Seizures, behavioral deficits, and adverse drug responses in two new genetic mouse models of HCN1 epileptic encephalopathy
- German Center for Neurodegenerative Diseases (DZNE), Germany
- University of Cologne, Institute for Molecular and Behavioral Neuroscience, Germany
- University of Cologne, Center for Molecular Medicine Cologne, Germany
- Department of Neuroscience, Mortimer B. Zuckerman Mind Brain Behavior Institute, Columbia University, United States
- Department of Biosciences, University of Milan, Italy
- In vivo Research Facility, Faculty of Medicine and University Hospital Cologne, University of Cologne, Germany
Figures
Figure 1 with 1 supplement
Body weight, survival, and general brain morphology in Hcn1GD/+ and Hcn1MI/+ mice.
(A) Reduced body weight post-weaning and through adult life in Hcn1GD/+ (GD) mice of both sexes, as well as in Hcn1MI/+ (MI) males (ns = not significant, *p<0.05, ***p<0.001; effect of genotype, …
Figure 1—figure supplement 1
Cerebellum and brainstem area in Hcn1GD/+ mice.
Fluorescent Nissl stain of hindbrain sections from WT and Hcn1GD/+ (GD) mice is shown on the left (Bregma –6.12 mm, scale bar = 1200 μm). Brain area measurements comparing cerebellum (CB) and …
Figure 2 with 7 supplements
Baseline exploratory behavior, gait, and motor function analysis in Hcn1GD/+ and Hcn1MI/+ mice.
(A) Schematic representation of the open-field arena, with dashed lines depicting the imaginary border (gray) and center zones (red). Occupation ratio calculated as (Center – Border)/(Center + …
-
Figure 2—source data 1
Open-field parameters for Hcn1GD/+ and Hcn1MI/+ heterozygous mice in comparison to WT littermates.
Number of animals is indicated in parentheses. Times in border and center zones, respectively, are expressed as percentage of total trial duration. *Data was analyzed with a Mann–Whitney U test; #data was analyzed with a Student’s t-test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig2-data1-v2.docx
-
Figure 2—source data 2
Catwalk gait analysis parameters for Hcn1GD/+ and Hcn1MI/+ heterozygous mice in comparison to WT littermates.
Parameters listed correspond to the right front paw. Number of animals is shown in parentheses. *Data was analyzed with a Mann–Whitney U test; #data was analyzed with a Student’s t-test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig2-data2-v2.docx
-
Figure 2—source data 3
Vertical pole test parameters for Hcn1GD/+ and Hcn1MI/+ heterozygous mice in comparison to WT littermates.
Number of animals is indicated in parentheses. Latency data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig2-data3-v2.docx
Figure 2—figure supplement 1
Open-field behavior of Hcn1GD/+ and Hcn1MI/+ mice.
Comparison of open-field behavior between Hcn1GD/+ (GD) or Hcn1MI/+ (MI) mice and their respective WT littermates. (A) Mean running speed and (B) mean distance moved over time during 15 min in the …
Figure 2—figure supplement 2
Gait analysis in Hcn1GD/+ mice.
(A) Mean running speed of all runs was increased in Hcn1GD/+ (GD) mice compared to WT littermates. (B) Base of support (BOS) of the hind paws was decreased at the higher speed range in Hcn1GD/+ …
Figure 2—figure supplement 3
Gait analysis in Hcn1MI/+ mice.
(A) Mean running speed of all runs was increased in Hcn1MI/+ (MI) mice compared to WT littermates. (B) Base of support (BOS) of the hind paws was unchanged. Gait analysis parameters of the right …
Figure 2—video 1
Pole test recording of a Hcn1GD/+ heterozygous male falling off the pole.
The animal can be seen falling off at level 1 while trying to perform a body rotation.
Figure 2—video 2
Pole test recording of a Hcn1GD/+ heterozygous male sliding down the pole.
Although initially the animal performed a successful body rotation at level 1 of the pole, it could not maintain the posture and kept sliding down instead of using all four paws to climb down.
Figure 2—video 3
Pole test recording of a Hcn1MI/+ heterozygous female.
The animal performed a full 180° body rotation at level 1 of the vertical pole, then climbed down the pole with all four paws, successfully completing the trial.
Figure 2—video 4
Pole test recording of a WT female.
The animal can be seen successfully performing a full 180° body rotation at level 1 of the vertical pole, then climbing down the pole with all four paws.
Figure 3
Spontaneous alternation and object recognition memory in Hcn1GD/+ and Hcn1MI/+ mice.
(A) Spontaneous alternation test with schematic representation of the Y maze consisting of three equal arms (A–C). (B) Alternation rates were significantly decreased in Hcn1GD/+ mice (GD, left), but …
-
Figure 3—source data 1
Spontaneous alternation in the Y maze.
Alternation rates and time to complete 24 transitions are expressed as the mean of 2 days. Number of animals is indicated in parentheses. *Data was analyzed using a Mann–Whitney U test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig3-data1-v2.docx
-
Figure 3—source data 2
Object recognition memory test.
Number of animals is indicated in parentheses. *Data was analyzed using a Mann–Whitney U test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig3-data2-v2.docx
Figure 4 with 3 supplements
Spontaneous convulsive seizures in Hcn1GD/+ and Hcn1MI/+ mice.
(A) Example of a spontaneous seizure recorded in an Hcn1GD/+ mouse. Upper trace shows electrocorticogram (ECoG) signal of a behaviorally noted grade 4 seizure (red bar), with expanded trace and …
Figure 4—figure supplement 1
Histological markers show hippocampal changes associated with epilepsy in Hcn1GD/+ and Hcn1MI/+ mice.
Immunofluorescent staining of mid-coronal sections from adult brains in WT, Hcn1GD/+, and Hcn1MI/+ mice showing hippocampal region labeled for neuropeptide Y (NPY, first row), Wisteria floribunda …
Figure 4—video 1
Video - electrocorticogram (ECoG) recording of a spontaneous seizure in Hcn1GD/+ heterozygous female.
The first portion of the video illustrates a period of grade 3–4 behavioral seizures, accompanied by high -amplitude oscillatory activity on the ECoG trace. Immediately following the high -amplitude …
Figure 4—video 2
Video -electrocorticogram (ECoG) recording of a spontaneous seizure in Hcn1MI/+ heterozygous male.
The first portion of the video illustrates grade 2–5 behavioral seizures, accompanied by high -amplitude oscillatory activity on the ECoG trace, similar to Hcn1GD/+ animals. This is followed by a …
Figure 5 with 1 supplement
HCN1 protein expression and Ih-dependent voltage sag in CA1 pyramidal neurons are reduced in Hcn1GD/+ and Hcn1MI/+ mice.
(A) Immunofluorescent labeling of HCN1 protein in hippocampus from adult WT, Hcn1GD/+, and Hcn1MI/+ animals. (B) Quantification of fluorescent signal along the somatodendritic axis of pyramidal …
-
Figure 5—source data 1
Action potential (AP) properties of Hcn1GD/+ and Hcn1MI/+ pyramidal neurons compared to respective WT littermate controls.
Number of cells is shown in parenthesis. Number of animals used for GD: WT n = 6 mice, GD n = 5 mice; and for MI: WT n = 3 mice, MI n = 3 mice. *Data was analyzed using a Mann–Whitney U test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig5-data1-v2.docx
Figure 5—figure supplement 1
Impaired action potential (AP) firing in Hcn1GD/+ and Hcn1MI/+ neurons.
(A) Input–output curves (number of APs versus injected current) for CA1 pyramidal neurons from Hcn1GD/+ (GD) and WT littermates. (B) Same comparison for CA1 pyramidal neurons from Hcn1MI/+ (MI) and …
Figure 6 with 1 supplement
Alterations in HCN1 localization in cerebellar basket cell pinceau with accompanying loss of KV1.2 and ATP1a3 in Hcn1GD/+ but not Hcn1MI/+ mice.
Immunofluorescent labeling of coronal hindbrain sections from adult mouse brain. Detail of the cerebellar cortex of WT, Hcn1GD/+, and Hcn1MI/+ mice is shown, displaying the Purkinje cell layer. Top …
Figure 6—figure supplement 1
KV1.2 protein expression is unaltered in cerebellar pinceau of global HCN1 knockout animals.
Immunofluorescent staining of coronal hindbrain sections from adult brains in Hcn1+/+ and Hcn1-/- mice, showing the cerebellar cortex. (A) Left: HCN1 protein labeling; center: Nissl counterstain; …
Figure 7 with 2 supplements
Viral targeting of HCN1 subunits to parvalbumin-positive (PV+) interneuron terminals in hippocampus shows impaired trafficking of HCN1-GD mutant protein.
Immunofluorescent staining of midcoronal sections from adult mouse brain. (A) Labeling of HCN1 protein in the hippocampus of WT, Hcn1GD/+, and Hcn1MI/+ mice. Images show a close-up of the pyramidal …
Figure 7—figure supplement 1
Impaired trafficking of virally transduced HCN1-GD protein to parvalbumin-positive (PV+) interneuron terminals in hippocampus.
Immunofluorescent staining of midcoronal sections from adult mouse brain. Anti-hemagglutinin (anti-HA) tag labeling of virally expressed HCN1 protein after stereotaxic injection into hippocampal …
Figure 7—figure supplement 2
Viral targeting of HCN1 subunits to parvalbumin-positive (PV+) interneurons in hippocampal area CA1.
Immunofluorescent staining of midcoronal sections from adult mouse brain, showing the hippocampus region. Anti-hemagglutinin (anti-HA) tag labeling of virally expressed HCN1 protein after …
Figure 8
Anticonvulsant-drug induced seizures in Hcn1GD/+ and Hcn1MI/+ mice.
(A) Example electrocorticogram (ECoG) trace for lamotrigine-induced grade 3 seizure in Hcn1GD/+ (left) and grade 6 seizure in Hcn1MI/+ mouse (right), with seizure shown at expanded time scale below. …
Figure 9 with 1 supplement
Lamotrigine (LTG) has no direct effect on HCN1 or HCN2 channel activity.
(A) Sample current traces from whole-cell voltage-clamp recordings in HEK293T cells transiently expressing HCN1 (top), HCN1 and TRIP8b (middle) or HCN2 (bottom), in the absence or presence of bath …
-
Figure 9—source data 1
Lamotrigine has no direct effect on HCN1 or HCN2 channel activity.
Number of cells is indicated in parenthesis. #Data was analyzed with a Student’s t-test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig9-data1-v2.docx
Figure 9—figure supplement 1
Effects of lamotrigine (LTG) on NaV1.5 channels.
(A) The inhibition of NaV1.5 channel activity by LTG was tested at different holding potentials. Representative sodium currents recorded from HEK293T cells transiently expressing NaV1.5 channels …
Figure 10
Lack of effect of ZD7288 on Hcn1GD/+ neurons and heterologously expressed hHCN1-WT/G391D channels.
(A) Whole-cell voltage-clamp recordings in HEK293T cells heterologously expressing either human HCN1 (hHCN1) WT or heteromeric hHCN1 WT/G391D channels. Sample current traces are shown, in response …
-
Figure 10—source data 1
Lack of effect of ZD7288 on Hcn1GD/+ neurons.
Number of cells is shown in parenthesis. *Data was analyzed with a paired t-test. #Data was analyzed with a Wilcoxon matched-pairs signed-rank test. Data represent mean ± SEM.
- https://cdn.elifesciences.org/articles/70826/elife-70826-fig10-data1-v2.docx
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-HCN1 (mouse monoclonal) | NeuroMab | RRID:AB_2877279; clone N70-28, Cat# N75-110 | IHC (1:300) |
| Antibody | Anti-NPY (rabbit polyclonal) | Immunostar Hudson | RRID:AB_572253; Cat# 22940 | IHC (1:1000) |
| Antibody | Anti-GFAP (mouse monoclonal) | Invitrogen | RRID:AB_10598206; clone GA5, Cat# 14-9898-82 | IHC (1:250) |
| Antibody | Anti-ATP1a3 (mouse monoclonal) | Invitrogen | RRID:AB_2274447; clone G10, Cat# MA3-915 | IHC (1:400) |
| Antibody | Anti-HA tag (rat monoclonal) | Roche | RRID:AB_390917; clone BMG-3F10, Cat# 12013819001 | IHC (1:100) |
| Antibody | Anti-KV1.2 (mouse monoclonal) | NeuroMab | RRID:AB_2296313; clone K14/16, Cat# N75-008 | IHC (1:300) |
| Antibody | Anti-parvalbumin (rabbit polyclonal) | Synaptic Systems | RRID:AB_2156474; Cat# 195002 | IHC (1:1000) |
| Cell line (human) | HEK293T | ATCC (authenticated by STR profiling) | RRID:CVCL_0063 | Tested for mycoplasma: negative result |
| Commercial assay, kit | Clariom S Assay, mouse | Thermo Fisher Scientific | Cat# 902931 | |
| Genetic reagent (Mus musculus) | Hcn1-/- (B6.129S-Hcn1tm2Kndl/J) | Jackson Laboratory | RRID:IMSR_JAX:016566 | Males and females |
| Genetic reagent (M. musculus) | Hcn1G380D (C57BL/6J-Hcn1em1(G380D)Cecad) | This paper | Males and females | |
| Genetic reagent (M. musculus) | Hcn1M142I (C57BL/6J-Hcn1em2(M142I)Cecad) | This paper | Males and females | |
| Genetic reagent (M. musculus) | Pvalb-Cre (B6.129P2-Pvalbtm1(cre)Arbr/J) | Jackson Laboratory | RRID:IMSR_JAX:017320 | Males and females |
| Peptide, recombinant protein | WFA biotin conjugate | Sigma-Aldrich | RRID:AB_2620171; Cat# L-1516 | IHC (1:1000) |
| Peptide, recombinant protein | Streptavidin Alexa Fluor 594 conjugate | Life Technologies | RRID:AB_2337250; Cat# S32356 | IHC (1:500) |
| Recombinant DNA reagent | pcDNA 3.1 (plasmid) | Invitrogen | Used for HEK293T experiments to express human HCN1 and mouse TRIP8b | |
| Recombinant DNA reagent | pCI (plasmid) | Promega | U47119; Cat# E1731 | Used for HEK293T experiments to express mouse HCN2 |
| Recombinant DNA reagent | pmaxGFP (plasmid) | Amaxa Biosystems | HEK293T experiments (cotransfection for target cell visualization) | |
| Recombinant DNA reagent | pIRES-EGFP (plasmid) | Clontech Laboratories | Used for HEK293T experiments to express human NaV1.5 | |
| Recombinant DNA reagent | pAAV-hSyn-DIO-hM4D(Gi)-mCherry (plasmid) | Addgene | Cat# 44362 | Used to replace hM4D(Gi)-mCherry with mouse HCN1 cDNAs |
| Recombinant DNA reagent | pAAV-hSyn-DIO-HA-HCN1-WT (plasmid) | This paper | Mouse HCN1 with N-terminal HA tag (YPYDVPDYA); AAV virus injection | |
| Recombinant DNA reagent | pAAV-hSyn-DIO-HA-HCN1-GD (plasmid) | This paper | Mouse HCN1-GD with N-terminal HA tag (YPYDVPDYA); AAV virus injection | |
| Recombinant DNA reagent | pAAV-hSyn-DIO-HA-HCN1-MI (plasmid) | This paper | mouse HCN1-MI with N-terminal HA tag (YPYDVPDYA); AAV virus injection | |
| Sequence-based reagent | crRNA for Hcn1GD | This paper | 5'-ACTGGATCAA AGCTGTGGCA-3' | |
| Sequence-based reagent | ssODN for Hcn1GD | This paper | 5'-CCCAAGCCCCTGTCAGCATGTCTGACCTCTGGATTACCATGCTGAGC ATGATTGTGGGCGCCACCTGCTACGCAATGTTTGTTGATCATGCCACAG CTTTGATCCAGTCTTTGGACTCTTCAAGGAG-3' | |
| Sequence-based reagent | crRNA for Hcn1MI | This paper | 5'-ATCATGCTTAT AATGATGGT-3' | |
| Sequence-based reagent | ssODN for Hcn1MI | This paper | 5'-ATCGGATGCCA CGTTGAAAATAATCCACGGTGTTGTCGTCTGCTCTGTGAAGAAC GTGATTCCAACTGGTATGATGACCAAATTTCCAACGATCATTATAA GCATGATTAAATCCCAATAAAACCTA-3' | |
| Sequence-based reagent | Hcn1GD WT forward primer | This paper | 5'-ACGGTGATGA CACTTGTTCAGT-3' | |
| Sequence-based reagent | Hcn1GD WT reverse primer | This paper | 5'-TGGATCAAAGCTGTGGCATGGC-3' | |
| Sequence-based reagent | Hcn1GD mutant forward primer | This paper | 5'-ACCTGCTACGC AATGTTTGTTGAT-3' | |
| Sequence-based reagent | Hcn1GD mutant reverse primer | This paper | 5'-GGCACTACA CGCTAGGAA-3' | |
| Sequence-based reagent | Hcn1MI forward primer | This paper | 5'-CAACATTTGTT TGTTCTCCTCACC-3' | |
| Sequence-based reagent | Hcn1MI reverse primer | This paper | 5'-ATGATCGAAT GCCACGTTGA-3' | |
| Software, algorithm | ImageJ | NIH | v1.49 | |
| Software, algorithm | Axograph X | Axograph Scientific | 1.7.6 | |
| Software, algorithm | MATLAB | MathWorks | R2022a | |
| Software, algorithm | Prism | GraphPad | v9.0.1 | |
| Software, algorithm | OriginPro | OriginLab | v2016 | |
| Software, algorithm | pClamp 10 | Molecular Devices | RRID:SCR_011323 | v10.7 |
| Software, algorithm | EZ Patch | Elements srl | v 1.2.3 | |
| Software, algorithm | TAC4.0 | Thermo Fisher Scientific | v4.0.2.15 | |
| Transfected construct (human) | HCN1 (cDNA) | Xention Ltd (Cambridge, UK) | HEK293T experiments | |
| Transfected construct (human) | NaV1.5 (cDNA) | PMID:33213388 | HEK293T experiments | |
| Transfected construct (mouse) | HCN1 (cDNA) | PMID:11331358 | Used to generate AAV virus construct and mutants thereof (see ‘Materials and methods’) | |
| Transfected construct (mouse) | HCN2 (cDNA) | PMID:11331358 | HEK293T experiments | |
| Transfected construct (mouse) | TRIP8b (cDNA) | PMID:19555649 | HEK293T experiments |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/70826/elife-70826-transrepform1-v2.pdf
-
Source code 1
MATLAB code to generate Figure 4A and C.
Source code used to plot typical examples of seizures, including the electrocorticogram (ECoG) trace and corresponding time–frequency spectrogram, using the custom written function plot_telemSz_andrea.
- https://cdn.elifesciences.org/articles/70826/elife-70826-code1-v2.docx
-
Source data 1
Microarray-based analysis of differential ion channel gene expression in Hcn1GD/+ and Hcn1MI/+ mice.
Average intensity (log2), fold change, p-value, and false discovery rate (FDR)-corrected p-value (considering all 22,206 probe sets) were derived using an Affymetrix-based screening of hippocampal tissue from Hcn1GD/+, Hcn1MI/+, and WT mice (n = 4 for each group) for 112 candidate genes, representing all main families of voltage-gated ion channels (see ‘Materials and methods’). Top 10 hits, ranked by p-value, are shown for each comparison. Values for GFAP and vimentin, two genes with an expected increase in hippocampal expression as a result of reactive gliosis (Figure 4—figure supplement 1, Escartin et al., 2021; Stringer, 1996), are also shown for reference. Note that both markers showed a nearly approximately twofold increase in Hcn1GD/+ animals (with FDR-corrected p-value<0.05 in the case of vimentin), while negligible changes were observed in Hcn1MI/+ animals.
- https://cdn.elifesciences.org/articles/70826/elife-70826-data1-v2.docx
