1l: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) one like slc25a37: solute carrier family 25 member 37timm17b: translocase of inner mitochondrial membrane 17B top1mt: DNA topoisomerase I mitochondrial trim3: tripartite motif containing 3 |
| Significantly upregulated mito-expressed genes common in MTZ + Olm/MTZ and CBE + Olm/CBE | Significantly downregulated mito-expressed genes common in MTZ + Olm/MTZ and CBE + Olm/CBE |
| trim3: tripartite motif containing 3rims3: regulating synaptic membrane exocytosis 3phldb1: pleckstrin homology like domain family B member 1 | Atp5l: ATP synthase, H + transporting, mitochondrial F0 complex, subunit g cox4i2,cox5aa, cox6a1, cox6c, cox7a2a, cox7c, cox8a: cytochrome c oxidase subunit 4I2, 5Aa, 6A1, 6 C, 7A2a, 7 C, 8A cox20: cytochrome c oxidase assembly factor 20cyc1: cytochrome c-1mrpl13,mrpl33, mrpl35, mrpl54: mitochondrial ribosomal protein L13, L33, L35, L54mrps2,mrps18c,mrps36: mitochondrial ribosomal protein S2, S18C, S36, ndufa1, ndufb2, ndufs4, ndufv2: NADH:ubiquinone oxidoreductase subunit A1, B2, S4, core subunit V2timm10: translocase of inner mitochondrial membrane 10tomm6: translocase of outer mitochondrial membrane 6 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Danio rerio) | agtr1a | Ensembl | ENSDART00000021528.7 | |
| Gene (Danio rerio) | agtr1b | Ensembl | ENSDART00000066834.5 | |
| Gene (Danio rerio) | ace1 | Ensembl | ENSDART00000114637.4 | |
| Gene (Danio rerio) | agt | Ensembl | ENSDART00000010918.5 | |
| Gene (Drosophila melanogaster) | pink1 | Ensembl | FBtr0100416 | |
| Strain, strain background (Danio rerio, AB Wild Type) | AB WT | Zebrafish International Resource Center | ZFIN ID: ZDB- GENO-960809–7 | |
| Strain, strain background (Danio rerio, fuguth:gal4-uas: GFP; uas-NTRmCherry) | Tg[fuguth:gal4-uas: GFP; uas-NTRmCherry] | doi:10.1371/journal.pone.0164645 | ||
| Strain, strain background (Danio rerio, UAS:mtPAGFP: mtDsRed2) | Tg[UAS:mtPAGFP :mtDsRed2] | doi: 10.1016/jj.nbd.2016.07.020 | ZFIN ID: ZDB- TGCONSTRCT-161116–1Edward Burton Lab | |
| Strain, strain background (Danio rerio, th1:gal4; uas: NTRmCherry) | Tg[th1:gal4; uas: NTRmCherry] | doi: 10.1016/j.nbd.2016.07.020 | Jiulin Du lab | |
| Strain, strain background (Drosophila melanogaster) | PINK1B9 | doi: 10.1038/nature04788 | Gift from the Chung Lab. | |
| Strain, strain background (Drosophila melanogaster) | TH-Gal4 | DOI: 10.1002/neu.10185 | Gift from the Birman Lab. | |
| Strain, strain background (Drosophila melanogaster) | UAS-mito-GFP | doi: 10.1091/mbc.e05-06-0526 | Gift from the Saxton Lab. | |
| Genetic reagent (Morpholino Oligonucleotide) | agtr1a | Gene Tools LLC | agtr1a_MO | 0.5 mM(5'-GACGTTGTCCATTTTGGAGATTTGT-3') |
| Genetic reagent (Morpholino Oligonucleotide) | agtr1b | Gene Tools LLC | agtr1b_MO | 0.5 mM(5'-TCATTGCTGATGTTTGGTTCTCCAT-3') |
| Genetic reagent (PCR Master mix) | GoTaq Green Master Mix | Promega | M7122 | |
| Sequence-based reagent | Renin Angiotensin Pathway Primers | This Paper | PCR primers | Refer to Supplementary file 1 |
| Sequence-based reagent | Nuclear DNA_F | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’-AGAGCGCGATTGCTGGATTCAC-3’ |
| Sequence-based reagent | Nuclear DNA_R | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’-GTCCTTGCAGGTTGGCAAATGG-3’ |
| Sequence-based reagent | Mitochondria DNA_F | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’-TTAAAGCCCCGAATCCAGGTGAGC-3’ |
| Sequence-based reagent | Mitochondria DNA_R | doi: 10.1016/j.ymeth.2010.01.033 | PCR primers | 5’- GAGATGTTCTCGGGTGTGGGATGG –3’ |
| Sequence-based reagent | sgRNA primers for agtr1 | This Paper | PCR primers | Refer to Figure 3—figure supplement 1 |
| Recombinant DNA reagent | agtr1a_1b sgRNA plasmid | This Paper | Agtr1a and agtr1b sgRNA cloned into addgene: 74,009 | |
| Recombinant DNA reagent | Agtr1a_1b sgRNA scrambled | This Paper | Agtr1a and agtr1b scrambled sgRNA cloned into addgene: 74,009 | |
| Peptide, recombinant protein | Cas9-NLS protein | UC Berkeley | https://qb3.berkeley.edu/facility/qb3-macrolab/ | |
| Antibody | anti-AGTR1 (Rabbit polyclonal) | Proteintech | 25343–1-AP | WB(1:500)IF(1:500) |
| Antibody | anti-5HT (Rabbit polyclonal) | Immunostar | cat#20,080 | IF(1:1000) |
| Antibody | anti-TH (Mouse monoclonal) | Immunostar | cat#22,941 | IF(1:500) |
| Antibody | Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody | Thermofisher | Alexa Fluor 488 (cat# A-11001) | IF(1:500) |
| Antibody | Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, | Thermofisher | Alexa Fluor 568 (cat# A-11036) | IF(1:1000) |
| Antibody | chicken anti-GFP | Abcam | ab92456 | IF(1:500) |
| Antibody | rabbit anti-TH | Pel-Freez | P41301 | IF(1:1000) |
| Antibody | Goat Anti-Rabbit IgG H&L Horseradish Peroxidase conjugated antibody | Abcam | ab6721 | WB(1:1000) |
| Antibody | Rabbit Anti-Mouse IgG H&L Horseradish Peroxidase conjugated antibody | Abcam | ab6728 | WB(1:1000) |
| Commercial assay or kit | Long-Range PCR Kit | QIAGEN | cat# 206,402 | |
| Commercial assay or kit | QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina | Lexogen | cat# 015 | |
| Commercial assay or kit | QIAprep Gel Extraction Kit | Qiagen | cat# 28,704 | |
| Commercial assay or kit | Mini-PROTEAN TGX Gels | Bio-Rad | cat# 4561083 | |
| Commercial assay or kit | Trans-Blot Turbo Transfer System | Bio-Rad | cat# 1704150 | |
| Chemical compound, drug | Bioactive Compound Library | SelleckChem; curated set from UCSF Small Molecular Discovery Center | cat# L1700 | 10 µM Screening concentration |
| Chemical compound, drug | Olmesartan | Sigma-Aldrich | cat#144689-63-4 | |
| Chemical compound, drug | Aliskiren | Sigma-Aldrich | cat# 62571-86-2 | |
| Chemical compound, drug | Captopril | Sigma-Aldrich | Cat# 173334-58-2 | |
| Chemical compound, drug | Metronidazole | Selleck Chemicals | cat# S1907 | |
| Chemical compound, drug | N-acetylcysteine | Selleck Chemicals | Cat# S1623 | |
| Chemical compound, drug | Conduritol B Epoxide | Sigma Aldrich | Cat#6090-95-5 | |
| Chemical compound, drug | MPP+ | Millipore Sigma | CAS 36913-39-0 | |
| Chemical compound, drug | 1 % low melting point agarose | Sigma Aldrich | Cat#39346-81-1 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | 1.5.0 |
| Software, algorithm | Prism 7 | GraphPad | RRID:SCR_002798 | Version 7.03 |
| Software, algorithm | Matlab | Mathworks | RRID:SCR_001622 | Version R2018 |
| Software, algorithm | CellProfiler | The Broad Institute of Harvard and MIT | RRID:SCR_007358 | Version 3.1.8 |
| Software, algorithm | R DESeq2 package | Bioconductor | RRID:SCR_015687 | Version 4.0.1 |
| Software, algorithm | R MatchIt package | https://github.com/kosukeimai/MatchIt, Ho et al., 2011 | Version 4.2.0 | |
| Software, algorithm | InCell Analyzer | GE Life Sciences | RRID:SCR_015790 | Version 1.9 |
| Software, algorithm | Ethovision XT | Noldus | RRID:SCR_000441 | |
| Software, algorithm | IMARIS | Bitplane | RRID:SCR_007370 | Version 8.4 |
| Software, algorithm | Synthego ICE software | Synthego | https://ice.synthego.com/#/ | version 2.0 |
| Software, algorithm | SnapGene Viewer | SnapGene | RRID:SCR_015053 |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/69795/elife-69795-transrepform1-v1.docx
-
Supplementary file 1
Table S1 and Table S2.
- https://cdn.elifesciences.org/articles/69795/elife-69795-supp1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A zebrafish screen reveals Renin-angiotensin system inhibitors as neuroprotective via mitochondrial restoration in dopamine neurons
eLife 10:e69795.
https://doi.org/10.7554/eLife.69795
