Skeleton interoception regulates bone and fat metabolism through hypothalamic neuroendocrine NPY
- Department of Orthopaedic Surgery, Institute of Cell Engineering, and Department of Biomedical Engineering, The Johns Hopkins University, United States
- Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, China
Figures
Figure 1 with 1 supplement
Sensory nerve denervation induces NPY expression.
(A) Representative images of GFP+ neurons in the hypothalamus after multisynaptic tracer HSV-1 H19-G4 injected in the femur marrow for 5 days (dpi, days post injection). (B) Enzyme-linked immunosorbent assay (ELISA) analysis of NPY level in serum in 3-month-old Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice. (C) Representative images of immunofluorescence staining and quantitative analysis of NPY (green) in the ARC of hypothalamus of 3-month-old Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice. DAPI stains nuclei blue. Scale bars = 50 µm. (D) Quantitative analysis of food intake for 2- and 4-month-old Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice. (E) Quantitative analysis of body weight for male and female Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice at 1, 3, 6, and 12 months old. (F) Quantitative analysis of the weight of the gonadal and inguinal fat pads isolated from 3-month-old Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice. qNMR analysis of (G) fat weight, fat mass, and (H) lean mass of 1- and 3-month-old Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice. (I) ELISA analysis of serum NPY level of 3-month-old AvilCre:Rosa26 lsl-DTR mice injected with vehicle or 1 ug/kg/d of DTX for 5 and 7 days. (J) Representative images of immunofluorescence staining and quantitative analysis of NPY (green) in the ARC of hypothalamus of 3-month-old AvilCre:Rosa26 lsl-DTR mice injected with vehicle or 1 µg/kg/d DTX for 7 days. Scale bars = 50 µm. (K) Quantitative analysis of food intake for 3-month-old AvilCre:Rosa26 lsl-DTR mice injected with vehicle or DTX for 1 month. (L) Quantitative analysis of the weight of the gonadal and inguinal fat pads isolated from 3-month-old AvilCre:Rosa26 lsl-DTR mice injected with vehicle or DTX for 1 month. qNMR analysis of (M) fat weight, fat mass, and (N) lean mass of 3-month-old AvilCre:Rosa26 lsl-DTR mice injected with vehicle or DTX for 1 month. N ≥ six per group. *p < 0.05, and N.S. means not significant. Statistical significance was determined by Student’s t-test.
-
Figure 1—source data 1
Raw data of neuropeptiedes level.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Knockout efficiency of AvilCre:Ntrk1fl/fl mice.
(A) Representative images of immunostaining for NeuN (Green) and TrkA (Red) and co-staining for NeuN (Green) and TrkA (Red) for the Dorsal Root Ganglion (DRG) of 3-month-old male Ntrk1fl/fl and AvilCre:Ntrk1fl/fl mice, scale bar:100 µm. (B) Representative μCT images of femurs from 3-month-old male Ptger4fl/fl and AvilCre:Ntrk1fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for one month. N≥six per group, *p<0.05 (Student t-test).
Figure 2 with 1 supplement
Deletion of EP4 receptor in sensory nerve increases NPY expression.
(A) ELISA analysis of bone marrow and hypothalamus interstitial in WT mice treated with vehicle or SW033291 for 0 and 3 hr. (B) RT-PCR quantitative analysis of Npy gene expression in the ARC area in 3-month-old male WT mice after being treated with vehicle or 10 mg/kg/d SW033291 for 1 month. (C) ELISA analysis of NPY level in serum from 3-month-old male WT mice after being treated with vehicle or 10 mg/kg/day SW033291 for 1 month. (D) ELISA analysis of NPY level in serum from 1- and 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice. (E) ELISA analysis of NPY level in serum from 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated with vehicle or 10 mg/kg/d SW033291 for 1 month. (F) Representative images of immunofluorescence staining and quantitative analysis of NPY (green) in the ARC of hypothalamus of 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated with vehicle or 10 mg/kg/d SW033291 for 1 month. DAPI stains nuclei blue. Scale bars = 50 µm. (G) Quantitative analysis of food intake for 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated with vehicle or 10 mg/kg/d SW033291 for 1 month. (H) Quantitative analysis of body weight for male and female Ptger4fl/fl and AvilCre:Ptger4fl/fl mice at 1, 3, 6, and 12 months old. Quantitative analysis of the weight of the (I) gonadal and inguinal fat pads isolated from 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated with vehicle or SW033291 for 1 month. qNMR analysis of (J) fat weight, fat mass, and (K) lean mass of 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated with vehicle or SW033291 for 1 month. N ≥ six per group. *p < 0.05, and N.S. means not significant. Statistical significance was determined by Student’s t-test for A–D. Statistical significance was determined by two-way analysis of variance for E-G, I-K.
-
Figure 2—source data 1
Raw data of quantification of NPY level, staining of NPY, perilipin, osteocalcin and pCREB, Fatp1 and cpt1b gene expression.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Osteocytes derived PGE2 did not affects hypothalamic NPY.
(A) ELISA analysis of NPY level in serum from 3-month-old Cox2 fl/fl and DMP1Cre:Cox2fl/fl mice, (B) Representative images of immunofluorescence staining and quantitative analysis of NPY (green) in the ARC of hypothalamus of 3-month-old Cox2 fl/fl and DMP1Cre:Cox2fl/fl mice. DAPI stains nuclei blue. Scale bars = 50 µm. (C) Representative co-immunofluorescence staining and quantitative analysis (adipocyte number per section and number of osteoblast) of osteocalcin (green) and perilipin (red) from femurs of 3-month-old male Cox2 fl/fl and DMP1Cre:Cox2fl/fl mice. Scale bars = 50 µm. (D) RT-PCR quantitative analysis of Fatp1 and Cpt1b expression in femurs from 3-month-old male Cox2 fl/fl and DMP1Cre:Cox2fl/fl mice. (E) Representative images of immunofluorescence staining and quantitative analysis of the pCREB in the ARC of the hypothalamus of 3-month-old Cox2 fl/fl and BglapCre:Cox2fl/fl mice. Scale bars = 50 µm. N ≥ six per group. *p < 0.05 and N.S. indicates not significant. Statistical significance was determined by the two-way analysis of variance.
Figure 3 with 1 supplement
Stimulation of skeletal interoception induces SMILE to suppress NPY transcription in the hypothalamus.
(A) Western blot analysis expression of phosphorylation CREB and SMILE in the ARC area from 3-month-old male WT mice injected with vehicle or 10 mg/kg/day SW033291 for 3 days. (B) Diagram of potential pCREB binding site on the Npy gene promoter. (C, D) ChIP and RT-PCR quantitative analysis of pCREB on Npy gene promoter in the ARC area treated with 10 mg/kg/day SW033291 for 3 days. (E) Diagram of the mechanism of SW033291 down-regulated Npy gene expression in the ARC area. (F) Representative images of immunofluorescence staining and (G) quantitative analysis of the pCREB (up) and SMILE (down) in the ARC of the hypothalamus of 3-month-old Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated with vehicle or 10 mg/kg/day SW033291 for 7 days. Scale bars = 50 µm. N ≥ six per group. *p < 0.05, and N.S. indicates not significant. Statistical significance was determined by two-way analysis of variance for D,G.
-
Figure 3—source data 1
Raw data of quantification of BV/TV and trabecular number and osteogeneic related gene expression.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
PGE2 regulate osteoblastic bone formation via EP4 receptor on sensory nerves.
(A–B) Quantitative analysis of trabecular bone fraction and trabecular number from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. Scale bar: 1 mm. (C) Western blot analysis of expression of pCREB and CREB in the osteoblasts isolated from femurs of 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for one month. (D) RT-PCR analysis of osteogenesis-related gene Alp and Col1a1 expression in bone marrow isolated from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for one month. N≥six per group, *p<0.05 (Student t-test).
Figure 4
Skeletal interoception promotes osteoblastic bone formation by downregulation of hypothalamic NPY.
(A) Representative images of calcein double labeling of femoral trabecular bone and (B) quantification of mineral apposition rate (MAR) and bone formation rate per bone surface (BFR/BS) in 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/d SW033291 for 1 month. Scale bars = 20 μm. (C) Representative co-immunofluorescence staining and (D) quantitative analysis of pCREB (green) and osteocalcin (red) from femurs of 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. Scale bars = 50 µm. (E) Quantitative analysis of cAMP concentration in the osteoblasts isolated from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. (F) RT-PCR quantitative analysis of Runx2 expression in femurs from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. (G) Representative co-immunofluorescence staining and (H) quantitative analysis (adipocyte number per section and number of osteoblast) of osteocalcin (green) and perilipin (red) from femurs of 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. Scale bars = 50 µm. (I) RT-PCR quantitative analysis of Fatp1 and Cpt1b expression in femurs from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. N ≥ six per group. *p < 0.05, **p<0.01, and N.S. indicates not significant. Statistical significance was determined by two-way analysis of variance.
-
Figure 4—source data 1
Raw data of quantification of dynamic bone formation, staining of pCREB, perilipin, osteocalcin, cAMP concentration and gene expression.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig4-data1-v2.xlsx
Figure 5
Downregulation of NPY by skeletal interoception stimulates lipolysis.
RT-PCR quantitative analysis of (A) Lipe and (B) Pnpla2 expression in the gonadal white adipose tissues from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. (C) Quantitative analysis of free FA level in serum from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/d SW033291 for 1 month. (D) Representative co-immunofluorescence staining and (E) quantitative analysis of pAMPK (green) and perilipin (red) from the gonadal white adipose tissues of 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice injected with vehicle or 10 mg/kg/day SW033291 for 1 month. (F) Representative μCT-detected OsO4-stained images of decalcified femurs and (G) quantitative analysis of the number of adipocytes (Ad.N) Ad.V/Ma.V in distal femurs from 3-month-old male Ptger4fl/fl and AvilCre:Ptger4fl/fl mice treated vehicle or 10 mg/kg/day SW033291 for 1 month. Scale bars = 500 μm. (H) ELISA analysis of NPY level in serum from 3-month-old Cox2 fl/fl and BglapCre:Cox2fl/fl mice. (I) Representative images of immunofluorescence staining and quantitative analysis of NPY (green) in the ARC of hypothalamus of 3-month-old Cox2 fl/fl and BglapCre:Cox2fl/fl mice. DAPI stains nuclei blue. Scale bars = 50 µm. (J) Representative co-immunofluorescence staining and quantitative analysis (adipocyte number per section and number of osteoblast) of osteocalcin (green) and perilipin (red) from femurs of 3-month-old male Cox2 fl/fl and BglapCre:Cox2fl/fl mice. Scale bars = 50 µm. (K) RT-PCR quantitative analysis of Fatp1 and Cpt1b expression in femurs from 3-month-old male Cox2 fl/fl and BglapCre:Cox2fl/fl mice N ≥ six per group. *p < 0.05 and N.S. indicates not significant. Statistical significance was determined by the two-way analysis of variance for A-C, E, G.
-
Figure 5—source data 1
Raw data of quantification of Lipe,Pnpla2, cpt1b, Fatp1 gene expression, free fatty acids level, NPY level, pAMPK, NPY, perilipin and osteocalcin staining.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig5-data1-v2.xlsx
Figure 6
Inhibition of Y1R accelerates oxidation of free FAs and rescues bone loss in AvilCre:Ptger4fl/fl mice.
(A) Representative μCT images of femurs from 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/day BIBO3304 for 1 month. (B) Quantitative analysis of trabecular bone fraction (BV/TV) and trabecular number (Tb.N). Scale bars = 1 mm. (C) Representative images of immunostaining and (D) quantitative analysis of the osteocalcin+ cells (brown) on trabecular bone surface of femoral bone. (E) Representative co-immunofluorescence staining and quantitative analysis of pCREB (green) and osteocalcin (red) from femurs of 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/day BIBO3304 for 1 month. Scale bars = 50 µm. (F) Quantitative analysis of cAMP concentration in osteoblasts isolated from 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/day BIBO3304 for 1 month. (G, H) RT-PCR analysis of expression of Runx2, ALlp, Col1a1, Fatp1, and Cpt1b level of bone marrow from 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/d BIBO3304 for 1 month. (I) Quantitative analysis of free FA level in serum from 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/d BIBO3304 for 1 month. (J) RT-PCR analysis of expression of Lipe and Pnpla2 level of white adipose tissues of 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/d BIBO3304 for 1 month. (K) Representative co-immunofluorescence staining and quantitative analysis of pAMPK (green) and perilipin (red) from gonadal white adipose tissues of 3-month-old male AvilCre:Ptger4fl/fl mice injected with vehicle or 1 mg/kg/d BIBO3304 for 1 month. (L) Representative μCT-detected OsO4-stained images of decalcified femurs and (M) quantitative analysis of Ad.N and Ad.V/Ma.V in distal femurs from 3-month-old male AvilCre:Ptger4fl/fl mice treated with vehicle or 1 mg/kg/d BIBO3304 for 1 month. Scale bars = 500 μm. N ≥ six per group. *p < 0.05 and N.S. indicates not significant. Statistical significance was determined by Student’s t-test.
-
Figure 6—source data 1
Raw data of quantification of MicroCT, staining of osteocalcin, pCREB and pAMPK, gene expression, cAMP concentration, free fatty acids level and OsO4 staining.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig6-data1-v2.xlsx
Figure 7
β2R regulates MSC commitment and Y1R coordinates osteoblastic formation and mineralization.
(A) Representative images of immunofluorescence staining of colocalization of Osterix (red) and osteocalcin (red) with YFP (green) (representing LepR+ cells) and (B, C) quantitative analysis of (B) YFP+ osterix+ cells per section and (C) YFP+ osteoblasts per section in femur bone marrow from 3-month-old Lepr;YFP mice treated with propranolol (0.5 mg/kg/day for 6 weeks), 5 μmol/mouse/day [Leu31, Pro34]-NPY, and a combination of propranolol (0.5 mg/kg/d for 6 weeks) and 5 umol/mouse/d [Leu31, Pro34]-NPY for 4 weeks. Scale bars = 50 µm. (D) Representative images of alizarin red S–stained CFU-Ob and crystal violet–stained CFU-F. Quantitative analysis of (E) CFU-Ob and (F) CFU-F MSCs isolated from 3-month-old male Lepr;YFP mice treated with propranolol (0.5 mg/kg/d for 6 weeks), 5 umol/mouse/day [Leu31, Pro34]-NPY, and a combination of propranolol (0.5 mg/kg/day for 6 weeks) and 5 umol/mouse/d [Leu31, Pro34]-NPY for 4 weeks. N ≥ six per group. *p < 0.05 and N.S. indicates not significant. Statistical significance was determined by two-way analysis of variance. (G) Diagram showing that PGE2/EP4 ascending signal also downregulates expression of neuroendocrine factor NPY, which is secreted into circulation, as the neuroendocrine descending interoceptive signal for bone and fat metabolism.
-
Figure 7—source data 1
Raw data of quantification of YFP staining and CFU-OB and CFU-F.
- https://cdn.elifesciences.org/articles/70324/elife-70324-fig7-data1-v2.xlsx
Tables
Table 1
Potential binding-sites for pCREB on Npy promoter.
| Primer | Forward | Reverse |
|---|---|---|
| 1 | AGGATCGCATATTGAAACA | ACTAACTCTGCAAGGGCAT |
| 2 | GAATCTTTCAAACATCCGA | TCCTGAAATCATTGGTAGC |
| 3 | GCTAAATCCAGGCTTCAACT | CCAGAACAACAATATCCCTC |
Additional files
-
Supplementary file 1
Sequence of primer.
- https://cdn.elifesciences.org/articles/70324/elife-70324-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/70324/elife-70324-transrepform-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Skeleton interoception regulates bone and fat metabolism through hypothalamic neuroendocrine NPY
eLife 10:e70324.
https://doi.org/10.7554/eLife.70324
