Thrombopoietin from hepatocytes promotes hematopoietic stem cell regeneration after myeloablation
- Columbia Stem Cell Initiative, Columbia University Medical Center, United States
- Department of Rehabilitation and Regenerative Medicine, Columbia University Medical Center, United States
- Department of Microbiology and Immunology, Columbia University Medical Center, New York, United States, United States
Figures
Figure 1 with 2 supplements
Bone marrow thrombopoietin (THPO) is not required for hematopoietic recovery and hematopoietic stem cell (HSC) expansion after 5-fluorouracil (5-FU) chemoablation.
(A) Confocal images of liver sections from tamoxifen-treated ThpocreER; Rosa26LSL-ZsGreen mice 10 days after 5-FU injection. (B) Confocal images of femur sections from tamoxifen-treated ThpocreER; …
-
Figure 1—source data 1
Numerical values of the data plotted in panels E-M.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Hematopoietic recovery and hematopoietic stem cell (HSC) expansion after chemoablation with 5-fluorouracil (5-FU) depend on thrombopoietin (THPO).
(A–H) Blood cell counts of wild-type and Thpogfp/gfp mice with and without 5-FU challenge. Normalized fold changes (relative to no 5-FU challenge baseline) are also shown. n = 4–11 mice.(I–L) Bone …
-
Figure 1—figure supplement 1—source data 1
Numerical values of the data plotted in panels A-V.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig1-figsupp1-data1-v2.xlsx
Figure 1—figure supplement 2
Hematopoietic progenitor expansion after 5-fluorouracil (5-FU) chemoablation does not depend on bone marrow thrombopoietin (THPO) and THPO from bone marrow Prrx1+ mesenchymal cells is dispensable for thrombopoiesis and hematopoietic stem cell (HSC) maintenance.
(A) Relative expression of Thpo transcripts in bone marrow stromal cells 14 days after 5-FU treatment or irradiation. n = 3 mice for each condition. (B and C) Frequencies of LSKs in the bone marrow …
-
Figure 1—figure supplement 2—source data 1
Numerical values of the data plotted in panels A-N.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig1-figsupp2-data1-v2.xlsx
Figure 2 with 1 supplement
Hepatic thrombopoietin (THPO) is required for hematopoietic recovery and hematopoietic stem cell (HSC) expansion after 5-fluorouracil (5-FU) chemoablation.
(A–H) Cellularity and frequencies of HSCs (A, C, E, G) in the bone marrow and spleens from mice with Thpo conditionally deleted from hepatocytes (AAV) and controls, with and without 5-FU challenge. …
-
Figure 2—source data 1
Numerical values of the data plotted in panels A-J.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Limited impact of acute Thpo deletion from hepatocytes on leukocytes and hematopoietic progenitors after 5-fluorouracil (5-FU) treatment.
(A) Relative expression of Thpo transcripts in the liver from Thpofl/fl mice treated with PBS or AAV8-TBG-cre. n = 3 mice for each condition. (B–I) Blood cell counts in mice with Thpo conditionally …
-
Figure 2—figure supplement 1—source data 1
Numerical values of the data plotted in panels A-M.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig2-figsupp1-data1-v2.xlsx
Figure 3 with 2 supplements
Bone marrow thrombopoietin (THPO) is not required for hematopoietic recovery from irradiation.
(A) Confocal images of liver sections from tamoxifen-treated ThpocreER; Rosa26LSL-ZsGreen mice 10 days after irradiation. (B) Confocal images of femur sections from tamoxifen-treated ThpocreER; …
-
Figure 3—source data 1
Numerical values of the data plotted in panels E-M.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Hematopoietic recovery after irradiation depends on thrombopoietin (THPO).
(A–H) Blood cell counts of Thpo+/+ (+/+) and Thpogfp/gfp (gfp/gfp) mice with and without irradiation treatment. Normalized fold changes (relative to no irradiation baseline) are also shown. n = 4–7 …
-
Figure 3—figure supplement 1—source data 1
Numerical values of the data plotted in panels A-N and P-W.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig3-figsupp1-data1-v2.xlsx
Figure 3—figure supplement 2
Bone marrow thrombopoietin (THPO) is not required for hematopoietic recovery after irradiation.
(A) LSK frequencies in the bone marrow from mice with Thpo deleted from osteoblasts (Col1a1-cre), mesenchymal stromal cells (Lepr-cre), or both (Prrx1-cre), as well as controls after irradiation. n …
-
Figure 3—figure supplement 2—source data 1
Numerical values of the data plotted in panels A and B.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig3-figsupp2-data1-v2.xlsx
Figure 4 with 1 supplement
Hepatic thrombopoietin (THPO) is required for effective hematopoietic stem cell (HSC) recovery from ionizing radiation.
(A–H) Cellularity and frequencies of HSCs in the bone marrow and spleens from mice with Thpo conditionally deleted from hepatocytes (AAV) and controls with and without irradiation. Normalized fold …
-
Figure 4—source data 1
Numerical values of the data plotted in panels A-J.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Hepatic thrombopoietin (THPO) is critical for hematopoietic recovery after irradiation.
(A–H) Blood cell counts of mice with Thpo deleted from hepatocytes (AAV) as well as controls with and without irradiation. Normalized fold changes (relative to baseline) are also shown. n = 5–7 …
-
Figure 4—figure supplement 1—source data 1
Numerical values of the data plotted in panels A-L.
- https://cdn.elifesciences.org/articles/69894/elife-69894-fig4-figsupp1-data1-v2.xlsx
Author response image 1
5-FU treatment does not change Thpo transcript levels in the liver.
qPCR analysis showing the relative expression levels of Thpo transcripts in controls and 5-FU-treated mice. n = 4 mice for each condition.
Author response image 2
Deletion of Thpo from hepatocytes does not lead to changes in Vegfa expression in HSCs.
qPCR analysis showing that LSKCD150+CD48- HSCs from AAV-treated Thpofl/fl mice had similar Vegfa expression levels as PBS-treated controls. n = 3 mice for each condition.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Prrx1-cre | PMID:12112875 | JAX stock (005584) | |
| Genetic reagent (Mus musculus) | Leprcre | PMID:11283374 | JAX stock (008320) | |
| Genetic reagent (Mus musculus) | Rosa26LSL-ZsGreen | PMID:20023653 | JAX stock (007906) | |
| Genetic reagent (Mus musculus) | Col1a1-cre | PMID:15470637 | ||
| Genetic reagent (Mus musculus) | Thpogfp | PMID:29622652 | ||
| Genetic reagent (Mus musculus) | ThpocreER | PMID:29622652 | ||
| Genetic reagent (Mus musculus) | Thpofl | PMID:29622652 | ||
| Recombinant DNA reagent | AAV8-TBG-cre | Penn Vector core or Addgene | Cat# 107787-AAV8 | |
| Chemical compound, drug | 5-Fluorouracil | FreseniusKabi | Cat# 101,710 | 150 mg/kg IP |
| Chemical compound, drug | Tamoxifen | Sigma | Cat# T5648 | |
| Chemical compound, drug | Collagenase, Type IV | Worthington | Cat# LS004188 | |
| Chemical compound, drug | DNase I | Sigma | Cat# D4527 | |
| Antibody | (Rat monoclonal) anti-CD2 (RM2-5) | Biolegend | Flow cytometry (1:200) | |
| Antibody | (Rat monoclonal) anti-CD3 (17A2) | Biolegend | Flow cytometry (1:200) | |
| Antibody | (Rat monoclonal) anti-CD5 (53–7.3) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-CD8a (53–6.7) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-B220 (6B2) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-Gr1 (8C5) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-Ter119 | Biolegend | Flow cytometry (1:200) | |
| Antibody | (Rat monoclonal) anti-Sca1 (E13-161.7) | Biolegend | Flow cytometry (1:200) | |
| Antibody | (Rat monoclonal) anti-cKit (2B8) | Biolegend | Flow cytometry (1:200) | |
| Antibody | Armenian (Hamster monoclonal) anti-CD48 (HM48-1) | Biolegend | Flow cytometry (1:200) | |
| Antibody | (Rat monoclonal) anti-CD150 (TC15-12F12.2) | Biolegend | Flow cytometry (1:200) | |
| Antibody | (Rat monoclonal) anti-CD45.2 (104) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-CD45.1 (A20) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-Mac1 (M1/70) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rat monoclonal) anti-CD45 (30 F-11) | Biolegend | Flow cytometry (1:400) | |
| Antibody | (Rabbit monoclonal) anti-HNF4α (EPR16885-99) | AbCam | Cat# Ab201460 | IF (1:10) |
| Sequence-based reagent | OLD815 | IDT DNA | CCACCACCATGCCTAACTCT | |
| Sequence-based reagent | OLD816 | IDT DNA | GTTCTCCTCCACGTCTCCAG | |
| Sequence-based reagent | OLD817 | IDT DNA | TCGCTAGCTGCTCTGATGAA | |
| Sequence-based reagent | ZsGreen F | IDT DNA | GGCATTAAAGCAGCGTATCC | |
| Sequence-based reagent | ZsGreen R | IDT DNA | AACCAGAAGTGGCACCTGAC | |
| Sequence-based reagent | OLD581 | IDT DNA | CATCTCGCTGCTCTTAGCAGGG | |
| Sequence-based reagent | OLD582 | IDT DNA | GAGCTGTTTGTGTTCCAACTGG | |
| Sequence-based reagent | OLD292 | IDT DNA | CGGACACGCTGAACTTGTGG | |
| Sequence-based reagent | OLD528 | IDT DNA | ACTTATTCTCAGGTGGTGACTC | |
| Sequence-based reagent | OLD653 | IDT DNA | AGGGAGCCACTTCAGTTAGAC | |
| Sequence-based reagent | OLD434 | IDT DNA | CATTGTATGGGATCTGATCTGG | |
| Sequence-based reagent | OLD435 | IDT DNA | GGCAAATTTTGGTGTACGGTC | |
| Sequence-based reagent | OLD338 | IDT DNA | GCATTTCTGGGGATTGCTTA | |
| Sequence-based reagent | OLD339 | IDT DNA | ATTCTCCCACCGTCAGTACG | |
| Sequence-based reagent | OLD390 | IDT DNA | CCTTTGTCTATCCCTGTTCTGC | |
| Sequence-based reagent | OLD391 | IDT DNA | ACTGCCCCTAGAATGTCCTGT | |
| Sequence-based reagent | OLD27 | IDT DNA | GCTCTTTTCCAGCCTTCCTT | |
| Sequence-based reagent | OLD28 | IDT DNA | CTTCTGCATCCTGTCAGCAA | |
| Software, algorithm | FacsDiva | BD | ||
| Software, algorithm | FlowJo | FlowJo | ||
| Software, algorithm | Prism | GraphPad | ||
| Other | SuperScript III | ThermoFisher | Cat# 18080093 | |
| Other | ProtoScript II | NEB | Cat# M0368S | |
| Other | PELCO Cryo-Embedding compound | Ted Pella, Inc | Cat# 27,300 |
