1. Microbiology and Infectious Disease
  2. Structural Biology and Molecular Biophysics
Download icon

Structural characterization of NrnC identifies unifying features of dinucleotidases

  1. Justin D Lormand
  2. Soo-Kyoung Kim
  3. George A Walters-Marrah
  4. Bryce A Brownfield
  5. J Christopher Fromme
  6. Wade C Winkler
  7. Jonathan R Goodson
  8. Vincent T Lee
  9. Holger Sondermann  Is a corresponding author
  1. Department of Molecular Medicine, Cornell University, United States
  2. Department of Cell Biology and Molecular Genetics, University of Maryland, United States
  3. Department of Molecular Biology and Genetics, Cornell University, United States
  4. CSSB Centre for Structural Systems Biology, Deutsches Elektronen-Synchrotron DESY, Germany
  5. Christian-Albrechts-Universität, Germany
Research Advance
Cite this article as: eLife 2021;10:e70146 doi: 10.7554/eLife.70146
8 figures, 1 table and 3 additional files

Figures

Figure 1 with 4 supplements
The crystal structures of B. henselae nano-RNase C (NrnC) bound to pGG reveals motifs defining substrate specificity.

(A) The octameric assembly. NrnCBh is shown as surface representation in two views. Each monomer is shown in a distinct color. The cartoon illustrates the stacking of the two tetrameric NrnC rings that form the octamer with a central, round opening. (B) Active-site position. Each monomer contributes one active site, here bound to the substrate pGG, facing toward NrnC’s central pore. Each active site includes a C-terminal tail of a subunit from an adjacent ring. (C) Substrate coordination. The catalytic DEDDy motif and residues coordinating each moiety of pGG contacts are shown as sticks, with carbon residues colored according to monomer identity. Residue Y151 coordinates water molecule near the scissile bond. (D) Conservation mapping on a surface representation of a NrnC monomer. Conservation scores were calculated based on a multisequence alignments (MUSCLE; Edgar, 2004) of NrnC homologs identified using a sequence search on the EggNOG resource, version 5.0.0 (Huerta-Cepas et al., 2019) and the sequence of NrnCBh as the input. Outliers were identified based on sequence length and non-consensus insertions, resulting in a final collection of 560 sequences of putative NrnC orthologs. The two views, separated by a 180° rotation, show the cavity-facing (interior, left) and outer-facing (exterior, right) surface regions.

Figure 1—figure supplement 1
Inter- and intra-ring contacts in the NrnCBh octamer.

(A) Overview of three pGG-bound NrnCBh monomers. The monomers are shown in cartoon representation The chain colored in dark gray forms an intra-ring contact with the central, green-colored chain, whereas the chain colored in blue forms a representative inter-ring contact within the octameric nano-RNase C (NrnC). (B) Detailed intra-ring interface. (C) Detailed inter-ring interface. Residues contributing direct interactions between monomers are shown as sticks. Representative hydrogen bonds are shown as dashed lines.

Figure 1—figure supplement 2
Comparison of nano-RNase C (NrnC) to structurally related proteins reveals the constricted nature of NrnC’s active site.

(A) A pGG-bound NrnCBh inter-ring dimer (slate and green chains, with pGG carbon atoms shown in white) was superimposed on a structure of the exosome’s Rrp6 exonuclease (purple chain) bound to poly-A (pink carbon atoms; PDB:4oo1; Wasmuth et al., 2014). The inset shows a detailed view of the superimposed active sites. Numbering refers to the residues in the substrate. Phosphate cap residues of NrnC that block the path of poly-A substrate are shown as spheres. The black protein chain in top-right corner stems from an adjacent intra-ring monomer. (B) A substrate-free NrnCBm inter-ring dimer (slate and green chains) was superimposed on a structure of apo-RNase D (Zuo et al., 2005), highlighting conservation of the catalytic DEDDy motif and differences in regions around NrnC’s L-wedge and phosphate cap (inset). (C) Surface views of the active sites of NrnC, RNaseD, and Rrp6 accentuate the constraint of the NrnC active site. Translucent pGG represents modeled substrate as opposed to co-crystallized substrate.

Figure 1—figure supplement 3
Structural comparison of NrnCBh bound to various ribonucleotides.

(A) Diribonucleotide pGG-bound NrnCBh, identical to the structure shown in Figure 1. (B) Diribonucleotide pAA-bound NrnCBh. (C) Diribonucleotide pGC-bound NrnCBh. (D) Adenosine-3′,5′-bisphosphate (pAp)-bound NrnCBh. The top row of images shows nano-RNase C (NrnC) as a cartoon representation with the nucleotide substrate represented as sticks with carbon atoms colored white. Polder omit maps for each substrate are shown as blue mesh. The bottom row shows detailed views of the active site residues contacting each ribonucleotide.

Figure 1—figure supplement 4
In crystallo catalysis indicates a two-metal mechanism of NrnCBh activity.

(A) Active sites of NrnCBh•pGG, before and after soaking crystals in a solution containing Mg2+ prior to data collection. (B) Active site of NrnCBh•pGG, after soaking crystals in a solution containing Mn2+ prior to data collection. Top panels show polder omit maps highlighting nucleotide and metal density. The red density in (B) represents an anomalous-difference map calculated from data collected at the Mn2+ absorption edge. The bottom panels show specific active site contacts between protein, nucleotide, ions, and water molecules. (C) Schematic overview of two-metal coordination at the active site of nano-RNase C (NrnC).

Figure 2 with 2 supplements
Phosphate cap and L-wedge contribute to nano-RNase C’s (NrnC’s) diribonucleotidase activity.

(A) In vitro enzyme activity. Degradation of 32P-pGG (1 μM total) by purified wild-type NrnCBh or variants with alanine substitutions (5 nM) at the indicated sites was assessed. Samples were stopped at the indicated times (min) and analyzed by denaturing 20% PAGE. Representative gels are shown (left). The graph (right) shows the means and SD of three independent experiments. (B) Effect of a dinucleotide lacking the 5′ phosphate (GG) and pAp on NrnC catalysis. pGG processing was assessed as in (A) but in the presence or absence of 100-fold excess (over 32P-pGG) GpG or pAp. Representative gels (left) and quantification from three independent experiments (right) are shown. Means and SD are plotted. (C) Competition binding studies. Fraction bound of 32P-pGpG to 200 nM purified NrnCBh in the presence of no competitor, 100 µM pGG, 100 µM GpG, or 100 µM pAp is plotted as individual data, means, and SD of four independent experiments. (D) Complementation of the small-colony phenotype of P. aeruginosaorn by wild-type and mutant NrnCBh. Bacterial cultures were diluted and dripped on LB agar plates. After overnight incubation, representative images of the plates were taken (left). Experiments were performed in triplicate. Quantification of respective colony sizes is shown as violin plots (right).

Figure 2—source data 1

Source data for Figure 2A.

Original, unedited images, labeled overview, and quantification of wild-type and mutant NrnC activity using pGG as the substrate from three replicates.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig2-data1-v2.zip
Figure 2—source data 2

Source data for Figure 2B.

Original, unedited images, labeled overview, and quantification of nano-RNase C (NrnC) activity using pGG as the substrate in the presence or absence of GG or pAp from three replicates.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig2-data2-v2.zip
Figure 2—source data 3

Source data for Figure 2C.

Quantification of competition binding experiments using nano-RNase C (NrnC) and radiolabeled pGG in the presence or absence of unlabeled GG or pAp.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig2-data3-v2.zip
Figure 2—source data 4

Source data for Figure 2D.

Original, unedited images and labeled composite image of P. aeruginosa colony growth.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig2-data4-v2.zip
Figure 2—figure supplement 1
SEC-MALS of NrnCBh wild-type and mutant variants.

Molecular weight determination indicates that pGG binding does not impact oligomerization, and that purified NrnCBh point mutants remain octameric in solution. Absolute molecular weights of nano-RNase C (NrnC) are shown as orange data points across elution peaks plotted on the right axis. Theoretical oligomerization states are shown as dashed horizontal lines. 90°-light scattering: blue solid lines; refractive index signal: black dashed lines; plotted on left axis.

Figure 2—figure supplement 2
Expression of NrnCBh wild-type and mutant variants in P. aeruginosaorn.

Cell lysates were analyzed by western blotting, detecting the C-terminal HA-tag in recombinantly expressed NrnCBh.

Figure 2—figure supplement 2—source data 1

Original and labeled, unedited western blot image.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig2-figsupp2-data1-v2.zip
Figure 3 with 1 supplement
B. melitensis nano-RNase C (NrnC) crystal structures reveal a flexible loop that constraints the enzyme’s active site.

(A) Crystal structure of apo-NrnCBm. A crystallographic dimer as part of the octameric assembly is shown as surface presentation (left) and close-up of the active site (middle). The diagram (right) depicts the octamer and the spatial relationship of the monomers shown. (B) Crystal structure of NrnCBm with alternating substrate-bound and empty active sites. The close-up (middle) shows a superposition of the two monomers in the asymmetric unit, depicting their conformational difference and adjacent monomers, with intra- and inter-ring neighbors colored as shown in the diagram (right). (C) Superposition of four apo-NrnCBm conformations based on three independent crystal forms (comprising chains apo1A/apo1B for form 1; apo2A/apo2B for form 2, and apo3A/pGG-bound3B for form 3), compared to the pGG-bound conformation of the same protein shown in (B). The position of the flexible loop (red) in the NrnC octamer is shown (right panel).

Figure 3—figure supplement 1
Overlay of an alternative crystallographic apo-NrnCBm state with the apo- and pGG-bound states observed in the crystal structure shown in Figure 3B.

The large panel shows three structures superimposed. The smaller panels on the right show each active site isolated with residues of interest labeled and shown as sticks.

Figure 4 with 9 supplements
Cryo-electron microscopy (cryo-EM) structures of NrnCBh with 2-, 3-, 5-mer RNA substrates show substrate length-dependent active site conformations.

(A) Electron density map of a NrnCBh octamer in complex with pGG. D4 symmetry was applied during final map refinement. pGG molecule and density are colored cyan. The SKQQQS-containing loops (residues 130–137) are colored maroon. Superposition of all eight active sites from a reconstruction with C1 symmetry (right panel) shows consensus order in the loop when bound to pGG. (B) Active site images shown for NrnCBh incubated with 3-mer and 5-mer (with or without Ca2+) RNA substrates. Regions corresponding to those shown in (A) are shown in color, with light red (left panel), orange (middle panel), and brown (right panel) depicting the loop/loop density from structures determined with added pAGG, pAAAGG, and pAAAGG•Ca2+, respectively. D4-symmetric maps are shown. (C) Superposition of all eight active sites from octamer reconstructions based on respective C1-symmetric maps for each RNA substrate. Color scheme is as described in (B).

Figure 4—figure supplement 1
Cryo-electron microscopy (cryo-EM) workflow and resolution for NrnCBh•pGG.
Figure 4—figure supplement 2
Cryo-electron microscopy (cryo-EM) workflow and resolution for NrnCBh•pAGG.
Figure 4—figure supplement 3
Cryo-electron microscopy (cryo-EM) workflow and resolution for NrnCBh•pAAAGG.
Figure 4—figure supplement 4
Cryo-electron microscopy (cryo-EM) workflow and resolution for NrnCBh•pAAAGG in the presence of Ca2+ ions.
Figure 4—figure supplement 5
Overall and individual active site electron density of a NrnCBh•pGG octamer after refinement with C1 symmetry.
Figure 4—figure supplement 6
Overall and individual active site electron density of a NrnCBh•pAGG octamer after refinement with C1 symmetry.
Figure 4—figure supplement 7
Overall and individual active site electron density of a NrnCBh•pAAAGG octamer after refinement with C1 symmetry.
Figure 4—figure supplement 8
Overall and individual active site electron density of a NrnCBh•pAAAGG octamer in the presence of Ca2+ ions after refinement with C1 symmetry.
Figure 4—figure supplement 9
The conformation of nano-RNase C (NrnC) bound to substrates with more than two bases resembles the crystallographic apo-state.

(A) Comparison of the crystal structure of NrnCBh-pGG with the corresponding cryo-electron microscopy (cryo-EM) structure shows agreement between the solution and crystalline state of the protein with a well-ordered conformation of the loop residues 130–137 engaging the substrate. (B) Comparison of the crystal structure of apo-NrnCBm with the cryo-EM structure of NrnCBm-pAAAGG. The superposition indicates that longer substrates may bind the active site but only the first full residues appear ordered, resulting in a conformation of nano-RNase C (NrnC) similar to the inactive state observed in the apo-state crystal structures.

Figure 5 with 3 supplements
Nano-RNase C (NrnC) shows a strong preference for substrates with two residues in length.

(A, B). RNase assays. Experiments are similar to those in Figure 2 but were performed with radiolabeled substrates from 2 to 7 residues in length. Representative gels of at least two independent experiments are shown. In (B), enzyme concentration was varied from 5 to 1000 nM (1:200 to 1:1 enzyme:substrate ratio). Substrate length-dependent binding studies. (C) Affinity of NrnC for RNA with different lengths. Fraction bound of radiolabeled substrates of increasing length was assessed at different NrnC concentrations and is plotted as means and SD from three independent experiments.

Figure 5—source data 1

Source data for Figure 5A.

Original, unedited images and labeled composite overview of nano-RNase C (NrnC) activity against substrates with different length in three replicates.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-data1-v2.zip
Figure 5—source data 2

Source data for Figure 5B.

Original, unedited images and labeled composite overview of nano-RNase C (NrnC) activity against a 7-nucleotide RNA substrate at increasing enzyme concentration in three replicates.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-data2-v2.zip
Figure 5—source data 3

Source data for Figure 5C.

Quantification of binding studies using nano-RNase C (NrnC) and radiolabeled, single-stranded RNA with increasing length.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-data3-v2.zip
Figure 5—figure supplement 1
Competition binding studies.

Fraction bound of 32P-pGG to 200 nM purified NrnCBh in the presence of no competitor or 100 µM unlabeled RNA as indicated. Individual data, means, and SD of four independent experiments are plotted.

Figure 5—figure supplement 1—source data 1

Quantification of 32P-pGG binding to nano-RNase C (NrnC) in the presence of unlabeled RNA with increasing length (in three replicates).

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-figsupp1-data1-v2.zip
Figure 5—figure supplement 2
NrnCBh degrades long DNA fragments under distinct conditions.

(A) DNA fragments tested in this assay. (B) DNase activity of wild-type NrnCBh and a catalytically inactive mutant variant on blunt dsDNA in the presence of either Mg2+ or Mn2+ and in the absence or presence of NaCl. (C) NaCl titration on blunt dsDNA using wild-type NrnCBh. (D) Nano-RNase C (NrnC) activity on various dsDNA substrates with or without a 5′-PO4 and in the presence of Mg2+ of Mn2+. Representative agarose gels are shown from at least two independent experiments.

Figure 5—figure supplement 2—source data 1

Original, unedited agarose gel images and composite overview of nano-RNase C (NrnC) activity against 1.5 kb, double-stranded DNA substrates.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-figsupp2-data1-v2.zip
Figure 5—figure supplement 3
The preferred substrates of NrnCBh are diribonucleotides and deoxy-dinucleotides.

(A–C) NrnCBh does not degrade dsDNA and dsRNA. DNA or RNA oligonucleotide sequences used are shown in (A). Primers 1 and 2 were annealed to generate a 27-nucleotide DNA or RNA with a 5′ overhang and primers 3 and 4 were annealed to generate a 3′ overhang of (length of overhang: 5 nucleotides). NrnCBh activity on 5′ overhang or 3′ overhang of DNA(B) and RNA (C) in the presence of Mg2+ and 100 mM NaCl. These experiments were performed with 3.3 nM of 5′-radiolabeled DNA or RNA. Aliquots of each reaction were stopped at the indicated times and analyzed by 20% urea PAGE. (D) dsDNA is not an inhibitor of NrnCBh’s activity on diribonucleotides. The rate of 32P-pGG degradation by 5 nM NrnCBh was assayed over time with no competitor, plasmid DNA (30 nM) that was cut with StuI, or primers (1 µM) annealed to generate 5-nucleotide 5′ or 3′ overhangs (primers in panel A). Samples were stopped at the indicated time points and analyzed by thin-layer chromatography. Data are from triplicate independent experiments. (E) NrnCBh cleaves DNA deoxy-dinucleotides. Degradation of 32P-pGG, pAA, pdAdA, and pdAdGdG (3.3 nM) by 5 nM NrnCBh is shown. Samples were stopped at the indicated time points and analyzed by TLC. The graph shows quantification of triplicate independent experiments.

Figure 5—figure supplement 3—source data 1

Source data for Figure 5—figure supplement 3B.

Original, unedited images and labeled composite overview of nano-RNase C (NrnC) activity against double-stranded DNA oligonucleotides.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-figsupp3-data1-v2.zip
Figure 5—figure supplement 3—source data 2

Source data for Figure 5—figure supplement 3C.

Original, unedited images and labeled composite overview of nano-RNase C (NrnC) activity against double-stranded RNA oligonucleotides.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-figsupp3-data2-v2.zip
Figure 5—figure supplement 3—source data 3

Source data for Figure 5—figure supplement 3D and E.

Data quantification plotted in the graphs shown from three replicate experiments.

https://cdn.elifesciences.org/articles/70146/elife-70146-fig5-figsupp3-data3-v2.zip
Presence of RNase homologs across sequenced organism classes.

Shown is a ‘Tree of Life’ with all taxonomic groups at the class level with at least one substantially complete proteome available in the dataset. The tree is based on the structure of the NCBI Taxonomy database, with bacterial taxa shown with purple lines, eukaryotic taxa shown with green lines, and archaeal taxa shown with red lines. The presence of each RNase homolog as a proportion of the total proteins in that taxonomic group is shown as either a filled square (>50% presence of a homolog per genome) or an empty square (<50% presence of a homolog per genome). Lack of a square indicates no homologs for that family were present in genomes of that class.

Phylogenetic tree of four DnaQ-fold RNase families.

(A) Phylogenetic tree of 669 representatives of the RNase T, RNase D, oligoribonuclease (Orn), and nano-RNase C (NrnC) families of RNase proteins. The inner ring represents the original classification of each sequence by HMM analysis. The outer ring represents the high-level taxonomic classification of the organism the protein is found in. The color of the branch represents the UFBoot bootstrap value, where black branches are <80%, red is 80%, orange is 85%, yellow is 90%, light green is 95%, and bright green is 100%. Bootstrap values > 90% indicate high-confidence splits. (B) Sequence logos of RNase D and NrnC subgroups. Sequence logos showing the relative entropy (information content) at selected positions in RNase D as well as the Actinobacterial and non-Actinobacterial subsets of NrnC. Sequence numbering is relative to Bartonella birtlessi NrnC (G4VUY7). Active site residues are shown in red, phosphate cap residues in dark blue, and the L-wedge in yellow.

Structural comparison of nano-RNase C (NrnC) and oligoribonuclease (Orn).

(A) Fold topology. pGG-bound NrnC and Orn monomers are shown in a similar orientation as cartoons (top) or schematic topology diagrams (bottom). Conserved catalytic core elements are colored in gray. NrnC and Orn-specific features are colored in green and purple, respectively. Other color codes mark the positions of the DEDDy/h motif (red spheres), L-wedge (yellow sphere), and phosphate cap residues (dark blue spheres). (B) Comparison of dimer units of NrnC and Orn (top) with close-ups of the composite active sites of the enzymes (bottom). An NrnC monomer is colored green and an Orn monomer is colored purple, with adjacent monomers in the biological assemblies colored in light gray. Specific residues are colored as in (A). Coordinate systems indicate the twofold symmetry axis of the enzyme dimers, with the colored monomers shown in a similar orientation. (C) Structurally and functionally conserved features common among NrnC- and Orn-type diribonucleotidases.

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Pseudomonas aeruginosa)PA14Rahme et al., 1995; PMID:7604262
Strain, strain background (P. aeruginosa)PA14 ∆ornThis study
Strain, strain background (Escherichia coli)Stellar cellsTakara/Clontech
Strain, strain background (E. coli)BL21(DE3)New England Biolabs
Recombinant DNA reagentpEX-Gn-∆orn (plasmid)This study
Recombinant DNA reagentpJN105 (plasmid)Newman and Fuqua, 1999;
PMID:10023058
Recombinant DNA reagentpJHA (plasmid)Kim et al., 2019; PMID:31225796
Sequence-based reagentACAGATTGGTGGATC
CATGACCGAAATTCGCG
TGCATCAGGGCGATCTGC
CGAACCTGGATAACTAT
CGCATTGATG
CGGTGGCG
GTGGATACCG
AAACCCTGG
GCCTGCAGCC
GCATCGCGAT
CGCCTGTGCG
TGGTGCAGCTG
AGCAGCGGCGA
TGGCACCGC
GGATGTGATTCA
GATTGCGAA
AGGCCAGAAAA
GCGCGCCGAA
CCTGGTGCGCC
TGCTGAGCG
ATCGCGATATT
ACCAAAATTTTT
CATTTTGGCCGC
TTTGATCTG
GCGATTCTGGCG
CATACCTTTG
GCGTGATGCCG
GATGTGGTGT
TTTGCACCAAAAT
TGCGAGCAA
ACTGACCCGCAC
CTATACCGATCGC
CATGGCCTGAAAG
AAATTTGCGG
CGAACTGCTGAAC
GTGAACATTAG
CAAACAGCAGCAG
AGCAGCGATTG
GGCGGCGGAAAC
CCTGAGCCGCG
CGCAGATTGAATAT
GCGGCGAGCG
ATGTGCTGTATCTG
CATCGCCTGAA
AGATATTTTTGAAG
AACGCCTGAAA
CGCGAAGAACGCG
AAAGCGTGGCG
AAAGCGTGCTTTC
AGTTTCTGCCGA
TGCGCGCGAACC
TGGATCTGCTGG
GCTGGAGCGAAATTG
ATATTTTTGCG
CATAGCTAAGCGGC
CGCACTCGAGCA
(DNA fragment)
GeneartBH02530Custom DNA fragment for Bartonella henselae NrnC, cloned in to His6-SUMO-pET28
Sequence-based reagentACAGATTGGTG
GATCCATGACCA
TTCGCTTTCATC
GCAACGATCT
GCCGAACCTGGA
TAACTATCAGG
TGGATGCGGTG
GCGATTGATAC
CGAAACCCTGG
GCCTGAACCCGC
ATCGCGATCGCC
TGTGCGTGGTG
CAGATTAGCCCG
GGCGATGGCAC
CGCGGATGTGA
TTCAGATTGAAGC
GGGCCAGAAAAAA
GCGCCGAACC
TGGTGAAACTGC
TGAAAGATCGC
AGCATTACCAAAA
TTTTTCATTTTG
GCCGCTTTGATC
TGGCGGTGCTG
GCGCATGCGTTT
GGCACCATGCC
GCAGCCGGTGTT
TTGCACCAAAAT
TGCGAGCAAACTG
ACCCGCACCT
ATACCGATCGCCAT
GGCCTGAAAG
AAATTTGCAGCGA
ACTGCTGGATG
TGAGCATTAGCAA
ACAGCAGCAG
AGCAGCGATTGGG
CGGCGGAAG
TGCTGAGCCAGG
CGCAGCTGGAA
TATGCGGCGAG
CGATGTGCTGTAT
CTGCATCGCCTG
AAAGCGGTGCT
GGAACAGCGCCT
GGAACGCGAT
GGCCGCACCAAA
CAGGCGGAAGC
GTGCTTTAAATTT
CTGCCGACCCG
CAGCGAACTGGA
TCTGATGGGCTG
GGCGGAAAGCGA
TATTTTTGCGCAT
AGCTAAGCGGCCGCACTC
GAGCA (DNA fragment)
GeneartBMEI1828Custom DNA fragment for Brucella melitensis NrnC, cloned in to His6-SUMO-pET28
Recombinant DNA reagentHis6-SUMO-pET28-
NrnCBh (plasmid)
This studyCloned from custom DNA fragment
Recombinant DNA reagentHis6-SUMO-pET28-
NrnCBm (plasmid)
This studyCloned from custom DNA fragment
Recombinant DNA reagentpJHA-NrnCBh (plasmid)This studyNrnCBh cloned into pJHA for expression in P. aeruginosa
Recombinant DNA reagentpJHA-NrnCBm (plasmid)This studyNrnCBm cloned into pJHA for expression in P. aeruginosa
Recombinant DNA reagentpJHA-NrnCBh
D25A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
E27A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
D84A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
D155A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
Y151A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
L31A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
H79A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
K103A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
H205A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Recombinant DNA reagentpJHA-NrnCBh
K132A (plasmid)
This studyProduct of site-directed mutagenesis of pJHA-NrnCBh
Sequence-based reagentTTTGGGCTAGCCA
TATGACCGAAATT
CGTGTTCATCAGGG
Life TechnologiesNrnCBh_
infusionprimer_F
Primer for cloning NrnCBh into pJHA
Sequence-based reagentGCTCAAGCTTGAAT
TCGCTGTGTGCAA
AGATATCAATTTCG
Life TechnologiesNrnCBh_
infusionprimer_R
Primer for cloning NrnCBh into pJHA
Sequence-based reagentTTTGGGCTAGCCATATGACCATTCGTTTTCATCGTAATGATCLife TechnologiesNrnCBm_
infusionprimer_F
Primer for cloning NrnCBm into pJHA
Sequence-based reagentGCTCAAGCTTGAATTCGCTATGTGCAAAAATATCGCTTTCLife TechnologiesNrnCBm_
infusionprimer_R
Primer for cloning NrnCBm into pJHA
Sequence-based reagentAcccagtgtttcggtagc
aacggcaactgcatc
Life TechnologiesNrnCBh D25A_aPrimer for site directed mutagenesis
Sequence-based reagentGatgcagttgccgttgct
accgaaacactgggt
Life TechnologiesNrnCBh D25A_bPrimer for site directed mutagenesis
Sequence-based reagentGttgccgttgataccgca
acactgggtctgcag
Life TechnologiesNrnCBh E27A_aPrimer for site directed mutagenesis
Sequence-based reagentCtgcagacccagtgttgc
ggtatcaacggcaac
Life TechnologiesNrnCBh
E27A_b
Primer for site directed mutagenesis
Sequence-based reagentCgatgcggctgcgcac
ccagtgtttcggtatcaacg
Life TechnologiesNrnCBh
L31A_a
Primer for site directed mutagenesis
Sequence-based reagentCgttgataccgaaaca
ctgggtgcgcagc
cgcatcg
Life TechnologiesNrnCBh
L31A_b
Primer for site directed mutagenesis
Sequence-based reagentAgatcgaaacgacca
aaggcaaagattttg
gtaatatcacgatcgc
Life TechnologiesNrnCBh
H79A_a
Primer for site directed mutagenesis
Sequence-based reagentGcgatcgtgatattacc
aaaatctttgcctttg
gtcgtttcgatct
Life TechnologiesNrnCBh
H79A_b
Primer for site directed mutagenesis
Sequence-based reagentGtgccagaattgccag
agcgaaacgac
caaagtga
Life TechnologiesNrnCBh
D84A_a
Primer for site directed mutagenesis
Sequence-based reagentTcactttggtcgtttcgct
ctggcaattctggcac
Life TechnologiesNrnCBh
D84A_b
Primer for site directed mutagenesis
Sequence-based reagentCgggtcagtttgcttgc
aattgcggtacaa
aaaacaacatccgg
Life TechnologiesNrnCBh
K103A_a
Primer for site directed mutagenesis
Sequence-based reagentCcggatgttgttttttgtacc
gcaattgcaagca
aactgacccg
Life TechnologiesNrnCBh
K103A_b
Primer for site directed mutagenesis
Sequence-based reagentAcatcacttgctgcagct
tcaatctgtgcac
ggctcagg
Life TechnologiesNrnCBh
Y151A_a
Primer for site directed mutagenesis
Sequence-based reagentCctgagccgtgcacag attgaagctgca
gcaagtgatgt
Life TechnologiesNrnCBh
Y151A_b
Primer for site directed mutagenesis
Sequence-based reagentCggtgcagatacaga acagcacttgctgcatattcaaLife TechnologiesNrnCBh
D155A_a
Primer for site directed mutagenesis
Sequence-based reagentTtgaatatgcagcaag
tgctgttctgtatctgcaccg
Life TechnologiesNrnCBh
D155A_b
Primer for site directed mutagenesis
Sequence-based reagentGctcaagcttgaattc
gctggctgcaa
agatatcaatttcgc
Life TechnologiesNrnCBh
H205A_a_pJHA
Primer for site directed mutagenesis
Sequence-based reagentGcgaaattgatatctttgc agccagcgaattcaagcttgagcLife TechnologiesNrnCBh
H205A_b_pJHA
Primer for site directed mutagenesis
Sequence-based reagentGtgcggccgcttagctgg ctgcaaagatatcaatttcgctLife TechnologiesNrnCBh
H205A_a_SUMO
Primer for site directed mutagenesis
Sequence-based reagentAgcgaaattgatatcttt gcagccagctaa
gcggccgcac
Life TechnologiesNrnCBh
H205A_b_SUMO
Primer for site directed mutagenesis
Sequence-based reagent5′-GG-3′ (RNA primer)Sigma
Sequence-based reagent5′-AGG-3′ (RNA primer)Sigma
Sequence-based reagent5′-AAGG-3′ (RNA primer)Sigma
Sequence-based reagent5′-AAAGG-3′
(RNA primer)
Sigma
Sequence-based reagent5′-AAAAGG-3′
(RNA primer)
Sigma
Sequence-based reagent5′-AAAAAGG-3′
(RNA primer)
Sigma
Sequence-based reagent5′-pGG-3′ (RNA primer)Biolog’ catalog number P023-01
Sequence-based reagent5′-pAA-3′ (RNA primer)Biolog’ catalog number P033-01
Sequence-based reagent5′-pGC-3′ (RNA primer)GE Healthcare Dharmacon
Chemical compound, drug5′-pAp-3′ (RNA primer)SigmaCat# A5763
Sequence-based reagentVarious RNA and
DNA oligonucleotides
IDT
AntibodyAnti-HA (rabbit
polyclonal)
TakaraCat# 631207(1:100)
AntibodyAnti-HA−agarose
(mouse monoclonal,
clone HA-7)
SigmaCat# A2095; RRID:AB_257974(10 µl)
AntibodyAnti-rabbit (donkey
polyclonal,
HRP-conjugated)
CytivaCat# NA934(1:5000)
Software, algorithmPrismGraphPadRRID:SCR_002798
Software, algorithmXDS Program PackageKabsch, 2010; PMID:20124693RRID:SCR_015652Distributed through SBGrid
Software, algorithmPointlessEvans, 2006; PMID:16369096RRID:SCR_014218Distributed through SBGrid
Software, algorithmScalaEvans, 2006; PMID:16369096Distributed through SBGrid
Software, algorithmPhenixAdams et al., 2010; PMID:20124702RRID:SCR_014224Distributed through SBGrid
Software, algorithmCootEmsley et al., 2010; PMID:20383002RRID:SCR_014222Distributed through SBGrid
Software, algorithmMrBumpKeegan et al., 2018;PMID:29533225Distributed through SBGrid
Software, algorithmPyMOLSchrödingerRRID:SCR_000305Distributed through SBGrid
Software, algorithmUCSF ChimeraXPettersen et al., 2021; PMID:32881101RRID:SCR_015872Distributed through SBGrid
Software, algorithmcryoSPARCPunjani et al., 2017; PMID:28165473RRID:SCR_016501
Software, algorithmRELIONZivanov et al., 2018; PMID:30412051RRID:SCR_016274
Software, algorithmGCTFZhang, 2016; PMID:26592709RRID:SCR_016500
Software, algorithmiTOLLetunic and Bork, 2019; PMID:30931475RRID:SCR_018174
Software, algorithmTCoffeeNotredame et al., 2000; PMID:10964570RRID:SCR_019024
Software, algorithmHmmerEddy, 2011; PMID:22039361RRID:SCR_005305
Software, algorithmMAFFTKatoh et al., 2005; PMID:15661851RRID:SCR_011811
Software, algorithmSnakeMakeKöster and Rahmann, 2018; PMID:29788404RRID:SCR_003475

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)