TMEM120A contains a specific coenzyme A-binding site and might not mediate poking- or stretch-induced channel activities in cells
- National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, China
- College of Life Sciences, University of Chinese Academy of Sciences, China
- State Key Laboratory of Membrane Biology; Tsinghua-Peking Center for Life Sciences; Beijing Advanced Innovation Center for Structural Biology; IDG/McGovern Institute for Brain Research; School of Pharmaceutical Sciences, Tsinghua University, China
- State Key Laboratory of Brain and Cognitive Science, Institute of Biophysics, Chinese Academy of Sciences, China
Figures
Figure 1 with 1 supplement
TMEM120A does not mediate poking- or stretch-induced currents in P1-KO-HEK cells.
(A) Representative poking-evoked whole-cell currents from P1-KO-HEK cells transfected with the indicated constructs. (B) Current-displacement curves showing poking-evoked whole-cell currents from …
-
Figure 1—source data 1
Source files for the electrophysiology data.
- https://cdn.elifesciences.org/articles/71474/elife-71474-fig1-data1-v2.zip
Figure 1—figure supplement 1
Representative excised inside-out patch recordings of HsTMEM120A reconstituted in GUVs.
(A) Traces of ion channel activities responding to the increase of negative pressure at both +80 and −80 mV. (B) A different patch of membrane exhibiting distinct behaviors of ion channel activities …
-
Figure 1—figure supplement 1—source data 1
Source file for the representative excised inside-out patch recordings shown in Figure 1—figure supplement 1 A.
- https://cdn.elifesciences.org/articles/71474/elife-71474-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
Source file for the representative excised inside-out patch recordings shown in Figure 1—figure supplement 1 B.
- https://cdn.elifesciences.org/articles/71474/elife-71474-fig1-figsupp1-data2-v2.zip
-
Figure 1—figure supplement 1—source data 3
Source file for the representative excised inside-out patch recordings shown in Figure 1—figure supplement 1 C.
- https://cdn.elifesciences.org/articles/71474/elife-71474-fig1-figsupp1-data3-v2.zip
Figure 2 with 1 supplement
Cryo-EM density and overall architecture of HsTMEM120A homodimer in complex with CoASH molecules.
(A) Cryo-electron microscopy (cryo-EM) density of HsTMEM120A-CoASH complex dimer embedded in a lipid nanodisc. The densities of two HsTMEM120A protein subunits are colored blue and pink, while those …
Figure 2—figure supplement 1
Sample preparation, cryo-EM data collection, and processing of the HsTMEM120A-CoASH complex reconstituted in nanodiscs.
(A) Size-exclusion chromatography of the HsTMEM120A-CoASH complex reconstituted in nanodiscs. The image of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of the peak …
-
Figure 2—figure supplement 1—source data 1
Source file for the gel image data shown in Figure 2–figure supplement 1A.
- https://cdn.elifesciences.org/articles/71474/elife-71474-fig2-figsupp1-data1-v2.zip
Figure 3 with 1 supplement
The membrane topology and domain structure of HsTMEM120A monomer.
(A) The topology of HsTMEM120A monomer and arrangement of different parts relative to the membrane. The α-helices are presented as cylinder models. IH1-3, the intracellular helices 1–3; TM1-6, …
Figure 3—figure supplement 1
Fitting of the structural model with the cryo-EM densities of various local regions of HsTMEM120A in nanodiscs.
The refined structural models superposed on the map are shown as stick models. The map is contoured at 6.7–13.1 rmsd level. TM2 (158–184), TM3 (191–209), TM4 (214–244), and EL2 (210–213), 13.1 rmsd; …
Figure 4 with 4 supplements
HsTMEM120A contains an internal CoASH-binding site within each monomer.
(A) Electrostatic potential surface presentation of HsTMEM120A dimer reveals a deep coenzyme A (CoASH)-binding cavity with an electropositive surface. Left, side view; right, top view along the membr…
Figure 4—figure supplement 1
Fitting of the cofactor density with various small-molecule models.
(A) Coenzyme A (CoASH). (B) Acetyl-CoA. The area in the dashed box indicates the local region with clashes between the acetyl group of acetyl-CoA model and Gly282-His283 region of the protein. (C) …
Figure 4—figure supplement 2
The conserved features of TMEM120A.
(A) Sequence alignment of HsTMEM120A with other homologs from different species. The highly conserved amino acid residues are highlighted in a dark background. The triangles denote the coenzyme A (Co…
Figure 4—figure supplement 3
Sequence alignment of HsTMEM120A with various TMEM120B orthologs.
Hs, Homo sapiens (NP_001074294.2); Mm, Mus musculus (NP_001034812.1); Gg, Gallus gallus (NP_001376307.1); Xl, Xenopus laevis (NP_001086700.1); Dr, Danio rerio (XP_005169279.1).
Figure 4—figure supplement 4
Analysis of CoASH-binding property of the W193A mutant of HsTMEM120A.
(A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analyses of the purified W193A protein. (B) Isothermal titration calorimetry (ITC) analysis of W193A protein …
-
Figure 4—figure supplement 4—source data 1
Source files for the ITC data, gel image, and western blot (Figure 4—figure supplement 4A,B).
- https://cdn.elifesciences.org/articles/71474/elife-71474-fig4-figsupp4-data1-v2.zip
Figure 5 with 2 supplements
Structure of HsTMEM120A at the CoASH-free state in comparison with the CoASH-bound state.
(A, B) The overall structure of HsTMEM120A without coenzyme A (CoASH) bound. The side view (A) and bottom view from intracellular side (B) are shown. The two monomers are colored light and dark …
Figure 5—figure supplement 1
Cryo-EM data collection and processing of HsTMEM120A protein purified in detergent micelle.
(A) The flow chart of data collection, 2D classification, 3D classification, and refinement process. A total of 12,156 movie stacks were collected, and a representative motion-corrected micrograph …
Figure 5—figure supplement 2
The occluded cavity of HsTMEM120A with CoASH bound in comparison with the open cavity without CoASH bound.
(A) Hole profiles of the coenzyme A (CoASH)-bound (left) and CoASH-free (right) HsTMEM120A structures. Red, pore radius < 1.15 Å; green, 1.15 Å < pore radius < 2.30 Å; blue, pore radius > 2.30 Å. …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | HsTMEM120A-pFastBac Dual | Synthetic/ Genscript | N/A | Custom-synthesized cDNA |
| Gene (H. sapiens) | HsTMEM120A-mCherry-pDEST | Yulong Li lab in Peking University | N/A | |
| Gene (Mus musculus) | MmTMEM120A-pEG BacMam | Synthetic | N/A | |
| Gene (M. musculus) | MmTMEM120A- pcDNA3.1 | Synthetic | N/A | FP: gccctctagactcgagcggccgcgccaccATGCAGTCCCCGCCCCCGGAC RP: GGCGCGCCAAGCTTCTAGTCCTTCTTGTTCCCGTGCTGCTGGCTG |
| Gene (M. musculus) | MmPiezo1-mRuby2 pcDNA3.1 | Zhao et al., 2018 | N/A | |
| Gene (M. musculus) | MmPiezo2-GST-ires-GFP pcDNA3.1 | Wang et al., 2019 | N/A | |
| Gene (H. sapiens) | HsTMEM63A-mCherry-pDEST | Yulong Li lab in Peking University | N/A | |
| Strain, strain background (Escherichia coli) | Turbo Chemically Competent Cell | AngYuBio | Cat# X17012 | |
| Strain, strain background (E. coli) | DH10Bac Chemically Competent Cell | AngYuBio | Cat# G6006 | |
| Cell line (Spodoptera frugiperda) | Sf9 | ATCC | Cat# CRL-1711 RRID:CVCL_0549 | |
| Cell line (H. sapiens) | HEK293T-Piezo1-KO | Cahalan et al., 2015 | N/A | |
| Antibody | THE NWSHPQFEK Tag Antibody [HRP] (mouse monoclonal) | Genscript | Cat# A01742 RRID:AB_2622218 | WB (1:10,000) |
| Recombinant DNA reagent | HsTMEM120A W193A-pFastBac Dual | This study | N/A | Construct made and maintained in Z Liu lab |
| Sequence-based reagent | W193A _Forward | Beijing Genomics Institution | PCR primers | CGTATCAAGGGTTGGGCCGTGTTCCACCACTAC |
| Sequence-based reagent | W193A_Reverse | Beijing Genomics Institution | PCR primers | GTAGTGGTGGAACACGGCCCAACCCTTGATACG |
| Chemical compound, drug | Cellfectin II Reagent | Gibco | Cat# 11605102 | |
| Chemical compound, drug | ESF 921 Insect Cell Culture Medium, Protein Free | Expression Systems | Cat# 96-001-01 | |
| Chemical compound, drug | Grace's Insect Medium, supplemented | Gibco | Cat# 11605102 | |
| Chemical compound, drug | n-Dodecyl-β-D-Maltopyranoside (β-DDM) | Anatrace | Cat# D310 | |
| Chemical compound, drug | Cholesteryl Hemisuccinate (CHS) | Anatrace | Cat# CH210 | |
| Chemical compound, drug | CHAPS | Anatrace | Cat# C316 | |
| Chemical compound, drug | GDN | Anatrace | Cat# GDN101 | |
| Chemical compound, drug | Streptavidin Beads 6FF | Smart Lifesciences | Cat# SA021100 | |
| Chemical compound, drug | d-Desthiobiotin | Sigma-Aldrich | Cat# D1411 | |
| Chemical compound, drug | 18:1 (Δ9-Cis) PE (DOPE) | Avanti | Cat# 850725 | Powder |
| Chemical compound, drug | 16:0-18:1 PS (POPS) | Avanti | Cat# 840034 | Powder |
| Chemical compound, drug | 16:0-18:1 PC (POPC) | Avanti | Cat# 850457 | Powder |
| Chemical compound, drug | Bio-Beads SM-2 adsorbents | Bio-Rad | Cat# 1523920 | |
| Chemical compound, drug | Perchloric acid | SCR | Cat# 10015160 | |
| Chemical compound, drug | Coenzyme A sodium salt hydrate | Sigma-Aldrich | Cat# C4780 | |
| Chemical compound, drug | Lipofectamine3000 transfection kit | ThermoFisher | Cat# L3000015 | |
| Chemical compound, drug | poly-D-lysine | Beyotime | Cat# C0312 | |
| Chemical compound, drug | L-α-phosphatidylcholine | Sigma-Aldrich | Cat# P3644 | Powder |
| Chemical compound, drug | Cholesterol | Sigma-Aldrich | Cat# C8667 | Powder |
| Chemical compound, drug | 4ME 16:0 PC (DPhPC) | Avanti | Cat# 850356 | Powder |
| Software, algorithm | Serial EM | http://bio3d.colorado.edu/SerialEM | RRID:SCR_017293 | https://doi.org/10.1016/j.jsb.2005.07.007 |
| Software, algorithm | MotionCor2 | http://msg.ucsf.edu/em/software/motioncor2.html | RRID:SCR_016499 | https://doi.org/10.1038/nmeth.4193 |
| Software, algorithm | CTFFIND 4.1.10 | http://grigoriefflab.janelia.org/ctffind4 | RRID:SCR_016732 | https://doi.org/10.1016/j.jsb.2015.08.008 |
| Software, algorithm | cryoSPARC v3.1 | https://cryosparc.com/ | RRID:SCR_016501 | https://doi.org/10.1038/nmeth.4169 |
| Software, algorithm | Chimera | https://www.cgl.ucsf.edu/chimera/download.html | RRID:SCR_004097 | https://doi.org/10.1002/jcc.20084 |
| Software, algorithm | Gctf | https://www.mrclmb.cam.ac.uk/kzhang/Gctf/ | RRID:SCR_016500 | https://doi.org/10.1016/j.jsb.2015.11.003 |
| Software, algorithm | Gautomatch | https://hpc.nih.gov/apps/gautomatch.html | N/A | http://www.mrc-lmb.cam.ac.uk/kzhang/ |
| Software, algorithm | Topaz | http://cb.csail.mit.edu/cb/topaz/ | N/A | https://doi.org/10.1038/s41592-019-0575-8 |
| Software, algorithm | cisTEM | https://cistem.org/ | RRID:SCR_016502 | https://doi.org/10.7554/eLife.35383 |
| Software, algorithm | MonoRes | http://scipion.i2pc.es/ | N/A | https://doi.org/10.1016/j.str.2017.12.018 |
| Software, algorithm | COOT 0.8.9 | http://www2.mrclmb.cam.ac.uk/personal/pemsley/coot | RRID:SCR_014222 | https://doi.org/10.1107/S0907444910007493 |
| Software, algorithm | PSIPRED 4.0 | http://bioinf.cs.ucl.ac.uk/psipred | RRID:SCR_010246 | https://doi.org/10.1093/nar/gkz297 |
| Software, algorithm | PHENIX | https://www.phenix-online.org | RRID:SCR_014224 | https://doi.org/10.1107/S0907444909052925 |
| Software, algorithm | HOLE | http://www.holeprogram.org/ | N/A | https://doi.org/10.1016/s0263-7855(97)00009-x |
| Software, algorithm | ChimeraX | https://www.rbvi.ucsf.edu/chimerax/ | RRID:SCR_015872 | https://doi.org/10.1002/pro.3943 |
| Software, algorithm | PyMol 2.1.1 | Schrödinger, LLC | RRID:SCR_000305 | https://pymol.org/ |
| Software, algorithm | Peakview 2.1 | https://sciex.com/products/software/peakview-software | RRID:SCR_015786 | |
| Software, algorithm | MicroCal ITC200 | https://www.malvernpanalytical.com/ | RRID:SCR_020260 | |
| Software, algorithm | ESPript 3 | https://espript.ibcp.fr | RRID:SCR_006587 | https://doi.org/10.1093/nar/gku316 |
| Software, algorithm | T-COFFEE | http://tcoffee.crg.cat/apps/tcoffee/index.html | RRID:SCR_019024 | https://doi.org/10.1006/jmbi.2000.4042 |
| Software, algorithm | The ConSurf Server | https://consurf.tau.ac.il/ | RRID:SCR_002320 | https://doi.org/10.1093/nar/gkw408 |
| Software, algorithm | VMD 1.9.3 | https://www.ks.uiuc.edu/Research/vmd/ | RRID:SCR_001820 | |
| Software, algorithm | PatchMaster | HEKA http://www.heka.com/downloads/downloads_main.html#down_patchmaster | RRID:SCR_000034 | |
| Software, algorithm | GraphPad Prism | GraphPad Software Inc http://www.graphpad.com/scientific-software/prism/ | RRID:SCR_002798 | |
| Software, algorithm | Origin 9.2 | OriginLab http://www.originlab.com/ | RRID:SCR_014212 | |
| Software, algorithm | Igor Pro | WaveMetrics https://www.wavemetrics.com/ | RRID:SCR_000325 | |
| Other | Structural model of human TMEM120A in the CoASH-bound state and the corresponding cryo-EM map | This study | PDB ID 7F3T, EMD-31440 | Available for download in the webpage https://www.rcsb.org/structure/7F3T |
| Other | Structural model of human TMEM120A in the CoASH-free state and the corresponding cryo-EM map | This study | PDB ID 7F3U, EMD-31441 | Available for download in the webpage https://www.rcsb.org/structure/7F3U |
| Other | R1.2/1.3 100 Holey Carbon Films Cu 200 mesh | Quantifoil | Cat# Q56244 | |
| Other | R1.2/1.3 100 Holey Carbon Films Cu 300 mesh | Quantifoil | Cat# Q55987 | |
| Other | Immobilon-PSQtransfer membrane | Merck Millipore | Cat# ISEQ00010 | Filter type: PVDF |
Additional files
-
Supplementary file 1
Cryo-EM data collection and processing, refinement, and validation statistics of HsTMEM120A structures.
- https://cdn.elifesciences.org/articles/71474/elife-71474-supp1-v2.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/71474/elife-71474-transrepform-v2.docx
